diff --git a/.github/workflows/pypi.yml b/.github/workflows/pypi.yml new file mode 100644 index 0000000..667260d --- /dev/null +++ b/.github/workflows/pypi.yml @@ -0,0 +1,135 @@ +name: Upload to PyPI + +on: + release: + types: [published] + +permissions: + contents: read + +jobs: + linux: + runs-on: ${{ matrix.platform.runner }} + strategy: + matrix: + platform: + - runner: ubuntu-latest + target: x86_64 + - runner: ubuntu-latest + target: x86 + - runner: ubuntu-latest + target: aarch64 + steps: + - uses: actions/checkout@v4 + - uses: actions/setup-python@v5 + with: + python-version: 3.x + - name: Build wheels + uses: PyO3/maturin-action@v1 + with: + target: ${{ matrix.platform.target }} + args: --release --out dist --find-interpreter + sccache: 'true' + manylinux: auto + - name: Upload wheels + uses: actions/upload-artifact@v4 + with: + name: wheels-linux-${{ matrix.platform.target }} + path: dist + + musllinux: + runs-on: ${{ matrix.platform.runner }} + strategy: + matrix: + platform: + - runner: ubuntu-latest + target: x86_64 + - runner: ubuntu-latest + target: x86 + - runner: ubuntu-latest + target: aarch64 + steps: + - uses: actions/checkout@v4 + - uses: actions/setup-python@v5 + with: + python-version: 3.x + - name: Build wheels + uses: PyO3/maturin-action@v1 + with: + target: ${{ matrix.platform.target }} + args: --release --out dist --find-interpreter + sccache: 'true' + manylinux: musllinux_1_2 + - name: Upload wheels + uses: actions/upload-artifact@v4 + with: + name: wheels-musllinux-${{ matrix.platform.target }} + path: dist + + windows: + runs-on: ${{ matrix.platform.runner }} + strategy: + matrix: + platform: + - runner: windows-latest + target: x64 + - runner: windows-latest + target: x86 + steps: + - uses: actions/checkout@v4 + - uses: actions/setup-python@v5 + with: + python-version: 3.x + architecture: ${{ matrix.platform.target }} + - name: Build wheels + uses: PyO3/maturin-action@v1 + with: + target: ${{ matrix.platform.target }} + args: --release --out dist --find-interpreter + sccache: 'true' + - name: Upload wheels + uses: actions/upload-artifact@v4 + with: + name: wheels-windows-${{ matrix.platform.target }} + path: dist + + macos: + runs-on: ${{ matrix.platform.runner }} + strategy: + matrix: + platform: + - runner: macos-12 + target: x86_64 + - runner: macos-14 + target: aarch64 + steps: + - uses: actions/checkout@v4 + - uses: actions/setup-python@v5 + with: + python-version: 3.x + - name: Build wheels + uses: PyO3/maturin-action@v1 + with: + target: ${{ matrix.platform.target }} + args: --release --out dist --find-interpreter + sccache: 'true' + - name: Upload wheels + uses: actions/upload-artifact@v4 + with: + name: wheels-macos-${{ matrix.platform.target }} + path: dist + + + release: + name: Release + runs-on: ubuntu-latest + needs: [linux, musllinux, windows, macos] + steps: + - uses: actions/download-artifact@v4 + - name: Publish to PyPI + uses: PyO3/maturin-action@v1 + env: + MATURIN_PYPI_TOKEN: ${{ secrets.PYPI_API_TOKEN }} + with: + command: upload + args: --non-interactive --skip-existing wheels-*/* diff --git a/.github/workflows/rust_test.yml b/.github/workflows/rust_test.yml new file mode 100644 index 0000000..0a39390 --- /dev/null +++ b/.github/workflows/rust_test.yml @@ -0,0 +1,24 @@ +name: Cargo tests + +on: + push: + branches: [ "main" ] + pull_request: + branches: [ "main" ] + +env: + CARGO_TERM_COLOR: always + +jobs: + build: + + runs-on: ubuntu-latest + + steps: + - uses: actions/checkout@v4 + + - name: Build + run: cargo build --verbose + + - name: Run tests + run: cargo test --verbose diff --git a/.gitignore b/.gitignore new file mode 100644 index 0000000..493c961 --- /dev/null +++ b/.gitignore @@ -0,0 +1,74 @@ +/target + +# Byte-compiled / optimized / DLL files +__pycache__/ +.pytest_cache/ +*.py[cod] + +# C extensions +*.so + +# Distribution / packaging +.Python +.venv/ +env/ +bin/ +build/ +develop-eggs/ +dist/ +eggs/ +lib/ +lib64/ +parts/ +sdist/ +var/ +include/ +man/ +venv/ +*.egg-info/ +.installed.cfg +*.egg + +# Installer logs +pip-log.txt +pip-delete-this-directory.txt +pip-selfcheck.json + +# Unit test / coverage reports +htmlcov/ +.tox/ +.coverage +.cache +nosetests.xml +coverage.xml + +# Translations +*.mo + +# Mr Developer +.mr.developer.cfg +.project +.pydevproject + +# Rope +.ropeproject + +# Django stuff: +*.log +*.pot + +.DS_Store + +# Sphinx documentation +docs/_build/ + +# PyCharm +.idea/ + +# VSCode +.vscode/ + +# Pyenv +.python-version + +.pytest* \ No newline at end of file diff --git a/Cargo.lock b/Cargo.lock new file mode 100644 index 0000000..499ae46 --- /dev/null +++ b/Cargo.lock @@ -0,0 +1,887 @@ +# This file is automatically @generated by Cargo. +# It is not intended for manual editing. +version = 3 + +[[package]] +name = "adler2" +version = "2.0.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "512761e0bb2578dd7380c6baaa0f4ce03e84f95e960231d1dec8bf4d7d6e2627" + +[[package]] +name = "aho-corasick" +version = "1.1.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "8e60d3430d3a69478ad0993f19238d2df97c507009a52b3c10addcd7f6bcb916" +dependencies = [ + "memchr", +] + +[[package]] +name = "anyhow" +version = "1.0.86" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b3d1d046238990b9cf5bcde22a3fb3584ee5cf65fb2765f454ed428c7a0063da" + +[[package]] +name = "approx" +version = "0.5.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "cab112f0a86d568ea0e627cc1d6be74a1e9cd55214684db5561995f6dad897c6" +dependencies = [ + "num-traits", +] + +[[package]] +name = "autocfg" +version = "1.3.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "0c4b4d0bd25bd0b74681c0ad21497610ce1b7c91b1022cd21c80c6fbdd9476b0" + +[[package]] +name = "bio" +version = "2.0.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e8cbd545253762ecf9ef741f2c49f07c06a0ce4d041d74ee9c3f1ce0e2d5446e" +dependencies = [ + "anyhow", + "approx", + "bio-types", + "bit-set", + "bv", + "bytecount", + "csv", + "custom_derive", + "editdistancek", + "enum-map", + "fxhash", + "itertools", + "itertools-num", + "lazy_static", + "multimap", + "ndarray", + "newtype_derive", + "num-integer", + "num-traits", + "ordered-float", + "petgraph", + "rand", + "regex", + "serde", + "serde_derive", + "statrs", + "strum", + "strum_macros", + "thiserror", + "triple_accel", + "vec_map", +] + +[[package]] +name = "bio-types" +version = "1.0.4" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f4dcf54f8b7f51450207d54780bab09c05f30b8b0caa991545082842e466ad7e" +dependencies = [ + "derive-new", + "lazy_static", + "regex", + "strum_macros", + "thiserror", +] + +[[package]] +name = "bit-set" +version = "0.8.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "08807e080ed7f9d5433fa9b275196cfc35414f66a0c79d864dc51a0d825231a3" +dependencies = [ + "bit-vec", +] + +[[package]] +name = "bit-vec" +version = "0.8.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5e764a1d40d510daf35e07be9eb06e75770908c27d411ee6c92109c9840eaaf7" + +[[package]] +name = "bv" +version = "0.11.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "8834bb1d8ee5dc048ee3124f2c7c1afcc6bc9aed03f11e9dfd8c69470a5db340" +dependencies = [ + "feature-probe", + "serde", +] + +[[package]] +name = "bytecount" +version = "0.6.8" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5ce89b21cab1437276d2650d57e971f9d548a2d9037cc231abdc0562b97498ce" + +[[package]] +name = "bytemuck" +version = "1.17.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "773d90827bc3feecfb67fab12e24de0749aad83c74b9504ecde46237b5cd24e2" + +[[package]] +name = "byteorder" +version = "1.5.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "1fd0f2584146f6f2ef48085050886acf353beff7305ebd1ae69500e27c67f64b" + +[[package]] +name = "cfg-if" +version = "1.0.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "baf1de4339761588bc0619e3cbc0120ee582ebb74b53b4efbf79117bd2da40fd" + +[[package]] +name = "crc32fast" +version = "1.4.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "a97769d94ddab943e4510d138150169a2758b5ef3eb191a9ee688de3e23ef7b3" +dependencies = [ + "cfg-if", +] + +[[package]] +name = "csv" +version = "1.3.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "ac574ff4d437a7b5ad237ef331c17ccca63c46479e5b5453eb8e10bb99a759fe" +dependencies = [ + "csv-core", + "itoa", + "ryu", + "serde", +] + +[[package]] +name = "csv-core" +version = "0.1.11" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5efa2b3d7902f4b634a20cae3c9c4e6209dc4779feb6863329607560143efa70" +dependencies = [ + "memchr", +] + +[[package]] +name = "custom_derive" +version = "0.1.7" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "ef8ae57c4978a2acd8b869ce6b9ca1dfe817bff704c220209fdef2c0b75a01b9" + +[[package]] +name = "derive-new" +version = "0.6.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "d150dea618e920167e5973d70ae6ece4385b7164e0d799fe7c122dd0a5d912ad" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "editdistancek" +version = "1.0.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "3e02df23d5b1c6f9e69fa603b890378123b93073df998a21e6e33b9db0a32613" + +[[package]] +name = "either" +version = "1.13.