diff --git a/README.rst b/README.rst index 28c0dd051..4fffee191 100644 --- a/README.rst +++ b/README.rst @@ -139,6 +139,212 @@ The easiest way to use cwltool to run a tool or workflow from Python is to use a # result["out"] == "foo" +Leveraging SoftwareRequirements (Beta) +-------------------------------------- + +CWL tools may be decoarated with ``SoftwareRequirement`` hints that cwltool +may in turn use to resolve to packages in various package managers or +dependency management systems such as `Environment Modules +`__. + +Utilizing ``SoftwareRequirement`` hints using cwltool requires an optional +dependency, for this reason be sure to use specify the ``deps`` modifier when +installing cwltool. For instance:: + + $ pip install 'cwltool[deps]' + +Installing cwltool in this fashion enables several new command line options. +The most general of these options is ``--beta-dependency-resolvers-configuration``. +This option allows one to specify a dependency resolvers configuration file. +This file may be specified as either XML or YAML and very simply describes various +plugins to enable to "resolve" ``SoftwareRequirement`` dependencies. + +To discuss some of these plugins and how to configure them, first consider the +following ``hint`` definition for an example CWL tool. + +.. code:: yaml + + SoftwareRequirement: + packages: + - package: seqtk + version: + - r93 + +Now imagine deploying cwltool on a cluster with Software Modules installed +and that a ``seqtk`` module is avaialble at version ``r93``. This means cluster +users likely won't have the ``seqtk`` the binary on their ``PATH`` by default but after +sourcing this module with the command ``modulecmd sh load seqtk/r93`` ``seqtk`` is +available on the ``PATH``. A simple dependency resolvers configuration file, called +``dependency-resolvers-conf.yml`` for instance, that would enable cwltool to source +the correct module environment before executing the above tool would simply be: + +.. code:: yaml + + - type: module + +The outer list indicates that one plugin is being enabled, the plugin parameters are +defined as a dictionary for this one list item. There is only one required parameter +for the plugin above, this is ``type`` and defines the plugin type. This parameter +is required for all plugins. The available plugins and the parameters +available for each are documented (incompletely) `here +`__. +Unfortunately, this documentation is in the context of Galaxy tool ``requirement`` s instead of CWL ``SoftwareRequirement`` s, but the concepts map fairly directly. + +cwltool is distributed with an example of such seqtk tool and sample corresponding +job. It could executed from the cwltool root using a dependency resolvers +configuration file such as the above one using the command:: + + cwltool --beta-dependency-resolvers-configuration /path/to/dependency-resolvers-conf.yml \ + tests/seqtk_seq.cwl \ + tests/seqtk_seq_job.json + +This example demonstrates both that cwltool can leverage +existing software installations and also handle workflows with dependencies +on different versions of the same software and libraries. However the above +example does require an existing module setup so it is impossible to test this example +"out of the box" with cwltool. For a more isolated test that demonstrates all +the same concepts - the resolver plugin type ``galaxy_packages`` can be used. + +"Galaxy packages" are a lighter weight alternative to Environment Modules that are +really just defined by a way to lay out directories into packages and versions +to find little scripts that are sourced to modify the environment. They have +been used for years in Galaxy community to adapt Galaxy tools to cluster +environments but require neither knowledge of Galaxy nor any special tools to +setup. These should work just fine for CWL tools. + +The cwltool source code repository's test directory is setup with a very simple +directory that defines a set of "Galaxy packages" (but really just defines one +package named ``random-lines``). The directory layout is simply:: + + tests/test_deps_env/ + random-lines/ + 1.0/ + env.sh + +If the ``galaxy_packages`` plugin is enabled and pointed at the +``tests/test_deps_env`` directory in cwltool's root and a ``SoftwareRequirement`` +such as the following is encountered. + +.. code:: yaml + + hints: + SoftwareRequirement: + packages: + - package: 'random-lines' + version: + - '1.0' + +Then cwltool will simply find that ``env.sh`` file and source it before executing +the corresponding tool. That ``env.sh`` script is only responsible for modifying +the job's ``PATH`` to add the required binaries. + +This is a full example that works since resolving "Galaxy packages" has no +external requirements. Try it out by executing the following command from cwltool's +root directory:: + + cwltool --beta-dependency-resolvers-configuration tests/test_deps_env_resolvers_conf.yml \ + tests/random_lines.cwl \ + tests/random_lines_job.json + +The resolvers configuration file in the above example was simply: + +.. code:: yaml + + - type: galaxy_packages + base_path: ./tests/test_deps_env + +It is possible that the ``SoftwareRequirement`` s in a given CWL tool will not +match the module names for a given cluster. Such requirements can be re-mapped +to specific deployed packages and/or versions using another file specified using +the resolver plugin parameter `mapping_files`. We will +demonstrate this using `galaxy_packages` but the concepts apply equally well +to Environment Modules or Conda packages (described below) for instance. + +So consider the resolvers configuration file +(`tests/test_deps_env_resolvers_conf_rewrite.yml`): + +.. code:: yaml + + - type: galaxy_packages + base_path: ./tests/test_deps_env + mapping_files: ./tests/test_deps_mapping.yml + +And the corresponding mapping configuraiton file (`tests/test_deps_mapping.yml`): + +.. code:: yaml + + - from: + name: randomLines + version: 1.0.0-rc1 + to: + name: random-lines + version: '1.0' + +This is saying if cwltool encounters a requirement of ``randomLines`` at version +``1.0.0-rc1`` in a tool, to rewrite to our specific plugin as ``random-lines`` at +version ``1.0``. cwltool has such a test tool called ``random_lines_mapping.cwl`` +that contains such a source ``SoftwareRequirement``. To try out this example with +mapping, execute the following command from the cwltool root directory:: + + cwltool --beta-dependency-resolvers-configuration tests/test_deps_env_resolvers_conf_rewrite.yml \ + tests/random_lines_mapping.cwl \ + tests/random_lines_job.json + +The previous examples demonstrated leveraging existing infrastructure to +provide requirements for CWL tools. If instead a real package manager is used +cwltool has the oppertunity to install requirements as needed. While initial +support for Homebrew/Linuxbrew plugins is available, the most developed such +plugin is for the `Conda `__ package manager. Conda has the nice properties +of allowing multiple versions of a package to be installed simultaneously, +not requiring evalated permissions to install Conda itself or packages using +Conda, and being cross platform. For these reasons, cwltool may run as a normal +user, install its own Conda environment and manage multiple versions of Conda packages +on both Linux and Mac OS X. + +The Conda plugin can be endlessly