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "60b1af1c220855b6ceac025d3f6ecdd2b7c4894bfe9cd9bda4fbb4bc7c0d4cf0" + +[[package]] +name = "enum-map" +version = "2.7.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "6866f3bfdf8207509a033af1a75a7b08abda06bbaaeae6669323fd5a097df2e9" +dependencies = [ + "enum-map-derive", +] + +[[package]] +name = "enum-map-derive" +version = "0.17.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f282cfdfe92516eb26c2af8589c274c7c17681f5ecc03c18255fe741c6aa64eb" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "equivalent" +version = "1.0.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5443807d6dff69373d433ab9ef5378ad8df50ca6298caf15de6e52e24aaf54d5" + +[[package]] +name = "feature-probe" +version = "0.1.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "835a3dc7d1ec9e75e2b5fb4ba75396837112d2060b03f7d43bc1897c7f7211da" + +[[package]] +name = "fixedbitset" +version = "0.4.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "0ce7134b9999ecaf8bcd65542e436736ef32ddca1b3e06094cb6ec5755203b80" + +[[package]] +name = "flate2" +version = "1.0.33" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "324a1be68054ef05ad64b861cc9eaf1d623d2d8cb25b4bf2cb9cdd902b4bf253" +dependencies = [ + "crc32fast", + "miniz_oxide", +] + +[[package]] +name = "fxhash" +version = "0.2.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c31b6d751ae2c7f11320402d34e41349dd1016f8d5d45e48c4312bc8625af50c" +dependencies = [ + "byteorder", +] + +[[package]] +name = "getrandom" +version = "0.2.15" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c4567c8db10ae91089c99af84c68c38da3ec2f087c3f82960bcdbf3656b6f4d7" +dependencies = [ + "cfg-if", + "libc", + "wasi", +] + +[[package]] +name = "hashbrown" +version = "0.14.5" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e5274423e17b7c9fc20b6e7e208532f9b19825d82dfd615708b70edd83df41f1" + +[[package]] +name = "heck" +version = "0.5.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "2304e00983f87ffb38b55b444b5e3b60a884b5d30c0fca7d82fe33449bbe55ea" + +[[package]] +name = "indexmap" +version = "2.4.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "93ead53efc7ea8ed3cfb0c79fc8023fbb782a5432b52830b6518941cebe6505c" +dependencies = [ + "equivalent", + "hashbrown", +] + +[[package]] +name = "indoc" +version = "2.0.5" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b248f5224d1d606005e02c97f5aa4e88eeb230488bcc03bc9ca4d7991399f2b5" + +[[package]] +name = "itertools" +version = "0.13.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "413ee7dfc52ee1a4949ceeb7dbc8a33f2d6c088194d9f922fb8318faf1f01186" +dependencies = [ + "either", +] + +[[package]] +name = "itertools-num" +version = "0.1.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "a872a22f9e6f7521ca557660adb96dd830e54f0f490fa115bb55dd69d38b27e7" +dependencies = [ + "num-traits", +] + +[[package]] +name = "itoa" +version = "1.0.11" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "49f1f14873335454500d59611f1cf4a4b0f786f9ac11f4312a78e4cf2566695b" + +[[package]] +name = "lazy_static" +version = "1.5.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "bbd2bcb4c963f2ddae06a2efc7e9f3591312473c50c6685e1f298068316e66fe" + +[[package]] +name = "libc" +version = "0.2.158" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "d8adc4bb1803a324070e64a98ae98f38934d91957a99cfb3a43dcbc01bc56439" + +[[package]] +name = "libm" +version = "0.2.8" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "4ec2a862134d2a7d32d7983ddcdd1c4923530833c9f2ea1a44fc5fa473989058" + +[[package]] +name = "matrixmultiply" +version = "0.3.9" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "9380b911e3e96d10c1f415da0876389aaf1b56759054eeb0de7df940c456ba1a" +dependencies = [ + "autocfg", + "rawpointer", +] + +[[package]] +name = "memchr" +version = "2.7.4" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "78ca9ab1a0babb1e7d5695e3530886289c18cf2f87ec19a575a0abdce112e3a3" + +[[package]] +name = "memoffset" +version = "0.9.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "488016bfae457b036d996092f6cb448677611ce4449e970ceaf42695203f218a" +dependencies = [ + "autocfg", +] + +[[package]] +name = "miniz_oxide" +version = "0.8.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e2d80299ef12ff69b16a84bb182e3b9df68b5a91574d3d4fa6e41b65deec4df1" +dependencies = [ + "adler2", +] + +[[package]] +name = "multimap" +version = "0.10.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "defc4c55412d89136f966bbb339008b474350e5e6e78d2714439c386b3137a03" +dependencies = [ + "serde", +] + +[[package]] +name = "nalgebra" +version = "0.32.6" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "7b5c17de023a86f59ed79891b2e5d5a94c705dbe904a5b5c9c952ea6221b03e4" +dependencies = [ + "approx", + "matrixmultiply", + "nalgebra-macros", + "num-complex", + "num-rational", + "num-traits", + "rand", + "rand_distr", + "simba", + "typenum", +] + +[[package]] +name = "nalgebra-macros" +version = "0.2.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "254a5372af8fc138e36684761d3c0cdb758a4410e938babcff1c860ce14ddbfc" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "ndarray" +version = "0.15.6" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "adb12d4e967ec485a5f71c6311fe28158e9d6f4bc4a447b474184d0f91a8fa32" +dependencies = [ + "matrixmultiply", + "num-complex", + "num-integer", + "num-traits", + "rawpointer", +] + +[[package]] +name = "newtype_derive" +version = "0.1.6" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "ac8cd24d9f185bb7223958d8c1ff7a961b74b1953fd05dba7cc568a63b3861ec" +dependencies = [ + "rustc_version", +] + +[[package]] +name = "num-complex" +version = "0.4.6" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "73f88a1307638156682bada9d7604135552957b7818057dcef22705b4d509495" +dependencies = [ + "num-traits", +] + +[[package]] +name = "num-integer" +version = "0.1.46" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "7969661fd2958a5cb096e56c8e1ad0444ac2bbcd0061bd28660485a44879858f" +dependencies = [ + "num-traits", +] + +[[package]] +name = "num-rational" +version = "0.4.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f83d14da390562dca69fc84082e73e548e1ad308d24accdedd2720017cb37824" +dependencies = [ + "num-integer", + "num-traits", +] + +[[package]] +name = "num-traits" +version = "0.2.19" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "071dfc062690e90b734c0b2273ce72ad0ffa95f0c74596bc250dcfd960262841" +dependencies = [ + "autocfg", + "libm", +] + +[[package]] +name = "once_cell" +version = "1.19.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "3fdb12b2476b595f9358c5161aa467c2438859caa136dec86c26fdd2efe17b92" + +[[package]] +name = "ordered-float" +version = "4.2.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "4a91171844676f8c7990ce64959210cd2eaef32c2612c50f9fae9f8aaa6065a6" +dependencies = [ + "num-traits", +] + +[[package]] +name = "paste" +version = "1.0.15" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "57c0d7b74b563b49d38dae00a0c37d4d6de9b432382b2892f0574ddcae73fd0a" + +[[package]] +name = "petgraph" +version = "0.6.5" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b4c5cc86750666a3ed20bdaf5ca2a0344f9c67674cae0515bec2da16fbaa47db" +dependencies = [ + "fixedbitset", + "indexmap", +] + +[[package]] +name = "portable-atomic" +version = "1.7.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "da544ee218f0d287a911e9c99a39a8c9bc8fcad3cb8db5959940044ecfc67265" + +[[package]] +name = "ppv-lite86" +version = "0.2.20" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "77957b295656769bb8ad2b6a6b09d897d94f05c41b069aede1fcdaa675eaea04" +dependencies = [ + "zerocopy", +] + +[[package]] +name = "proc-macro2" +version = "1.0.86" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5e719e8df665df0d1c8fbfd238015744736151d4445ec0836b8e628aae103b77" +dependencies = [ + "unicode-ident", +] + +[[package]] +name = "pyo3" +version = "0.22.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "831e8e819a138c36e212f3af3fd9eeffed6bf1510a805af35b0edee5ffa59433" +dependencies = [ + "cfg-if", + "indoc", + "libc", + "memoffset", + "once_cell", + "portable-atomic", + "pyo3-build-config", + "pyo3-ffi", + "pyo3-macros", + "unindent", +] + +[[package]] +name = "pyo3-build-config" +version = "0.22.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "1e8730e591b14492a8945cdff32f089250b05f5accecf74aeddf9e8272ce1fa8" +dependencies = [ + "once_cell", + "target-lexicon", +] + +[[package]] +name = "pyo3-ffi" +version = "0.22.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "5e97e919d2df92eb88ca80a037969f44e5e70356559654962cbb3316d00300c6" +dependencies = [ + "libc", + "pyo3-build-config", +] + +[[package]] +name = "pyo3-macros" +version = "0.22.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "eb57983022ad41f9e683a599f2fd13c3664d7063a3ac5714cae4b7bee7d3f206" +dependencies = [ + "proc-macro2", + "pyo3-macros-backend", + "quote", + "syn", +] + +[[package]] +name = "pyo3-macros-backend" +version = "0.22.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "ec480c0c51ddec81019531705acac51bcdbeae563557c982aa8263bb96880372" +dependencies = [ + "heck", + "proc-macro2", + "pyo3-build-config", + "quote", + "syn", +] + +[[package]] +name = "quote" +version = "1.0.37" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b5b9d34b8991d19d98081b46eacdd8eb58c6f2b201139f7c5f643cc155a633af" +dependencies = [ + "proc-macro2", +] + +[[package]] +name = "rand" +version = "0.8.5" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "34af8d1a0e25924bc5b7c43c079c942339d8f0a8b57c39049bef581b46327404" +dependencies = [ + "libc", + "rand_chacha", + "rand_core", +] + +[[package]] +name = "rand_chacha" +version = "0.3.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "e6c10a63a0fa32252be49d21e7709d4d4baf8d231c2dbce1eaa8141b9b127d88" +dependencies = [ + "ppv-lite86", + "rand_core", +] + +[[package]] +name = "rand_core" +version = "0.6.4" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "ec0be4795e2f6a28069bec0b5ff3e2ac9bafc99e6a9a7dc3547996c5c816922c" +dependencies = [ + "getrandom", +] + +[[package]] +name = "rand_distr" +version = "0.4.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "32cb0b9bc82b0a0876c2dd994a7e7a2683d3e7390ca40e6886785ef0c7e3ee31" +dependencies = [ + "num-traits", + "rand", +] + +[[package]] +name = "rawpointer" +version = "0.2.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "60a357793950651c4ed0f3f52338f53b2f809f32d83a07f72909fa13e4c6c1e3" + +[[package]] +name = "regex" +version = "1.10.6" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "4219d74c6b67a3654a9fbebc4b419e22126d13d2f3c4a07ee0cb61ff79a79619" +dependencies = [ + "aho-corasick", + "memchr", + "regex-automata", + "regex-syntax", +] + +[[package]] +name = "regex-automata" +version = "0.4.7" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "38caf58cc5ef2fed281f89292ef23f6365465ed9a41b7a7754eb4e26496c92df" +dependencies = [ + "aho-corasick", + "memchr", + "regex-syntax", +] + +[[package]] +name = "regex-syntax" +version = "0.8.4" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "7a66a03ae7c801facd77a29370b4faec201768915ac14a721ba36f20bc9c209b" + +[[package]] +name = "rsbio-seq" +version = "0.1.0" +dependencies = [ + "bio", + "flate2", + "pyo3", +] + +[[package]] +name = "rustc_version" +version = "0.1.7" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c5f5376ea5e30ce23c03eb77cbe4962b988deead10910c372b226388b594c084" +dependencies = [ + "semver", +] + +[[package]] +name = "rustversion" +version = "1.0.17" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "955d28af4278de8121b7ebeb796b6a45735dc01436d898801014aced2773a3d6" + +[[package]] +name = "ryu" +version = "1.0.18" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f3cb5ba0dc43242ce17de99c180e96db90b235b8a9fdc9543c96d2209116bd9f" + +[[package]] +name = "safe_arch" +version = "0.7.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c3460605018fdc9612bce72735cba0d27efbcd9904780d44c7e3a9948f96148a" +dependencies = [ + "bytemuck", +] + +[[package]] +name = "semver" +version = "0.1.20" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "d4f410fedcf71af0345d7607d246e7ad15faaadd49d240ee3b24e5dc21a820ac" + +[[package]] +name = "serde" +version = "1.0.209" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "99fce0ffe7310761ca6bf9faf5115afbc19688edd00171d81b1bb1b116c63e09" +dependencies = [ + "serde_derive", +] + +[[package]] +name = "serde_derive" +version = "1.0.209" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "a5831b979fd7b5439637af1752d535ff49f4860c0f341d1baeb6faf0f4242170" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "simba" +version = "0.8.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "061507c94fc6ab4ba1c9a0305018408e312e17c041eb63bef8aa726fa33aceae" +dependencies = [ + "approx", + "num-complex", + "num-traits", + "paste", + "wide", +] + +[[package]] +name = "statrs" +version = "0.17.1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f697a07e4606a0a25c044de247e583a330dbb1731d11bc7350b81f48ad567255" +dependencies = [ + "approx", + "nalgebra", + "num-traits", + "rand", +] + +[[package]] +name = "strum" +version = "0.26.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "8fec0f0aef304996cf250b31b5a10dee7980c85da9d759361292b8bca5a18f06" + +[[package]] +name = "strum_macros" +version = "0.26.4" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "4c6bee85a5a24955dc440386795aa378cd9cf82acd5f764469152d2270e581be" +dependencies = [ + "heck", + "proc-macro2", + "quote", + "rustversion", + "syn", +] + +[[package]] +name = "syn" +version = "2.0.76" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "578e081a14e0cefc3279b0472138c513f37b41a08d5a3cca9b6e4e8ceb6cd525" +dependencies = [ + "proc-macro2", + "quote", + "unicode-ident", +] + +[[package]] +name = "target-lexicon" +version = "0.12.16" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "61c41af27dd6d1e27b1b16b489db798443478cef1f06a660c96db617ba5de3b1" + +[[package]] +name = "thiserror" +version = "1.0.63" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c0342370b38b6a11b6cc11d6a805569958d54cfa061a29969c3b5ce2ea405724" +dependencies = [ + "thiserror-impl", +] + +[[package]] +name = "thiserror-impl" +version = "1.0.63" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "a4558b58466b9ad7ca0f102865eccc95938dca1a74a856f2b57b6629050da261" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] + +[[package]] +name = "triple_accel" +version = "0.4.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "22048bc95dfb2ffd05b1ff9a756290a009224b60b2f0e7525faeee7603851e63" + +[[package]] +name = "typenum" +version = "1.17.0" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "42ff0bf0c66b8238c6f3b578df37d0b7848e55df8577b3f74f92a69acceeb825" + +[[package]] +name = "unicode-ident" +version = "1.0.12" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "3354b9ac3fae1ff6755cb6db53683adb661634f67557942dea4facebec0fee4b" + +[[package]] +name = "unindent" +version = "0.2.3" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "c7de7d73e1754487cb58364ee906a499937a0dfabd86bcb980fa99ec8c8fa2ce" + +[[package]] +name = "vec_map" +version = "0.8.2" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "f1bddf1187be692e79c5ffeab891132dfb0f236ed36a43c7ed39f1165ee20191" +dependencies = [ + "serde", +] + +[[package]] +name = "wasi" +version = "0.11.0+wasi-snapshot-preview1" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "9c8d87e72b64a3b4db28d11ce29237c246188f4f51057d65a7eab63b7987e423" + +[[package]] +name = "wide" +version = "0.7.28" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "b828f995bf1e9622031f8009f8481a85406ce1f4d4588ff746d872043e855690" +dependencies = [ + "bytemuck", + "safe_arch", +] + +[[package]] +name = "zerocopy" +version = "0.7.35" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "1b9b4fd18abc82b8136838da5d50bae7bdea537c574d8dc1a34ed098d6c166f0" +dependencies = [ + "byteorder", + "zerocopy-derive", +] + +[[package]] +name = "zerocopy-derive" +version = "0.7.35" +source = "registry+https://github.com/rust-lang/crates.io-index" +checksum = "fa4f8080344d4671fb4e831a13ad1e68092748387dfc4f55e356242fae12ce3e" +dependencies = [ + "proc-macro2", + "quote", + "syn", +] diff --git a/Cargo.toml b/Cargo.toml new file mode 100644 index 0000000..644d8bf --- /dev/null +++ b/Cargo.toml @@ -0,0 +1,18 @@ +[package] +name = "rsbio-seq" +version = "0.1.0" +edition = "2021" +authors = ["Anuradha Wickramarachchi "] +description = "RSBio-Seq is a python wrapper for rust bio crate to provide fast sequence reading." +readme = "README.md" +license-file = "LICENSE" + +# See more keys and their definitions at https://doc.rust-lang.org/cargo/reference/manifest.html +[lib] +name = "rsbio_seq" +crate-type = ["cdylib"] + +[dependencies] +bio = "2.0.1" +flate2 = "1.0.33" +pyo3 = { version = "0.22.0", features = ["abi3-py39"] } diff --git a/LICENSE b/LICENSE new file mode 100644 index 0000000..f288702 --- /dev/null +++ b/LICENSE @@ -0,0 +1,674 @@ + GNU GENERAL PUBLIC LICENSE + Version 3, 29 June 2007 + + Copyright (C) 2007 Free Software Foundation, Inc. + Everyone is permitted to copy and distribute verbatim copies + of this license document, but changing it is not allowed. + + Preamble + + The GNU General Public License is a free, copyleft license for +software and other kinds of works. + + The licenses for most software and other practical works are designed +to take away your freedom to share and change the works. By contrast, +the GNU General Public License is intended to guarantee your freedom to +share and change all versions of a program--to make sure it remains free +software for all its users. We, the Free Software Foundation, use the +GNU General Public License for most of our software; it applies also to +any other work released this way by its authors. You can apply it to +your programs, too. + + When we speak of free software, we are referring to freedom, not +price. Our General Public Licenses are designed to make sure that you +have the freedom to distribute copies of free software (and charge for +them if you wish), that you receive source code or can get it if you +want it, that you can change the software or use pieces of it in new +free programs, and that you know you can do these things. + + To protect your rights, we need to prevent others from denying you +these rights or asking you to surrender the rights. Therefore, you have +certain responsibilities