configured, but a sensible set of defaults +that has proven a powerful stack for dependency management within the Galaxy tool +development ecosystem can be enabled by simply passing cwltool the +``--beta-conda-dependencies`` flag. + +With this we can use the seqtk example above without Docker and without +any externally managed services - cwltool should install everything it needs +and create an environment for the tool. Try it out with the follwing command:: + + cwltool --beta-conda-dependencies tests/seqtk_seq.cwl tests/seqtk_seq_job.json + +The CWL specification allows URIs to be attached to ``SoftwareRequirement`` s +that allow disambiguation of package names. If the mapping files described above +allow deployers to adapt tools to their infrastructure, this mechanism allows +tools to adapt their requirements to multiple package managers. To demonstrate +this within the context of the seqtk, we can simply break the package name we +use and then specify a specific Conda package as follows: + +.. code:: yaml + + hints: + SoftwareRequirement: + packages: + - package: seqtk_seq + version: + - '1.2' + specs: + - https://anaconda.org/bioconda/seqtk + - https://packages.debian.org/sid/seqtk + +The example can be executed using the command:: + + cwltool --beta-conda-dependencies tests/seqtk_seq_wrong_name.cwl tests/seqtk_seq_job.json + +The plugin framework for managing resolution of these software requirements +as maintained as part of `galaxy-lib `__ - a small, portable subset of the Galaxy +project. More information on configuration and implementation can be found +at the following links: + +- `Dependency Resolvers in Galaxy `__ +- `Conda for [Galaxy] Tool Dependencies `__ +- `Mapping Files - Implementation `__ +- `Specifications - Implementation `__ +- `Initial cwltool Integration Pull Request `__ Cwltool control flow -------------------- diff --git a/cwltool/builder.py b/cwltool/builder.py index 52693dbcd..76a46a146 100644 --- a/cwltool/builder.py +++ b/cwltool/builder.py @@ -50,6 +50,8 @@ def __init__(self): # type: () -> None # Will be default "no_listing" for CWL v1.1 self.loadListing = "deep_listing" # type: Union[None, str] + self.find_default_container = None # type: Callable[[], Text] + def bind_input(self, schema, datum, lead_pos=None, tail_pos=None): # type: (Dict[Text, Any], Any, Union[int, List[int]], List[int]) -> List[Dict[Text, Any]] if tail_pos is None: diff --git a/cwltool/draft2tool.py b/cwltool/draft2tool.py index 2aa9ce388..ad4fe10ce 100644 --- a/cwltool/draft2tool.py +++ b/cwltool/draft2tool.py @@ -174,9 +174,19 @@ class CommandLineTool(Process): def __init__(self, toolpath_object, **kwargs): # type: (Dict[Text, Any], **Any) -> None super(CommandLineTool, self).__init__(toolpath_object, **kwargs) + self.find_default_container = kwargs.get("find_default_container", None) def makeJobRunner(self, use_container=True): # type: (Optional[bool]) -> JobBase dockerReq, _ = self.get_requirement("DockerRequirement") + if not dockerReq and use_container: + default_container = self.find_default_container(self) + if default_container: + self.requirements.insert(0, { + "class": "DockerRequirement", + "dockerPull": default_container + }) + dockerReq = self.requirements[0] + if dockerReq and use_container: return DockerCommandLineJob() else: diff --git a/cwltool/job.py b/cwltool/job.py index 60573cbad..6aea779c0 100644 --- a/cwltool/job.py +++ b/cwltool/job.py @@ -33,6 +33,7 @@ PYTHON_RUN_SCRIPT = """ import json +import os import sys import subprocess @@ -41,6 +42,7 @@ commands = popen_description["commands"] cwd = popen_description["cwd"] env = popen_description["env"] + env["PATH"] = os.environ.get("PATH") stdin_path = popen_description["stdin_path"] stdout_path = popen_description["stdout_path"] stderr_path = popen_description["stderr_path"] @@ -67,7 +69,7 @@ if sp.stdin: sp.stdin.close() rcode = sp.wait() - if isinstance(stdin, file): + if stdin is not subprocess.PIPE: stdin.close() if stdout is not sys.stderr: stdout.close() @@ -145,7 +147,6 @@ def _setup(self): # type: () -> None _logger.debug(u"[job %s] initial work dir %s", self.name, json.dumps({p: self.generatemapper.mapper(p) for p in self.generatemapper.files()}, indent=4)) - def _execute(self, runtime, env, rm_tmpdir=True, move_outputs="move"): # type: (List[Text], MutableMapping[Text, Text], bool, Text) -> None @@ -328,8 +329,12 @@ def run(self, pull_image=True, rm_container=True, env = cast(MutableMapping[Text, Text], os.environ) if docker_req and kwargs.get("use_container") is not False: img_id = docker.get_from_requirements(docker_req, True, pull_image) - elif kwargs.get("default_container", None) is not None: - img_id = kwargs.get("default_container") + if img_id is None: + find_default_container = self.builder.find_default_container + default_container = find_default_container and find_default_container() + if default_container: + img_id = default_container + env = cast(MutableMapping[Text, Text], os.environ) if docker_req and img_id is None and kwargs.get("use_container"): raise Exception("Docker image not available") @@ -482,8 +487,8 @@ def _job_popen( ["bash", job_script.encode("utf-8")], shell=False, cwd=job_dir, - stdout=subprocess.PIPE, - stderr=subprocess.PIPE, + stdout=sys.stderr, # The nested script will output the paths to the correct files if they need + stderr=sys.stderr, # to be captured. Else just write everything to stderr (same as above). stdin=subprocess.PIPE, ) if sp.stdin: diff --git a/cwltool/main.py b/cwltool/main.py index b7ba1e24e..20bbc8c58 100755 --- a/cwltool/main.py +++ b/cwltool/main.py @@ -13,6 +13,7 @@ import pkg_resources # part of setuptools import requests +import string import ruamel.yaml as yaml import schema_salad.validate as validate @@ -31,9 +32,11 @@ relocateOutputs, scandeps, shortname, use_custom_schema, use_standard_schema) from .resolver import ga4gh_tool_registries, tool_resolver +from .software_requirements import DependenciesConfiguration, get_container_from_software_requirements from .stdfsaccess import StdFsAccess from .update import ALLUPDATES, UPDATES + _logger = logging.getLogger("cwltool") defaultStreamHandler = logging.StreamHandler() @@ -149,6 +152,15 @@ def arg_parser(): # type: () -> argparse.ArgumentParser exgroup.add_argument("--quiet", action="store_true", help="Only print warnings and errors.") exgroup.add_argument("--debug", action="store_true", help="Print even more logging") + # help="Dependency resolver configuration file describing how to adapt 'SoftwareRequirement' packages to current system." + parser.add_argument("--beta-dependency-resolvers-configuration", default=None, help=argparse.SUPPRESS) + # help="Defaut root directory used by dependency resolvers configuration." + parser.add_argument("--beta-dependencies-directory", default=None, help=argparse.SUPPRESS) + # help="Use biocontainers for tools without an explicitly annotated Docker container." + parser.add_argument("--beta-use-biocontainers", default=None, help=argparse.SUPPRESS, action="store_true") + # help="Short cut to use Conda to resolve 'SoftwareRequirement' packages." + parser.add_argument("--beta-conda-dependencies", default=None, help=argparse.SUPPRESS, action="store_true") + parser.add_argument("--tool-help", action="store_true", help="Print command line help for tool") parser.add_argument("--relative-deps", choices=['primary', 