if you distribute copies of the software, or if +you modify it: responsibilities to respect the freedom of others. + + For example, if you distribute copies of such a program, whether +gratis or for a fee, you must pass on to the recipients the same +freedoms that you received. You must make sure that they, too, receive +or can get the source code. And you must show them these terms so they +know their rights. + + Developers that use the GNU GPL protect your rights with two steps: +(1) assert copyright on the software, and (2) offer you this License +giving you legal permission to copy, distribute and/or modify it. + + For the developers' and authors' protection, the GPL clearly explains +that there is no warranty for this free software. For both users' and +authors' sake, the GPL requires that modified versions be marked as +changed, so that their problems will not be attributed erroneously to +authors of previous versions. + + Some devices are designed to deny users access to install or run +modified versions of the software inside them, although the manufacturer +can do so. This is fundamentally incompatible with the aim of +protecting users' freedom to change the software. The systematic +pattern of such abuse occurs in the area of products for individuals to +use, which is precisely where it is most unacceptable. Therefore, we +have designed this version of the GPL to prohibit the practice for those +products. If such problems arise substantially in other domains, we +stand ready to extend this provision to those domains in future versions +of the GPL, as needed to protect the freedom of users. + + Finally, every program is threatened constantly by software patents. +States should not allow patents to restrict development and use of +software on general-purpose computers, but in those that do, we wish to +avoid the special danger that patents applied to a free program could +make it effectively proprietary. To prevent this, the GPL assures that +patents cannot be used to render the program non-free. + + The precise terms and conditions for copying, distribution and +modification follow. + + TERMS AND CONDITIONS + + 0. Definitions. + + "This License" refers to version 3 of the GNU General Public License. + + "Copyright" also means copyright-like laws that apply to other kinds of +works, such as semiconductor masks. + + "The Program" refers to any copyrightable work licensed under this +License. Each licensee is addressed as "you". "Licensees" and +"recipients" may be individuals or organizations. + + To "modify" a work means to copy from or adapt all or part of the work +in a fashion requiring copyright permission, other than the making of an +exact copy. The resulting work is called a "modified version" of the +earlier work or a work "based on" the earlier work. + + A "covered work" means either the unmodified Program or a work based +on the Program. + + To "propagate" a work means to do anything with it that, without +permission, would make you directly or secondarily liable for +infringement under applicable copyright law, except executing it on a +computer or modifying a private copy. Propagation includes copying, +distribution (with or without modification), making available to the +public, and in some countries other activities as well. + + To "convey" a work means any kind of propagation that enables other +parties to make or receive copies. Mere interaction with a user through +a computer network, with no transfer of a copy, is not conveying. + + An interactive user interface displays "Appropriate Legal Notices" +to the extent that it includes a convenient and prominently visible +feature that (1) displays an appropriate copyright notice, and (2) +tells the user that there is no warranty for the work (except to the +extent that warranties are provided), that licensees may convey the +work under this License, and how to view a copy of this License. If +the interface presents a list of user commands or options, such as a +menu, a prominent item in the list meets this criterion. + + 1. Source Code. + + The "source code" for a work means the preferred form of the work +for making modifications to it. "Object code" means any non-source +form of a work. + + A "Standard Interface" means an interface that either is an official +standard defined by a recognized standards body, or, in the case of +interfaces specified for a particular programming language, one that +is widely used among developers working in that language. + + The "System Libraries" of an executable work include anything, other +than the work as a whole, that (a) is included in the normal form of +packaging a Major Component, but which is not part of that Major +Component, and (b) serves only to enable use of the work with that +Major Component, or to implement a Standard Interface for which an +implementation is available to the public in source code form. A +"Major Component", in this context, means a major essential component +(kernel, window system, and so on) of the specific operating system +(if any) on which the executable work runs, or a compiler used to +produce the work, or an object code interpreter used to run it. + + The "Corresponding Source" for a work in object code form means all +the source code needed to generate, install, and (for an executable +work) run the object code and to modify the work, including scripts to +control those activities. However, it does not include the work's +System Libraries, or general-purpose tools or generally available free +programs which are used unmodified in performing those activities but +which are not part of the work. For example, Corresponding Source +includes interface definition files associated with source files for +the work, and the source code for shared libraries and dynamically +linked subprograms that the work is specifically designed to require, +such as by intimate data communication or control flow between those +subprograms and other parts of the work. + + The Corresponding Source need not include anything that users +can regenerate automatically from other parts of the Corresponding +Source. + + The Corresponding Source for a work in source code form is that +same work. + + 2. Basic Permissions. + + All rights granted under this License are granted for the term of +copyright on the Program, and are irrevocable provided the stated +conditions are met. This License explicitly affirms your unlimited +permission to run the unmodified Program. The output from running a +covered work is covered by this License only if the output, given its +content, constitutes a covered work. This License acknowledges your +rights of fair use or other equivalent, as provided by copyright law. + + You may make, run and propagate covered works that you do not +convey, without conditions so long as your license otherwise remains +in force. You may convey covered works to others for the sole purpose +of having them make modifications exclusively for you, or provide you +with facilities for running those works, provided that you comply with +the terms of this License in conveying all material for which you do +not control copyright. Those thus making or running the covered works +for you must do so exclusively on your behalf, under your direction +and control, on terms that prohibit them from making any copies of +your copyrighted material outside their relationship with you. + + Conveying under any other circumstances is permitted solely under +the conditions stated below. Sublicensing is not allowed; section 10 +makes it unnecessary. + + 3. Protecting Users' Legal Rights From Anti-Circumvention Law. + + No covered work shall be deemed part of an effective technological +measure under any applicable law fulfilling obligations under article +11 of the WIPO copyright treaty adopted on 20 December 1996, or +similar laws prohibiting or restricting circumvention of such +measures. + + When you convey a covered work, you waive any legal power to forbid +circumvention of technological measures to the extent such circumvention +is effected by exercising rights under this License with respect to +the covered work, and you disclaim any intention to limit operation or +modification of the work as a means of enforcing, against the work's +users, your or third parties' legal rights to forbid circumvention of +technological measures. + + 4. Conveying Verbatim Copies. + + You may convey verbatim copies of the Program's source code as you +receive it, in any medium, provided that you conspicuously and +appropriately publish on each copy an appropriate copyright notice; +keep intact all notices stating that this License and any +non-permissive terms added in accord with section 7 apply to the code; +keep intact all notices of the absence of any warranty; and give all +recipients a copy of this License along with the Program. + + You may charge any price or no price for each copy that you convey, +and you may offer support or warranty protection for a fee. + + 5. Conveying Modified Source Versions. + + You may convey a work based on the Program, or the modifications to +produce it from the Program, in the form of source code under the +terms of section 4, provided that you also meet all of these conditions: + + a) The work must carry prominent notices stating that you modified + it, and giving a relevant date. + + b) The work must carry prominent notices stating that it is + released under this License and any conditions added under section + 7. This requirement modifies the requirement in section 4 to + "keep intact all notices". + + c) You must license the entire work, as a whole, under this + License to anyone who comes into possession of a copy. This + License will therefore apply, along with any applicable section 7 + additional terms, to the whole of the work, and all its parts, + regardless of how they are packaged. This License gives no + permission to license the work in any other way, but it does not + invalidate such permission if you have separately received it. + + d) If the work has interactive user interfaces, each must display + Appropriate Legal Notices; however, if the Program has interactive + interfaces that do not display Appropriate Legal Notices, your + work need not make them do so. + + A compilation of a covered work with other separate and independent +works, which are not by their nature extensions of the covered work, +and which are not combined with it such as to form a larger program, +in or on a volume of a storage or distribution medium, is called an +"aggregate" if the compilation and its resulting copyright are not +used to limit the access or legal rights of the compilation's users +beyond what the individual works permit. Inclusion of a covered work +in an aggregate does not cause this License to apply to the other +parts of the aggregate. + + 6. Conveying Non-Source Forms. + + You may convey a covered work in object code form under the terms +of sections 4 and 5, provided that you also convey the +machine-readable Corresponding Source under the terms of this License, +in one of these ways: + + a) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by the + Corresponding Source fixed on a durable physical medium + customarily used for software interchange. + + b) Convey the object code in, or embodied in, a physical product + (including a physical distribution medium), accompanied by a + written offer, valid for at least three years and valid for as + long as you offer spare parts or customer support for that product + model, to give anyone who possesses the object code either (1) a + copy of the Corresponding Source for all the software in the + product that is covered by this License, on a durable physical + medium customarily used for software interchange, for a price no + more than your reasonable cost of physically performing this + conveying of source, or (2) access to copy the + Corresponding Source from a network server at no charge. + + c) Convey individual copies of the object code with a copy of the + written offer to provide the Corresponding Source. This + alternative is allowed only occasionally and noncommercially, and + only if you received the object code with such an offer, in accord + with subsection 6b. + + d) Convey the object code by offering access from a designated + place (gratis or for a charge), and offer equivalent access to the + Corresponding Source in the same way through the same place at no + further charge. You need not require recipients to copy the + Corresponding Source along with the object code. If the place to + copy the object code is a network server, the Corresponding Source + may be on a different server (operated by you or a third party) + that supports equivalent copying facilities, provided you maintain + clear directions next to the object code saying where to find the + Corresponding Source. Regardless of what server hosts the + Corresponding Source, you remain obligated to ensure that it is + available for as long as needed to satisfy these requirements. + + e) Convey the object code using peer-to-peer transmission, provided + you inform other peers where the object code and Corresponding + Source of the work are being offered to the general public at no + charge under subsection 6d. + + A separable portion of the object code, whose source code is excluded +from the Corresponding Source as a System Library, need not be +included in conveying the object code work. + + A "User Product" is either (1) a "consumer product", which means any +tangible personal property which is normally used for personal, family, +or household purposes, or (2) anything designed or sold for incorporation +into a dwelling. In determining whether a product is a consumer product, +doubtful cases shall be resolved in favor of coverage. For a particular +product received by a particular user, "normally used" refers to a +typical or common use of that class of product, regardless of the status +of the particular user or of the way in which the particular user +actually uses, or expects or is expected to use, the product. A product +is a consumer product regardless of whether the product has substantial +commercial, industrial or non-consumer uses, unless such uses represent +the only significant mode of use of the product. + + "Installation Information" for a User Product means any methods, +procedures, authorization keys, or other information required to install +and execute modified versions of a covered work in that User Product from +a modified version of its Corresponding Source. The information must +suffice to ensure that the continued functioning of the modified object +code is in no case prevented or interfered with solely because +modification has been made. + + If you convey an object code work under this section in, or with, or +specifically for use in, a User Product, and the conveying occurs as +part of a transaction in which the right of possession and use of the +User Product is transferred to the recipient in perpetuity or for a +fixed term (regardless of how the transaction is characterized), the +Corresponding Source conveyed under this section must be accompanied +by the Installation Information. But this requirement does not apply +if neither you nor any third party retains the ability to install +modified object code on the User Product (for example, the work has +been installed in ROM). + + The requirement to provide Installation Information does not include a +requirement to continue to provide support service, warranty, or updates +for a work that has been modified or installed by the recipient, or for +the User Product in which it has been modified or installed. Access to a +network may be denied when the modification itself materially and +adversely affects the operation of the network or violates the rules and +protocols for communication across the network. + + Corresponding Source conveyed, and Installation Information provided, +in accord with this section must be in a format that is publicly +documented (and with an implementation available to the public in +source code form), and must require no special password or key for +unpacking, reading or copying. + + 7. Additional Terms. + + "Additional permissions" are terms that supplement the terms of this +License by making exceptions from one or more of its conditions. +Additional permissions that are applicable to the entire Program shall +be treated as though they were included in this License, to the extent +that they are valid under applicable law. If additional permissions +apply only to part of the Program, that part may be used separately +under those permissions, but the entire Program remains governed by +this License without regard to the additional permissions. + + When you convey a copy of a covered work, you may at your option +remove any additional permissions from that copy, or from any part of +it. (Additional permissions may be written to require their own +removal in certain cases when you modify the work.) You may place +additional permissions on material, added by you to a covered work, +for which you have or can give appropriate copyright permission. + + Notwithstanding any other provision of this License, for material you +add to a covered work, you may (if authorized by the copyright holders of +that material) supplement the terms of this License with terms: + + a) Disclaiming warranty or limiting liability differently from the + terms of sections 15 and 16 of this License; or + + b) Requiring preservation of specified reasonable legal notices or + author attributions in that material or in the Appropriate Legal + Notices displayed by works containing it; or + + c) Prohibiting misrepresentation of the origin of that material, or + requiring that modified versions of such material be marked in + reasonable ways as different from the original version; or + + d) Limiting the use for publicity purposes of names of licensors or + authors of the material; or + + e) Declining to grant rights under trademark law for use of some + trade names, trademarks, or service marks; or + + f) Requiring indemnification of licensors and authors of that + material by anyone who conveys the material (or modified versions of + it) with