'cwd'], @@ -236,12 +248,6 @@ def output_callback(out, processStatus): for req in jobReqs: t.requirements.append(req) - if kwargs.get("default_container"): - t.requirements.insert(0, { - "class": "DockerRequirement", - "dockerPull": kwargs["default_container"] - }) - jobiter = t.job(job_order_object, output_callback, **kwargs) @@ -648,7 +654,8 @@ def main(argsl=None, # type: List[str] 'relax_path_checks': False, 'validate': False, 'enable_ga4gh_tool_registry': False, - 'ga4gh_tool_registries': [] + 'ga4gh_tool_registries': [], + 'find_default_container': None }.iteritems(): if not hasattr(args, k): setattr(args, k, v) @@ -716,8 +723,20 @@ def main(argsl=None, # type: List[str] stdout.write(json.dumps(processobj, indent=4)) return 0 + conf_file = getattr(args, "beta_dependency_resolvers_configuration", None) # Text + use_conda_dependencies = getattr(args, "beta_conda_dependencies", None) # Text + + make_tool_kwds = vars(args) + + build_job_script = None # type: Callable[[Any, List[str]], Text] + if conf_file or use_conda_dependencies: + dependencies_configuration = DependenciesConfiguration(args) # type: DependenciesConfiguration + make_tool_kwds["build_job_script"] = dependencies_configuration.build_job_script + + make_tool_kwds["find_default_container"] = functools.partial(find_default_container, args) + tool = make_tool(document_loader, avsc_names, metadata, uri, - makeTool, vars(args)) + makeTool, make_tool_kwds) if args.validate: return 0 @@ -838,5 +857,15 @@ def locToPath(p): _logger.addHandler(defaultStreamHandler) +def find_default_container(args, builder): + default_container = None + if args.default_container: + default_container = args.default_container + elif args.beta_use_biocontainers: + default_container = get_container_from_software_requirements(args, builder) + + return default_container + + if __name__ == "__main__": sys.exit(main(sys.argv[1:])) diff --git a/cwltool/process.py b/cwltool/process.py index fcf78615a..7fdd99d3d 100644 --- a/cwltool/process.py +++ b/cwltool/process.py @@ -598,6 +598,12 @@ def _init_job(self, joborder, **kwargs): builder.resources = self.evalResources(builder, kwargs) + build_job_script = kwargs.get("build_job_script", None) # type: Callable[[Builder, List[str]], Text] + curried_build_job_script = None # type: Callable[[List[str]], Text] + if build_job_script: + curried_build_job_script = lambda commands: build_job_script(builder, commands) + builder.build_job_script = curried_build_job_script + return builder def evalResources(self, builder, kwargs): diff --git a/cwltool/software_requirements.py b/cwltool/software_requirements.py new file mode 100644 index 000000000..fe8d28f5a --- /dev/null +++ b/cwltool/software_requirements.py @@ -0,0 +1,119 @@ +"""This module handles resolution of SoftwareRequirement hints. + +This is accomplished mainly by adapting cwltool internals to galaxy-lib's +concept of "dependencies". Despite the name, galaxy-lib is a light weight +library that can be used to map SoftwareRequirements in all sorts of ways - +Homebrew, Conda, custom scripts, environment modules. We'd be happy to find +ways to adapt new packages managers and such as well. +""" + +import argparse +import os +import string +from typing import (Any, Dict, List, Text) + +try: + from galaxy.tools.deps.requirements import ToolRequirement, ToolRequirements + from galaxy.tools import deps +except ImportError: + ToolRequirement = None # type: ignore + ToolRequirements = None # type: ignore + deps = None + +from .utils import get_feature + + +COMMAND_WITH_DEPENDENCIES_TEMPLATE = string.Template("""#!/bin/bash +$handle_dependencies +python "run_job.py" "job.json" +""") + + +class DependenciesConfiguration(object): + + def __init__(self, args): + # type: (argparse.Namespace) -> None + conf_file = getattr(args, "beta_dependency_resolvers_configuration", None) + tool_dependency_dir = getattr(args, "beta_dependencies_directory", None) + conda_dependencies = getattr(args, "beta_conda_dependencies", None) + if conf_file is not None and os.path.exists(conf_file): + self.use_tool_dependencies = True + if not tool_dependency_dir: + tool_dependency_dir = os.path.abspath(os.path.dirname(conf_file)) + self.tool_dependency_dir = tool_dependency_dir + self.dependency_resolvers_config_file = conf_file + elif conda_dependencies: + if not tool_dependency_dir: + tool_dependency_dir = os.path.abspath("./cwltool_deps") + self.tool_dependency_dir = tool_dependency_dir + self.use_tool_dependencies = True + self.dependency_resolvers_config_file = None + else: + self.use_tool_dependencies = False + + @property + def config_dict(self): + return { + 'conda_auto_install': True, + 'conda_auto_init': True, + } + + def build_job_script(self, builder, command): + # type: (Any, List[str]) -> Text + if deps is None: + raise Exception("galaxy-lib not found") + tool_dependency_manager = deps.build_dependency_manager(self) # type: deps.DependencyManager + dependencies = get_dependencies(builder) + handle_dependencies = "" # str + if dependencies: + handle_dependencies = "\n".join(tool_dependency_manager.dependency_shell_commands(dependencies, job_directory=builder.tmpdir)) + + template_kwds = dict(handle_dependencies=handle_dependencies) # type: Dict[str, str] + job_script = COMMAND_WITH_DEPENDENCIES_TEMPLATE.substitute(template_kwds) + return job_script + + +def get_dependencies(builder): + # type: (Any) -> ToolRequirements + (software_requirement, _) = get_feature(builder, "SoftwareRequirement") + dependencies = [] # type: List[ToolRequirement] + if software_requirement and software_requirement.get("packages"): + packages = software_requirement.get("packages") + for package in packages: + version = package.get("version", None) + if isinstance(version, list): + if version: + version = version[0] + else: + version = None + specs = [{"uri": s} for s in package.get("specs", [])] + dependencies.append(ToolRequirement.from_dict(dict( + name=package["package"].split("#")[-1], + version=version, + type="package", + specs=specs, + ))) + + return ToolRequirements.from_list(dependencies) + + +def get_container_from_software_requirements(args, builder): + if args.beta_use_biocontainers: + try: + from galaxy.tools.deps.containers import ContainerRegistry, AppInfo, ToolInfo, DOCKER_CONTAINER_TYPE + except ImportError: + raise Exception("Optional requirement galaxy-lib not found, it is required for this configuration.") + + app_info = AppInfo( + involucro_auto_init=True, + enable_beta_mulled_containers=True, + container_image_cache_path=".", + ) # type: AppInfo + container_registry = ContainerRegistry(app_info) # type: ContainerRegistry + requirements = get_dependencies(builder) + tool_info = ToolInfo(requirements=requirements) # type: ToolInfo + container_description = container_registry.find_best_container_description([DOCKER_CONTAINER_TYPE], tool_info) + if container_description: + return container_description.identifier + + return None diff --git a/setup.py b/setup.py index e5a260786..a2bf00f9a 100755 --- a/setup.py +++ b/setup.py @@ -61,6 +61,9 @@ 'typing >= 3.5.3', 'six >= 1.8.0', ], + extras_require={ + 'deps': ["galaxy-lib >= 17.09.3"] + }, setup_requires=[] + pytest_runner, test_suite='tests', tests_require=['pytest', 'mock >= 2.0.0',], diff --git a/tests/2.fasta b/tests/2.fasta new file mode 100644 index 000000000..3bfe7d3d3 --- /dev/null +++ b/tests/2.fasta @@ -0,0 +1,11 @@ +>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other; +gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctt +tacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttac +cggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttgg +aagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactg +gatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctt +tattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgac +ctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgt +ttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagt +tcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaa +aacaattcta atggtcaaaa a \ No newline at end of file diff --git a/tests/2.fastq b/tests/2.fastq new file mode 100644 index 000000000..436c05ff2 --- /dev/null +++ b/tests/2.fastq @@ -0,0 +1,12 @@ +@EAS54_6_R1_2_1_413_324 +CCCTTCTTGTCTTCAGCGTTTCTCC ++ +;;3;;;;;;;;;;;;7;;;;;;;88 +@EAS54_6_R1_2_1_540_792 +TTGGCAGGCCAAGGCCGATGGATCA ++ +;;;;;;;;;;;7;;;;;-;;;3;83 +@EAS54_6_R1_2_1_443_348 +GTTGCTTCTGGCGTGGGTGGGGGGG ++EAS54_6_R1_2_1_443_348 +;;;;;;;;;;;9;7;;.7;393333 \ No newline at end of file diff --git a/tests/random_lines.cwl b/tests/random_lines.cwl new file mode 100644 index 000000000..b352474a3 --- /dev/null +++ b/tests/random_lines.cwl @@ -0,0 +1,29 @@ +cwlVersion: v1.0 +class: CommandLineTool +id: "random_lines" +doc: "Select random lines from a file" +inputs: + - id: seed + type: int + inputBinding: + position: 1 + prefix: -s + - id: input1 + type: File + inputBinding: + position: 2 + - id: num_lines + type: int + inputBinding: + position: 3 +outputs: + output1: + type: stdout +baseCommand: ["random-lines"] +arguments: [] +hints: + SoftwareRequirement: + packages: + - package: 'random-lines' + version: + - '1.0' diff --git a/tests/random_lines_job.json b/tests/random_lines_job.json new file mode 100644 index 000000000..e1859c0e3 --- /dev/null +++ b/tests/random_lines_job.json @@ -0,0 +1,8 @@ +{ + "input1": { + "class": "File", + "location": "2.fastq" + }, + "seed": 5, + "num_lines": 2 +} diff --git a/tests/random_lines_mapping.cwl b/tests/random_lines_mapping.cwl new file mode 100644 index 000000000..b526b3c70 --- /dev/null +++ b/tests/random_lines_mapping.cwl @@ -0,0 +1,29 @@ +cwlVersion: v1.0 +class: CommandLineTool +id: "random_lines" +doc: "Select random lines from a file" +inputs: + - id: seed + type: int + inputBinding: + position: 1 + prefix: -s + - id: input1 + type: File + inputBinding: + position: 2 + - id: num_lines + type: int + inputBinding: + position: 3 +outputs: + output1: + type: stdout +baseCommand: ["random-lines"] +arguments: [] +hints: + SoftwareRequirement: + packages: + - package: randomLines + version: + - '1.0.0-rc1' diff --git a/tests/seqtk_seq.cwl b/tests/seqtk_seq.cwl new file mode 100644 index 000000000..b97d6c25e --- /dev/null +++ b/tests/seqtk_seq.cwl @@ -0,0 +1,24 @@ +cwlVersion: v1.0 +class: CommandLineTool +id: "seqtk_seq" +doc: "Convert to FASTA (seqtk)" +inputs: + - id: input1 + type: File + inputBinding: + position: 1 + prefix: "-a" +outputs: + - id: output1 + type: File + outputBinding: + glob: out +baseCommand: ["seqtk", "seq"] +arguments: [] +stdout: out +hints: + SoftwareRequirement: + packages: + - package: seqtk + version: + - r93 diff --git a/tests/seqtk_seq_job.json b/tests/seqtk_seq_job.json new file mode 100644 index 000000000..79ea46c37 --- /dev/null +++ b/tests/seqtk_seq_job.json @@ -0,0 +1,6 @@ +{ + "input1": { + "class": "File", + "location": "2.fastq" + } +} diff --git a/tests/seqtk_seq_with_docker.cwl b/tests/seqtk_seq_with_docker.cwl new file mode 100644 index 000000000..8c7834755 --- /dev/null +++ b/tests/seqtk_seq_with_docker.cwl @@ -0,0 +1,26 @@ +cwlVersion: v1.0 +class: CommandLineTool +id: "seqtk_seq" +doc: "Convert to FASTA (seqtk)" +inputs: + - id: input1 + type: File + inputBinding: + position: 1 + prefix: "-a" +outputs: + - id: output1 + type: File + outputBinding: + glob: out +baseCommand: ["seqtk", "seq"] +arguments: [] +stdout: out +hints: + SoftwareRequirement: + packages: + - package: seqtk + version: + - '1.2' + DockerRequirement: + dockerPull: quay.io/biocontainers/seqtk:1.2--0 diff --git a/tests/seqtk_seq_wrong_name.cwl b/tests/seqtk_seq_wrong_name.cwl new file mode 100644 index 000000000..5e4665b1f --- /dev/null +++ b/tests/seqtk_seq_wrong_name.cwl @@ -0,0 +1,27 @@ +cwlVersion: v1.0 +class: CommandLineTool +id: "seqtk_seq" +doc: "Convert to FASTA (seqtk)" +inputs: + - id: input1 + type: File + inputBinding: + position: 1 + prefix: "-a" +outputs: + - id: output1 + type: File + outputBinding: + glob: out +baseCommand: ["seqtk", "seq"] +arguments: [] +stdout: out +hints: + SoftwareRequirement: + packages: + - package: seqtk_seq + version: + - '1.2' + specs: + - https://anaconda.org/bioconda/seqtk + - https://packages.debian.org/sid/seqtk diff --git a/tests/test_deps_env/random-lines/1.0/env.sh b/tests/test_deps_env/random-lines/1.0/env.sh new file mode 100644 index 000000000..48e1611b6 --- /dev/null +++ b/tests/test_deps_env/random-lines/1.0/env.sh @@ -0,0 +1,8 @@ + +#PACKAGE_DIRECTORY="/path/to/cwlroot" + +# This shouldn't need to use bash-isms - but we don't know the full path to this file, +# so for testing it is setup this way. For actual deployments just using full paths +# directly would be preferable. +PACKAGE_DIRECTORY="$(cd "$(dirname "${BASH_SOURCE[0]}")" && pwd)/tests/test_deps_env/random-lines/1.0/" +export PATH=$PATH:$PACKAGE_DIRECTORY/scripts diff --git a/tests/test_deps_env/random-lines/1.0/scripts/random-lines b/tests/test_deps_env/random-lines/1.0/scripts/random-lines new file mode 100755 index 000000000..bfde39bff --- /dev/null +++ b/tests/test_deps_env/random-lines/1.0/scripts/random-lines @@ -0,0 +1,78 @@ +#!/usr/bin/env python +# Dan Blankenberg +# Selects N random lines from a file and outputs to another file, maintaining original line order +# allows specifying a seed +# does two passes to determine line offsets/count, and then to output contents +from __future__ import print_function + +import optparse +import random +import sys + + +def get_random_by_subtraction( line_offsets, num_lines ): + while len( line_offsets ) > num_lines: + del line_offsets[ random.randint( 0, len( line_offsets ) - 1 ) ] + return line_offsets + + +def get_random_by_sample( line_offsets, num_lines ): + line_offsets = random.sample( line_offsets, num_lines ) + line_offsets.sort() + return line_offsets + + +def get_random( line_offsets, num_lines ): + if num_lines > ( len( line_offsets ) / 2 ): + return get_random_by_subtraction( line_offsets, num_lines ) + else: + return get_random_by_sample( line_offsets, num_lines ) + + +def __main__(): + open("/Users/john/moo", "w").write("cow") + parser = optparse.OptionParser() + parser.add_option( '-s', '--seed', dest='seed', action='store', type="string", default=None, help='Set the random seed.' ) + (options, args) = parser.parse_args() + + input = open( args[0], 'rb' ) + output = sys.stdout + num_lines = int( args[1] ) + assert num_lines > 0, "You must select at least one line." + + if options.seed is not None: + random.seed( options.seed ) + + # get line offsets + line_offsets = [] + teller = input.tell + readliner = input.readline + appender = line_offsets.append + while True: + offset = teller() + if readliner(): + appender( offset ) + else: + break + + total_lines = len( line_offsets ) + assert num_lines <= total_lines, "Error: asked to select more lines (%i) than there were in the file (%i)." % ( num_lines, total_lines ) + + # get random line offsets + line_offsets = get_random( line_offsets, num_lines ) + + # write out random lines + seeker = input.seek + writer = output.write + for line_offset in line_offsets: + seeker( line_offset ) + writer( readliner() ) + input.close() + output.close() + #print("Kept %i of %i total lines." % ( num_lines, total_lines )) + #if options.seed is not None: + # print('Used random seed of "%s".' % options.seed) + + +if __name__ == "__main__": + __main__() diff --git a/tests/test_deps_env_resolvers_conf.yml b/tests/test_deps_env_resolvers_conf.yml new file mode 100644 index 000000000..e1e190c23 --- /dev/null +++ b/tests/test_deps_env_resolvers_conf.yml @@ -0,0 +1,3 @@ +- type: galaxy_packages + base_path: ./tests/test_deps_env + diff --git a/tests/test_deps_env_resolvers_conf_rewrite.yml b/tests/test_deps_env_resolvers_conf_rewrite.yml new file mode 100644 index 000000000..a80b6d4bf --- /dev/null +++ b/tests/test_deps_env_resolvers_conf_rewrite.yml @@ -0,0 +1,3 @@ +- type: galaxy_packages + base_path: ./tests/test_deps_env + mapping_files: ./tests/test_deps_mapping.yml diff --git a/tests/test_deps_mapping.yml b/tests/test_deps_mapping.yml new file mode 100644 index 000000000..e09af5ad3 --- /dev/null +++ b/tests/test_deps_mapping.yml @@ -0,0 +1,6 @@ +- from: + name: randomLines + version: 1.0.0-rc1 + to: + name: random-lines + version: '1.0' diff --git a/typeshed/2.7/galaxy/__init__.pyi b/typeshed/2.7/galaxy/__init__.pyi new file mode 100644 index 000000000..aa2f6e6ef --- /dev/null +++ b/typeshed/2.7/galaxy/__init__.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +PROJECT_NAME = ... # type: str +PROJECT_OWNER = ... # type: str +PROJECT_USERAME = ... # type: str +PROJECT_URL = ... # type: str +PROJECT_AUTHOR = ... # type: str +PROJECT_EMAIL = ... # type: str +RAW_CONTENT_URL = ... # type: Any diff --git a/typeshed/2.7/galaxy/exceptions/__init__.pyi b/typeshed/2.7/galaxy/exceptions/__init__.pyi new file mode 100644 index 000000000..e59ac087d --- /dev/null +++ b/typeshed/2.7/galaxy/exceptions/__init__.pyi @@ -0,0 +1,143 @@ +# Stubs for galaxy.exceptions (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..exceptions import error_codes as error_codes + +class MessageException(Exception): + status_code = ... # type: int + err_code = ... # type: Any + err_msg = ... # type: Any + type = ... # type: Any + extra_error_info = ... # type: Any + def __init__(self, err_msg: Optional[Any] = ..., type: str = ..., **extra_error_info) -> None: ... + +class ItemDeletionException(MessageException): ... +class ObjectInvalid(Exception): ... + +class ActionInputError(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + def __init__(self, err_msg, type: str = ...) -> None: ... + +class DuplicatedSlugException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class DuplicatedIdentifierException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ObjectAttributeInvalidException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ObjectAttributeMissingException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class MalformedId(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class MalformedContents(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class UnknownContentsType(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class RequestParameterMissingException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ToolMetaParameterException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ToolMissingException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class RequestParameterInvalidException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class AuthenticationFailed(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class AuthenticationRequired(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ItemAccessibilityException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ItemOwnershipException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ConfigDoesNotAllowException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class InsufficientPermissionsException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class AdminRequiredException(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ObjectNotFound(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class DeprecatedMethod(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class Conflict(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ConfigurationError(Exception): + status_code = ... # type: int + err_code = ... # type: Any + +class InconsistentDatabase(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class InternalServerError(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class NotImplemented(MessageException): + status_code = ... # type: int + err_code = ... # type: Any + +class ContainerCLIError(Exception): + stdout = ... # type: Any + stderr = ... # type: Any + returncode = ... # type: Any + command = ... # type: Any + subprocess_command = ... # type: Any + def __init__(self, msg: Optional[Any] = ..., stdout: Optional[Any] = ..., stderr: Optional[Any] = ..., returncode: Optional[Any] = ..., command: Optional[Any] = ..., subprocess_command: Optional[Any] = ..., **kwargs) -> None: ... + +class ContainerNotFound(Exception): + container_id = ... # type: Any + def __init__(self, msg: Optional[Any] = ..., container_id: Optional[Any] = ..., **kwargs) -> None: ... + +class ContainerImageNotFound(Exception): + image = ... # type: Any + def __init__(self, msg: Optional[Any] = ..., image: Optional[Any] = ..., **kwargs) -> None: ... + +class ContainerRunError(Exception): + image = ... # type: Any + command = ... # type: Any + def __init__(self, msg: Optional[Any] = ..., image: Optional[Any] = ..., command: Optional[Any] = ..., **kwargs) -> None: ... diff --git a/typeshed/2.7/galaxy/exceptions/error_codes.pyi b/typeshed/2.7/galaxy/exceptions/error_codes.pyi new file mode 100644 index 000000000..b25ca3e99 --- /dev/null +++ b/typeshed/2.7/galaxy/exceptions/error_codes.pyi @@ -0,0 +1,17 @@ +# Stubs for galaxy.exceptions.error_codes (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +UNKNOWN_ERROR_MESSAGE = ... # type: str + +class ErrorCode: + code = ... # type: Any + default_error_message = ... # type: Any + def __init__(self, code, default_error_message) -> None: ... + def __int__(self): ... + +error_codes_json = ... # type: Any +name = ... # type: Any +error_code_obj = ... # type: Any diff --git a/typeshed/2.7/galaxy/jobs/__init__.pyi b/typeshed/2.7/galaxy/jobs/__init__.pyi new file mode 100644 index 000000000..c65cfb4ee --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/__init__.pyi @@ -0,0 +1,4 @@ +# Stubs for galaxy.jobs (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + diff --git a/typeshed/2.7/galaxy/jobs/metrics/__init__.pyi b/typeshed/2.7/galaxy/jobs/metrics/__init__.pyi new file mode 100644 index 000000000..758ddc677 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/__init__.pyi @@ -0,0 +1,38 @@ +# Stubs for galaxy.jobs.metrics (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..metrics import formatting as formatting + +log = ... # type: Any +DEFAULT_FORMATTER = ... # type: Any + +class JobMetrics: + plugin_classes = ... # type: Any + default_job_instrumenter = ... # type: Any + job_instrumenters = ... # type: Any + def __init__(self, conf_file: Optional[Any] = ..., **kwargs) -> None: ... + def format(self, plugin, key, value): ... + def set_destination_conf_file(self, destination_id, conf_file): ... + def set_destination_conf_element(self, destination_id, element): ... + def set_destination_instrumenter(self, destination_id, job_instrumenter: Optional[Any] = ...): ... + def collect_properties(self, destination_id, job_id, job_directory): ... + +class NullJobInstrumenter: + def pre_execute_commands(self, job_directory): ... + def post_execute_commands(self, job_directory): ... + def collect_properties(self, job_id, job_directory): ... + +NULL_JOB_INSTRUMENTER = ... # type: Any + +class JobInstrumenter: + extra_kwargs = ... # type: Any + plugin_classes = ... # type: Any + plugins = ... # type: Any + def __init__(self, plugin_classes, plugins_source, **kwargs) -> None: ... + def pre_execute_commands(self, job_directory): ... + def post_execute_commands(self, job_directory): ... + def collect_properties(self, job_id, job_directory): ... + @staticmethod + def from_file(plugin_classes, conf_file, **kwargs): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/collectl/__init__.pyi b/typeshed/2.7/galaxy/jobs/metrics/collectl/__init__.pyi new file mode 100644 index 000000000..c58636ec4 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/collectl/__init__.pyi @@ -0,0 +1,4 @@ +# Stubs for galaxy.jobs.metrics.collectl (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + diff --git a/typeshed/2.7/galaxy/jobs/metrics/collectl/cli.pyi b/typeshed/2.7/galaxy/jobs/metrics/collectl/cli.pyi new file mode 100644 index 000000000..88e3120dd --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/collectl/cli.pyi @@ -0,0 +1,12 @@ +# Stubs for galaxy.jobs.metrics.collectl.cli (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class CollectlCli: + mode = ... # type: Any + command_args = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def build_command_line(self): ... + def run(self, stdout: Any = ..., stderr: Any = ...): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/collectl/processes.pyi b/typeshed/2.7/galaxy/jobs/metrics/collectl/processes.pyi new file mode 100644 index 000000000..ad6fbd88a --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/collectl/processes.pyi @@ -0,0 +1,24 @@ +# Stubs for galaxy.jobs.metrics.collectl.processes (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +def generate_process_statistics(collectl_playback_cli, pid, statistics: Any = ...): ... + +class CollectlProcessSummarizer: + pid = ... # type: Any + statistics = ... # type: Any + columns_of_interest = ... # type: Any + tree_statistics = ... # type: Any + process_accum_statistics = ... # type: Any + interval_count = ... # type: int + def __init__(self, pid, statistics) -> None: ... + def handle_interval(self, interval): ... + def get_statistics(self): ... + +class CollectlProcessInterval: + rows = ... # type: Any + def __init__(self) -> None: ... + def row_is_in(self, row): ... + def add_row(self, row): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/collectl/stats.pyi b/typeshed/2.7/galaxy/jobs/metrics/collectl/stats.pyi new file mode 100644 index 000000000..39f0c8d0d --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/collectl/stats.pyi @@ -0,0 +1,15 @@ +# Stubs for galaxy.jobs.metrics.collectl.stats (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class StatisticsTracker: + min = ... # type: Any + max = ... # type: Any + count = ... # type: int + sum = ... # type: int + def __init__(self) -> None: ... + def track(self, value): ... + @property + def avg(self): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/collectl/subsystems.pyi b/typeshed/2.7/galaxy/jobs/metrics/collectl/subsystems.pyi new file mode 100644 index 000000000..1da48e66d --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/collectl/subsystems.pyi @@ -0,0 +1,35 @@ +# Stubs for galaxy.jobs.metrics.collectl.subsystems (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +class CollectlSubsystem: + @property + def command_line_arg(self): ... + @property + def name(self, job_directory): ... + +class ProcessesSubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +class CpuSubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +class DiskSubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +class NetworkSubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +class EnvironmentSubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +class MemorySubsystem(CollectlSubsystem): + command_line_arg = ... # type: str + name = ... # type: str + +def get_subsystem(name): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/formatting.pyi b/typeshed/2.7/galaxy/jobs/metrics/formatting.pyi new file mode 100644 index 000000000..ebc91b1ff --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/formatting.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.jobs.metrics.formatting (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +class JobMetricFormatter: + def format(self, key, value): ... + +def seconds_to_str(value): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/__init__.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/__init__.pyi new file mode 100644 index 000000000..ede6717e0 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/__init__.pyi @@ -0,0 +1,16 @@ +# Stubs for galaxy.jobs.metrics.instrumenters (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from ...metrics import formatting as formatting + +INSTRUMENT_FILE_PREFIX = ... # type: str + +class InstrumentPlugin: + formatter = ... # type: Any + @property + def plugin_type(self): ... + def pre_execute_instrument(self, job_directory): ... + def post_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/collectl.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/collectl.pyi new file mode 100644 index 000000000..080d2e5b4 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/collectl.pyi @@ -0,0 +1,22 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.collectl (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class CollectlFormatter(formatting.JobMetricFormatter): + def format(self, key, value): ... + +class CollectlPlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + saved_logs_path = ... # type: Any + summarize_process_data = ... # type: Any + log_collectl_program_output = ... # type: Any + process_statistics = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def post_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/core.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/core.pyi new file mode 100644 index 000000000..885df5a2b --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/core.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.core (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class CorePluginFormatter(formatting.JobMetricFormatter): + def format(self, key, value): ... + +class CorePlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def post_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/cpuinfo.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/cpuinfo.pyi new file mode 100644 index 000000000..00744ed68 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/cpuinfo.