contractual assumptions of liability to the recipient, for + any liability that these contractual assumptions directly impose on + those licensors and authors. + + All other non-permissive additional terms are considered "further +restrictions" within the meaning of section 10. If the Program as you +received it, or any part of it, contains a notice stating that it is +governed by this License along with a term that is a further +restriction, you may remove that term. If a license document contains +a further restriction but permits relicensing or conveying under this +License, you may add to a covered work material governed by the terms +of that license document, provided that the further restriction does +not survive such relicensing or conveying. + + If you add terms to a covered work in accord with this section, you +must place, in the relevant source files, a statement of the +additional terms that apply to those files, or a notice indicating +where to find the applicable terms. + + Additional terms, permissive or non-permissive, may be stated in the +form of a separately written license, or stated as exceptions; +the above requirements apply either way. + + 8. Termination. + + You may not propagate or modify a covered work except as expressly +provided under this License. Any attempt otherwise to propagate or +modify it is void, and will automatically terminate your rights under +this License (including any patent licenses granted under the third +paragraph of section 11). + + However, if you cease all violation of this License, then your +license from a particular copyright holder is reinstated (a) +provisionally, unless and until the copyright holder explicitly and +finally terminates your license, and (b) permanently, if the copyright +holder fails to notify you of the violation by some reasonable means +prior to 60 days after the cessation. + + Moreover, your license from a particular copyright holder is +reinstated permanently if the copyright holder notifies you of the +violation by some reasonable means, this is the first time you have +received notice of violation of this License (for any work) from that +copyright holder, and you cure the violation prior to 30 days after +your receipt of the notice. + + Termination of your rights under this section does not terminate the +licenses of parties who have received copies or rights from you under +this License. If your rights have been terminated and not permanently +reinstated, you do not qualify to receive new licenses for the same +material under section 10. + + 9. Acceptance Not Required for Having Copies. + + You are not required to accept this License in order to receive or +run a copy of the Program. Ancillary propagation of a covered work +occurring solely as a consequence of using peer-to-peer transmission +to receive a copy likewise does not require acceptance. However, +nothing other than this License grants you permission to propagate or +modify any covered work. These actions infringe copyright if you do +not accept this License. Therefore, by modifying or propagating a +covered work, you indicate your acceptance of this License to do so. + + 10. Automatic Licensing of Downstream Recipients. + + Each time you convey a covered work, the recipient automatically +receives a license from the original licensors, to run, modify and +propagate that work, subject to this License. You are not responsible +for enforcing compliance by third parties with this License. + + An "entity transaction" is a transaction transferring control of an +organization, or substantially all assets of one, or subdividing an +organization, or merging organizations. If propagation of a covered +work results from an entity transaction, each party to that +transaction who receives a copy of the work also receives whatever +licenses to the work the party's predecessor in interest had or could +give under the previous paragraph, plus a right to possession of the +Corresponding Source of the work from the predecessor in interest, if +the predecessor has it or can get it with reasonable efforts. + + You may not impose any further restrictions on the exercise of the +rights granted or affirmed under this License. For example, you may +not impose a license fee, royalty, or other charge for exercise of +rights granted under this License, and you may not initiate litigation +(including a cross-claim or counterclaim in a lawsuit) alleging that +any patent claim is infringed by making, using, selling, offering for +sale, or importing the Program or any portion of it. + + 11. Patents. + + A "contributor" is a copyright holder who authorizes use under this +License of the Program or a work on which the Program is based. The +work thus licensed is called the contributor's "contributor version". + + A contributor's "essential patent claims" are all patent claims +owned or controlled by the contributor, whether already acquired or +hereafter acquired, that would be infringed by some manner, permitted +by this License, of making, using, or selling its contributor version, +but do not include claims that would be infringed only as a +consequence of further modification of the contributor version. For +purposes of this definition, "control" includes the right to grant +patent sublicenses in a manner consistent with the requirements of +this License. + + Each contributor grants you a non-exclusive, worldwide, royalty-free +patent license under the contributor's essential patent claims, to +make, use, sell, offer for sale, import and otherwise run, modify and +propagate the contents of its contributor version. + + In the following three paragraphs, a "patent license" is any express +agreement or commitment, however denominated, not to enforce a patent +(such as an express permission to practice a patent or covenant not to +sue for patent infringement). To "grant" such a patent license to a +party means to make such an agreement or commitment not to enforce a +patent against the party. + + If you convey a covered work, knowingly relying on a patent license, +and the Corresponding Source of the work is not available for anyone +to copy, free of charge and under the terms of this License, through a +publicly available network server or other readily accessible means, +then you must either (1) cause the Corresponding Source to be so +available, or (2) arrange to deprive yourself of the benefit of the +patent license for this particular work, or (3) arrange, in a manner +consistent with the requirements of this License, to extend the patent +license to downstream recipients. "Knowingly relying" means you have +actual knowledge that, but for the patent license, your conveying the +covered work in a country, or your recipient's use of the covered work +in a country, would infringe one or more identifiable patents in that +country that you have reason to believe are valid. + + If, pursuant to or in connection with a single transaction or +arrangement, you convey, or propagate by procuring conveyance of, a +covered work, and grant a patent license to some of the parties +receiving the covered work authorizing them to use, propagate, modify +or convey a specific copy of the covered work, then the patent license +you grant is automatically extended to all recipients of the covered +work and works based on it. + + A patent license is "discriminatory" if it does not include within +the scope of its coverage, prohibits the exercise of, or is +conditioned on the non-exercise of one or more of the rights that are +specifically granted under this License. You may not convey a covered +work if you are a party to an arrangement with a third party that is +in the business of distributing software, under which you make payment +to the third party based on the extent of your activity of conveying +the work, and under which the third party grants, to any of the +parties who would receive the covered work from you, a discriminatory +patent license (a) in connection with copies of the covered work +conveyed by you (or copies made from those copies), or (b) primarily +for and in connection with specific products or compilations that +contain the covered work, unless you entered into that arrangement, +or that patent license was granted, prior to 28 March 2007. + + Nothing in this License shall be construed as excluding or limiting +any implied license or other defenses to infringement that may +otherwise be available to you under applicable patent law. + + 12. No Surrender of Others' Freedom. + + If conditions are imposed on you (whether by court order, agreement or +otherwise) that contradict the conditions of this License, they do not +excuse you from the conditions of this License. If you cannot convey a +covered work so as to satisfy simultaneously your obligations under this +License and any other pertinent obligations, then as a consequence you may +not convey it at all. For example, if you agree to terms that obligate you +to collect a royalty for further conveying from those to whom you convey +the Program, the only way you could satisfy both those terms and this +License would be to refrain entirely from conveying the Program. + + 13. Use with the GNU Affero General Public License. + + Notwithstanding any other provision of this License, you have +permission to link or combine any covered work with a work licensed +under version 3 of the GNU Affero General Public License into a single +combined work, and to convey the resulting work. The terms of this +License will continue to apply to the part which is the covered work, +but the special requirements of the GNU Affero General Public License, +section 13, concerning interaction through a network will apply to the +combination as such. + + 14. Revised Versions of this License. + + The Free Software Foundation may publish revised and/or new versions of +the GNU General Public License from time to time. Such new versions will +be similar in spirit to the present version, but may differ in detail to +address new problems or concerns. + + Each version is given a distinguishing version number. If the +Program specifies that a certain numbered version of the GNU General +Public License "or any later version" applies to it, you have the +option of following the terms and conditions either of that numbered +version or of any later version published by the Free Software +Foundation. If the Program does not specify a version number of the +GNU General Public License, you may choose any version ever published +by the Free Software Foundation. + + If the Program specifies that a proxy can decide which future +versions of the GNU General Public License can be used, that proxy's +public statement of acceptance of a version permanently authorizes you +to choose that version for the Program. + + Later license versions may give you additional or different +permissions. However, no additional obligations are imposed on any +author or copyright holder as a result of your choosing to follow a +later version. + + 15. Disclaimer of Warranty. + + THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY +APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT +HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY +OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO, +THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR +PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM +IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF +ALL NECESSARY SERVICING, REPAIR OR CORRECTION. + + 16. Limitation of Liability. + + IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING +WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS +THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY +GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE +USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF +DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD +PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS), +EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF +SUCH DAMAGES. + + 17. Interpretation of Sections 15 and 16. + + If the disclaimer of warranty and limitation of liability provided +above cannot be given local legal effect according to their terms, +reviewing courts shall apply local law that most closely approximates +an absolute waiver of all civil liability in connection with the +Program, unless a warranty or assumption of liability accompanies a +copy of the Program in return for a fee. + + END OF TERMS AND CONDITIONS + + How to Apply These Terms to Your New Programs + + If you develop a new program, and you want it to be of the greatest +possible use to the public, the best way to achieve this is to make it +free software which everyone can redistribute and change under these terms. + + To do so, attach the following notices to the program. It is safest +to attach them to the start of each source file to most effectively +state the exclusion of warranty; and each file should have at least +the "copyright" line and a pointer to where the full notice is found. + + + Copyright (C) + + This program is free software: you can redistribute it and/or modify + it under the terms of the GNU General Public License as published by + the Free Software Foundation, either version 3 of the License, or + (at your option) any later version. + + This program is distributed in the hope that it will be useful, + but WITHOUT ANY WARRANTY; without even the implied warranty of + MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the + GNU General Public License for more details. + + You should have received a copy of the GNU General Public License + along with this program. If not, see . + +Also add information on how to contact you by electronic and paper mail. + + If the program does terminal interaction, make it output a short +notice like this when it starts in an interactive mode: + + Copyright (C) + This program comes with ABSOLUTELY NO WARRANTY; for details type `show w'. + This is free software, and you are welcome to redistribute it + under certain conditions; type `show c' for details. + +The hypothetical commands `show w' and `show c' should show the appropriate +parts of the General Public License. Of course, your program's commands +might be different; for a GUI interface, you would use an "about box". + + You should also get your employer (if you work as a programmer) or school, +if any, to sign a "copyright disclaimer" for the program, if necessary. +For more information on this, and how to apply and follow the GNU GPL, see +. + + The GNU General Public License does not permit incorporating your program +into proprietary programs. If your program is a subroutine library, you +may consider it more useful to permit linking proprietary applications with +the library. If this is what you want to do, use the GNU Lesser General +Public License instead of this License. But first, please read +. diff --git a/README.md b/README.md new file mode 100644 index 0000000..e69de29 diff --git a/pyproject.toml b/pyproject.toml new file mode 100644 index 0000000..a35792c --- /dev/null +++ b/pyproject.toml @@ -0,0 +1,16 @@ +[build-system] +requires = ["maturin>=1.7,<2.0"] +build-backend = "maturin" + +[project] +name = "rsbio-seq" +requires-python = ">=3.9" +classifiers = [ + "Programming Language :: Rust", + "Programming Language :: Python :: Implementation :: CPython", + "Programming Language :: Python :: Implementation :: PyPy", +] +dynamic = ["version", "readme", "description", "license", "authors"] + +[tool.maturin] +features = ["pyo3/extension-module"] diff --git a/rsbio_seq.pyi b/rsbio_seq.pyi new file mode 100644 index 0000000..689ca2c --- /dev/null +++ b/rsbio_seq.pyi @@ -0,0 +1,42 @@ +from typing import Iterator + +class Sequence: + """ + Sequence entry. + + Attributes + id (str): record id of the sequence. + desc (str): description of the record if available. + seq (str): content of the sequence. + qual (str): quality string of the sequence if available. + """ + + id: str + desc: str + seq: str + qual: str + +class SeqIO: + """ + Sequence reader. + """ + + def __init__(self, path: str) -> None: + """ + Initialise the reader with path of the file. + + Args: + path (str): The path to file fasta, fastq, fa, fq and compressed formats with gz are supported. + """ + ... + + def __iter__(self) -> Iterator[Sequence]: + """ + Return an iterator of Sequence objects. + + Returns: + Iterator[Sequence]: An iterator over sequences in the file. + """ + ... + +__all__ = ["Sequence", "SeqIO"] diff --git a/src/lib.rs b/src/lib.rs new file mode 100644 index 0000000..b597f82 --- /dev/null +++ b/src/lib.rs @@ -0,0 +1,43 @@ +mod seq; +use pyo3::prelude::*; +use seq::{get_reader, SeqFormat, Sequence, Sequences}; +use std::io::Read; + +/// Sequence reader +#[pyclass] +pub struct SeqIO { + records: Sequences>>, +} + +#[pymethods] +impl SeqIO { + /// Initialise a sequence reader for a file in some destination + #[new] + #[pyo3(signature = (path))] + pub fn new(path: String) -> Self { + let reader = get_reader(&path).unwrap(); + let format = SeqFormat::get(&path).expect("Unable to detect file format"); + + Self { + records: Sequences::new(format, reader).unwrap(), + } + } + + /// Iterator object + pub fn __iter__(slf: PyRef<'_, Self>) -> PyRef<'_, Self> { + slf + } + + /// Iterate through sequences + pub fn __next__(mut slf: PyRefMut<'_, Self>) -> Option { + slf.records.next() + } +} + +/// Sequence reader for rust +#[pymodule] +fn rsbio_seq(m: &Bound<'_, PyModule>) -> PyResult<()> { + m.add_class::()?; + m.add_class::()?; + Ok(()) +} diff --git a/src/seq.rs b/src/seq.rs new file mode 100644 index 0000000..93ce1ea --- /dev/null +++ b/src/seq.rs @@ -0,0 +1,228 @@ +use bio::io::fasta::{Reader as FastaReader, Records as FastaRecords}; +use bio::io::fastq::{Reader as FastqReader, Records as FastqRecords}; +use pyo3::prelude::*; +use std::fs::File; +use std::io::{BufRead, BufReader, Read}; + +// Record set entries of type R, which implement BufRead trait (stdin/file) +pub enum RecordSet { + Fasta(FastaRecords>), + Fastq(FastqRecords>), +} + +/// Sequence entry +#[pyclass] +pub struct Sequence { + /// sequence id + #[pyo3(get, set)] + pub id: String, + /// sequence description + #[pyo3(get, set)] + pub desc: String, + /// sequence string + #[pyo3(get, set)] + pub seq: String, + /// sequence quality string (for FASTQ) + #[pyo3(get, set)] + pub qual: String, +} + +#[derive(Debug, Clone, Copy)] +pub enum SeqFormat { + Fasta, + Fastq, +} + +impl SeqFormat { + pub fn get(path: &str) -> Option { + let mut path = path; + if path.ends_with(".gz") { + path = path.trim_end_matches(".gz"); + } + if path.ends_with(".fq") || path.ends_with(".fastq") { + return Some(SeqFormat::Fastq); + } else if path.ends_with(".fasta") || path.ends_with(".fa") || path.ends_with(".fna") { + return Some(SeqFormat::Fasta); + } + None + } +} + +pub struct Sequences { + pub records: RecordSet, +} + +impl Sequences { + pub fn new(format: SeqFormat, reader: R) -> Result { + match format { + SeqFormat::Fastq => { + let fastq_reader = FastqReader::new(reader); + Ok(Sequences { + records: RecordSet::Fastq(fastq_reader.records()), + }) + } + SeqFormat::Fasta => { + let fasta_reader = FastaReader::new(reader); + Ok(Sequences { + records: RecordSet::Fasta(fasta_reader.records()), + }) + } + } + } +} + +impl Iterator for Sequences { + type Item = Sequence; + + fn next(&mut self) -> Option { + // records do not have a common trait to get id and seq, we can create one + // but this looks simpler for the time being + match self.records { + RecordSet::Fastq(ref mut records) => { + let next_record = records.next(); + if let Some(record) = next_record { + let record = record.unwrap(); + return Some(Sequence { + id: record.id().to_string(), + desc: record.desc().unwrap_or("").to_string(), + seq: String::from_utf8_lossy(record.seq()).to_string(), + qual: String::from_utf8_lossy(record.qual()).to_string(), + }); + } + None + } + RecordSet::Fasta(ref mut records) => { + let next_record = records.next(); + if let Some(record) = next_record { + let record = record.unwrap(); + return Some(Sequence { + id: record.id().to_string(), + desc: record.desc().unwrap_or("").to_string(), + seq: String::from_utf8_lossy(record.seq()).to_string(), + qual: "".into(), + }); + } + None + } + } + } + + fn count(self) -> usize + where + Self: Sized, + { + unimplemented!("Count cannot be performed without always having a rewindable input stream, stdin is not!"); + } +} + +pub fn get_reader(path: &str) -> Result>, String> { + let is_zip = path.ends_with(".gz"); + let file = File::open(path).map_err(|_| format!("Unable to open: {}", path))?; + if is_zip { + let decoder = flate2::read::GzDecoder::new(file); + Ok(BufReader::new(Box::new(decoder))) + } else { + Ok(BufReader::new(Box::new(file))) + } +} + +#[cfg(test)] +mod tests { + use super::*; + const PATH_FQ: &str = "test_data/reads.fq"; + const PATH_FA: &str = "test_data/reads.fa"; + const PATH_FQ_GZ: &str = "test_data/reads.fq.gz"; + const PATH_FA_GZ: &str = "test_data/reads.fa.gz"; + + #[test] + fn load_fq_file_test() { + let reader = get_reader(PATH_FQ).unwrap(); + let mut seqs = Sequences::new(SeqFormat::Fastq, reader).unwrap(); + let record_1 = seqs.next().unwrap(); + assert_eq!("Read_1", record_1.id); + assert_eq!( + "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA", + record_1.seq + ); + let record_2 = seqs.next().unwrap(); + assert_eq!("Read_2", record_2.id); + assert_eq!( + "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT", + record_2.seq + ); + let finish = seqs.next(); + assert!(finish.is_none()); + } + + #[test] + fn load_fq_gz_file_test() { + let reader = get_reader(PATH_FQ_GZ).unwrap(); + let mut seqs = Sequences::new(SeqFormat::Fastq, reader).unwrap(); + let record_1 = seqs.next().unwrap(); + assert_eq!("Read_1", record_1.id); + assert_eq!( + "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA", + record_1.seq + ); + let record_2 = seqs.next().unwrap(); + assert_eq!("Read_2", record_2.id); + assert_eq!( + "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT", + record_2.seq + ); + let finish = seqs.next(); + assert!(finish.is_none()); + } + + #[test] + fn load_fa_file_test() { + let reader = get_reader(PATH_FA).unwrap(); + let mut seqs = Sequences::new(SeqFormat::Fasta, reader).unwrap(); + let record_1 = seqs.next().unwrap(); + assert_eq!("Record_1", record_1.id); + assert_eq!( + "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA", + record_1.seq + ); + let record_2 = seqs.next().unwrap(); + assert_eq!("Record_2", record_2.id); + assert_eq!( + "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT", + record_2.seq + ); + let finish = seqs.next(); + assert!(finish.is_none()); + } + + #[test] + fn load_fa_gz_file_test() { + let reader = get_reader(PATH_FA_GZ).unwrap(); + let mut seqs = Sequences::new(SeqFormat::Fasta, reader).unwrap(); + let record_1 = seqs.next().unwrap(); + assert_eq!("Record_1", record_1.id); + assert_eq!( + "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA", + record_1.seq + ); + let record_2 = seqs.next().unwrap(); + assert_eq!("Record_2", record_2.id); + assert_eq!( + "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT", + record_2.seq + ); + let finish = seqs.next(); + assert!(finish.is_none()); + } + + #[test] + fn parser_test() { + let input = ">Record_1\nACGTACGTACGT"; + let reader = BufReader::new(input.as_bytes()); + let mut seqs = Sequences::new(SeqFormat::Fasta, reader).unwrap(); + let record_1 = seqs.next().unwrap(); + assert_eq!("Record_1", record_1.id); + assert_eq!("ACGTACGTACGT", record_1.seq); + let finish = seqs.next(); + assert!(finish.is_none()); + } +} diff --git a/test_data/reads.fa b/test_data/reads.fa new file mode 100644 index 0000000..e3bfaad --- /dev/null +++ b/test_data/reads.fa @@ -0,0 +1,5 @@ +>Record_1 +GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA +>Record_2 +GTTCAGGGATACGACGTTTGTATTTTAAGAATC +TGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT diff --git a/test_data/reads.fa.gz b/test_data/reads.fa.gz new file mode 100644 index 0000000..ace42f5 Binary files /dev/null and b/test_data/reads.fa.gz differ diff --git a/test_data/reads.fq b/test_data/reads.fq new file mode 100644 index 0000000..16bdeaa --- /dev/null +++ b/test_data/reads.fq @@ -0,0 +1,8 @@ +@Read_1 +GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA ++Read_1 +IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/ +@Read_2 +GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT ++Read_2 +IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I diff --git a/test_data/reads.fq.gz b/test_data/reads.fq.gz new file mode 100644 index 0000000..241647b Binary files /dev/null and b/test_data/reads.fq.gz differ diff --git a/tests/perf.py b/tests/perf.py new file mode 100644 index 0000000..3b1ac3c --- /dev/null +++ b/tests/perf.py @@ -0,0 +1,22 @@ +from tqdm import tqdm +from Bio import SeqIO as BioSeqIO +import sys +from rsbio_seq import SeqIO as RsSeqIO + + +if __name__ == "__main__": + assert len(sys.argv) == 3, "Must provide a valid sequence file and format" + for seq in tqdm( + RsSeqIO(sys.argv[1]), + desc="Rs-iteration", + ): + pass + + for seq in tqdm( + BioSeqIO.parse(sys.argv[1], sys.argv[2]), + desc="Bio-iteration", + ): + pass + +# Rs-iteration: 28963522it [01:16, 379747.32it/s] +# Bio-iteration: 28963522it [02:43, 177329.69it/s] diff --git a/tests/test.py b/tests/test.py new file mode 100644 index 0000000..7977795 --- /dev/null +++ b/tests/test.py @@ -0,0 +1,84 @@ +from rsbio_seq import SeqIO, Sequence +import pathlib + +dir = pathlib.Path(__file__).parent + + +def test_fa(): + seqs = SeqIO(dir.joinpath("../test_data/reads.fa").as_posix()) + seq: Sequence = next(seqs) + assert seq.id == "Record_1" + assert ( + seq.seq + == "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA" + ) + seq = next(seqs) + assert seq.id == "Record_2" + assert ( + seq.seq + == "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT" + ) + + +def test_fa_gz(): + seqs = SeqIO(dir.joinpath("../test_data/reads.fa.gz").as_posix()) + seq: Sequence = next(seqs) + assert seq.id == "Record_1" + assert ( + seq.seq + == "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA" + ) + seq: Sequence = next(seqs) + assert seq.id == "Record_2" + assert ( + seq.seq + == "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT" + ) + + +def test_fq(): + seqs = SeqIO(dir.joinpath("../test_data/reads.fq").as_posix()) + seq: Sequence = next(seqs) + assert seq.id == "Read_1" + assert ( + seq.seq + == "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA" + ) + assert ( + seq.qual + == "IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/" + ) + seq: Sequence = next(seqs) + assert seq.id == "Read_2" + assert ( + seq.seq + == "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT" + ) + assert ( + seq.qual + == "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I" + ) + + +def test_fq_gz(): + seqs = SeqIO(dir.joinpath("../test_data/reads.fq.gz").as_posix()) + seq: Sequence = next(seqs) + assert seq.id == "Read_1" + assert ( + seq.seq + == "GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA" + ) + assert ( + seq.qual + == "IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/" + ) + seq: Sequence = next(seqs) + assert seq.id == "Read_2" + assert ( + seq.seq + == "GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT" + ) + assert ( + seq.qual + == "IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I" + )