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.cpuinfo (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class CpuInfoFormatter(formatting.JobMetricFormatter): + def format(self, key, value): ... + +class CpuInfoPlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + verbose = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/env.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/env.pyi new file mode 100644 index 000000000..411332205 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/env.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.env (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class EnvFormatter(formatting.JobMetricFormatter): ... + +class EnvPlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + variables = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def post_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/meminfo.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/meminfo.pyi new file mode 100644 index 000000000..344cfa861 --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/meminfo.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.meminfo (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class MemInfoFormatter(formatting.JobMetricFormatter): + def format(self, key, value): ... + +class MemInfoPlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + verbose = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/jobs/metrics/instrumenters/uname.pyi b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/uname.pyi new file mode 100644 index 000000000..b541bd02e --- /dev/null +++ b/typeshed/2.7/galaxy/jobs/metrics/instrumenters/uname.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.jobs.metrics.instrumenters.uname (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import formatting +from ..instrumenters import InstrumentPlugin + +class UnameFormatter(formatting.JobMetricFormatter): + def format(self, key, value): ... + +class UnamePlugin(InstrumentPlugin): + plugin_type = ... # type: str + formatter = ... # type: Any + uname_args = ... # type: Any + def __init__(self, **kwargs) -> None: ... + def pre_execute_instrument(self, job_directory): ... + def job_properties(self, job_id, job_directory): ... diff --git a/typeshed/2.7/galaxy/objectstore/__init__.pyi b/typeshed/2.7/galaxy/objectstore/__init__.pyi new file mode 100644 index 000000000..82259bceb --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/__init__.pyi @@ -0,0 +1,80 @@ +# Stubs for galaxy.objectstore (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +object_session = ... # type: Any +NO_SESSION_ERROR_MESSAGE = ... # type: str +log = ... # type: Any + +class ObjectStore: + running = ... # type: bool + extra_dirs = ... # type: Any + config = ... # type: Any + check_old_style = ... # type: Any + def __init__(self, config, **kwargs) -> None: ... + def shutdown(self): ... + def exists(self, obj, base_dir: Optional[Any] = ..., dir_only: bool = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ...): ... + def file_ready(self, obj, base_dir: Optional[Any] = ..., dir_only: bool = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def create(self, obj, base_dir: Optional[Any] = ..., dir_only: bool = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def empty(self, obj, base_dir: Optional[Any] = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def size(self, obj, extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def delete(self, obj, entire_dir: bool = ..., base_dir: Optional[Any] = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def get_data(self, obj, start: int = ..., count: int = ..., base_dir: Optional[Any] = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def get_filename(self, obj, base_dir: Optional[Any] = ..., dir_only: bool = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def update_from_file(self, obj, base_dir: Optional[Any] = ..., extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ..., file_name: Optional[Any] = ..., create: bool = ...): ... + def get_object_url(self, obj, extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ..., obj_dir: bool = ...): ... + def get_store_usage_percent(self): ... + +class DiskObjectStore(ObjectStore): + file_path = ... # type: Any + def __init__(self, config, config_xml: Optional[Any] = ..., file_path: Optional[Any] = ..., extra_dirs: Optional[Any] = ...) -> None: ... + def exists(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + def empty(self, obj, **kwargs): ... + def size(self, obj, **kwargs): ... + def delete(self, obj, entire_dir: bool = ..., **kwargs): ... + def get_data(self, obj, start: int = ..., count: int = ..., **kwargs): ... + def get_filename(self, obj, **kwargs): ... + def update_from_file(self, obj, file_name: Optional[Any] = ..., create: bool = ..., **kwargs): ... + def get_object_url(self, obj, **kwargs): ... + def get_store_usage_percent(self): ... + +class NestedObjectStore(ObjectStore): + backends = ... # type: Any + def __init__(self, config, config_xml: Optional[Any] = ...) -> None: ... + def shutdown(self): ... + def exists(self, obj, **kwargs): ... + def file_ready(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + def empty(self, obj, **kwargs): ... + def size(self, obj, **kwargs): ... + def delete(self, obj, **kwargs): ... + def get_data(self, obj, **kwargs): ... + def get_filename(self, obj, **kwargs): ... + def update_from_file(self, obj, **kwargs): ... + def get_object_url(self, obj, **kwargs): ... + +class DistributedObjectStore(NestedObjectStore): + distributed_config = ... # type: Any + backends = ... # type: Any + weighted_backend_ids = ... # type: Any + original_weighted_backend_ids = ... # type: Any + max_percent_full = ... # type: Any + global_max_percent_full = ... # type: float + sleeper = ... # type: Any + filesystem_monitor_thread = ... # type: Any + def __init__(self, config, config_xml: Optional[Any] = ..., fsmon: bool = ...) -> None: ... + def shutdown(self): ... + def create(self, obj, **kwargs): ... + +class HierarchicalObjectStore(NestedObjectStore): + backends = ... # type: Any + def __init__(self, config, config_xml: Optional[Any] = ..., fsmon: bool = ...) -> None: ... + def exists(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + +def build_object_store_from_config(config, fsmon: bool = ..., config_xml: Optional[Any] = ...): ... +def local_extra_dirs(func): ... +def convert_bytes(bytes): ... diff --git a/typeshed/2.7/galaxy/objectstore/azure_blob.pyi b/typeshed/2.7/galaxy/objectstore/azure_blob.pyi new file mode 100644 index 000000000..89b58c1ad --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/azure_blob.pyi @@ -0,0 +1,29 @@ +# Stubs for galaxy.objectstore.azure_blob (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..objectstore import convert_bytes as convert_bytes, ObjectStore as ObjectStore + +BlockBlobService = ... # type: Any +NO_BLOBSERVICE_ERROR_MESSAGE = ... # type: str +log = ... # type: Any + +class AzureBlobObjectStore(ObjectStore): + staging_path = ... # type: Any + transfer_progress = ... # type: int + cache_size = ... # type: Any + sleeper = ... # type: Any + cache_monitor_thread = ... # type: Any + def __init__(self, config, config_xml) -> None: ... + def exists(self, obj, **kwargs): ... + def file_ready(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + def empty(self, obj, **kwargs): ... + def size(self, obj, **kwargs): ... + def delete(self, obj, entire_dir: bool = ..., **kwargs): ... + def get_data(self, obj, start: int = ..., count: int = ..., **kwargs): ... + def get_filename(self, obj, **kwargs): ... + def update_from_file(self, obj, file_name: Optional[Any] = ..., create: bool = ..., **kwargs): ... + def get_object_url(self, obj, **kwargs): ... + def get_store_usage_percent(self): ... diff --git a/typeshed/2.7/galaxy/objectstore/pulsar.pyi b/typeshed/2.7/galaxy/objectstore/pulsar.pyi new file mode 100644 index 000000000..bad104522 --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/pulsar.pyi @@ -0,0 +1,24 @@ +# Stubs for galaxy.objectstore.pulsar (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..objectstore import ObjectStore as ObjectStore + +ObjectStoreClientManager = ... # type: Any + +class PulsarObjectStore(ObjectStore): + pulsar_client = ... # type: Any + def __init__(self, config, config_xml) -> None: ... + def exists(self, obj, **kwds): ... + def file_ready(self, obj, **kwds): ... + def create(self, obj, **kwds): ... + def empty(self, obj, **kwds): ... + def size(self, obj, **kwds): ... + def delete(self, obj, **kwds): ... + def get_data(self, obj, **kwds): ... + def get_filename(self, obj, **kwds): ... + def update_from_file(self, obj, **kwds): ... + def get_store_usage_percent(self): ... + def get_object_url(self, obj, extra_dir: Optional[Any] = ..., extra_dir_at_root: bool = ..., alt_name: Optional[Any] = ...): ... + def shutdown(self): ... diff --git a/typeshed/2.7/galaxy/objectstore/rods.pyi b/typeshed/2.7/galaxy/objectstore/rods.pyi new file mode 100644 index 000000000..125444b20 --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/rods.pyi @@ -0,0 +1,32 @@ +# Stubs for galaxy.objectstore.rods (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from posixpath import basename as path_basename +from posixpath import dirname as path_dirname +from posixpath import join as path_join +from ..objectstore import DiskObjectStore as DiskObjectStore, local_extra_dirs as local_extra_dirs + +irods = ... # type: Any +IRODS_IMPORT_MESSAGE = ... # type: str +log = ... # type: Any + +class IRODSObjectStore(DiskObjectStore): + cache_path = ... # type: Any + default_resource = ... # type: Any + root_collection_path = ... # type: Any + root_collection = ... # type: Any + def __init__(self, config, file_path: Optional[Any] = ..., extra_dirs: Optional[Any] = ...) -> None: ... + def exists(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + def empty(self, obj, **kwargs): ... + def size(self, obj, **kwargs): ... + def delete(self, obj, entire_dir: bool = ..., **kwargs): ... + def get_data(self, obj, start: int = ..., count: int = ..., **kwargs): ... + def get_filename(self, obj, **kwargs): ... + def update_from_file(self, obj, file_name: Optional[Any] = ..., create: bool = ..., **kwargs): ... + def get_object_url(self, obj, **kwargs): ... + def get_store_usage_percent(self): ... + +def rods_connect(): ... diff --git a/typeshed/2.7/galaxy/objectstore/s3.pyi b/typeshed/2.7/galaxy/objectstore/s3.pyi new file mode 100644 index 000000000..8ffbd92c5 --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/s3.pyi @@ -0,0 +1,34 @@ +# Stubs for galaxy.objectstore.s3 (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .s3_multipart_upload import multipart_upload as multipart_upload +from ..objectstore import convert_bytes as convert_bytes, ObjectStore as ObjectStore + +boto = ... # type: Any +NO_BOTO_ERROR_MESSAGE = ... # type: str +log = ... # type: Any + +class S3ObjectStore(ObjectStore): + staging_path = ... # type: Any + transfer_progress = ... # type: int + bucket = ... # type: Any + cache_size = ... # type: Any + sleeper = ... # type: Any + cache_monitor_thread = ... # type: Any + use_axel = ... # type: bool + def __init__(self, config, config_xml) -> None: ... + def file_ready(self, obj, **kwargs): ... + def exists(self, obj, **kwargs): ... + def create(self, obj, **kwargs): ... + def empty(self, obj, **kwargs): ... + def size(self, obj, **kwargs): ... + def delete(self, obj, entire_dir: bool = ..., **kwargs): ... + def get_data(self, obj, start: int = ..., count: int = ..., **kwargs): ... + def get_filename(self, obj, **kwargs): ... + def update_from_file(self, obj, file_name: Optional[Any] = ..., create: bool = ..., **kwargs): ... + def get_object_url(self, obj, **kwargs): ... + def get_store_usage_percent(self): ... + +class SwiftObjectStore(S3ObjectStore): ... diff --git a/typeshed/2.7/galaxy/objectstore/s3_multipart_upload.pyi b/typeshed/2.7/galaxy/objectstore/s3_multipart_upload.pyi new file mode 100644 index 000000000..9bf1d8726 --- /dev/null +++ b/typeshed/2.7/galaxy/objectstore/s3_multipart_upload.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy.objectstore.s3_multipart_upload (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +boto = ... # type: Any + +def map_wrap(f): ... +def mp_from_ids(s3server, mp_id, mp_keyname, mp_bucketname): ... +def transfer_part(s3server, mp_id, mp_keyname, mp_bucketname, i, part): ... +def multipart_upload(s3server, bucket, s3_key_name, tarball, mb_size): ... +def multimap(cores: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/__init__.pyi b/typeshed/2.7/galaxy/tools/__init__.pyi new file mode 100644 index 000000000..ef883e955 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/__init__.pyi @@ -0,0 +1,4 @@ +# Stubs for galaxy.tools (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + diff --git a/typeshed/2.7/galaxy/tools/cwl/__init__.pyi b/typeshed/2.7/galaxy/tools/cwl/__init__.pyi new file mode 100644 index 000000000..72bc0494f --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/__init__.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.tools.cwl (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from .cwltool_deps import needs_shell_quoting as needs_shell_quoting, shellescape as shellescape +from .parser import tool_proxy as tool_proxy, workflow_proxy as workflow_proxy +from .representation import to_cwl_job as to_cwl_job, to_galaxy_parameters as to_galaxy_parameters +from .runtime_actions import handle_outputs as handle_outputs diff --git a/typeshed/2.7/galaxy/tools/cwl/cwltool_deps.pyi b/typeshed/2.7/galaxy/tools/cwl/cwltool_deps.pyi new file mode 100644 index 000000000..351a4208d --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/cwltool_deps.pyi @@ -0,0 +1,22 @@ +# Stubs for galaxy.tools.cwl.cwltool_deps (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from cwltool import main as main, workflow as workflow, process as process, pathmapper as pathmapper +from cwltool import load_tool as load_tool +import shellescape as shellescape +import schema_salad as schema_salad +from schema_salad import ref_resolver as ref_resolver + +main = ... # type: Any +workflow = ... # type: Any +process = ... # type: Any +pathmapper = ... # type: Any +load_tool = ... # type: Any +shellescape = ... # type: Any +schema_salad = ... # type: Any +ref_resolver = ... # type: Any +needs_shell_quoting = ... # type: Any + +def ensure_cwltool_available(): ... diff --git a/typeshed/2.7/galaxy/tools/cwl/parser.pyi b/typeshed/2.7/galaxy/tools/cwl/parser.pyi new file mode 100644 index 000000000..369b14688 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/parser.pyi @@ -0,0 +1,94 @@ +# Stubs for galaxy.tools.cwl.parser (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def tool_proxy(tool_path, strict_cwl_validation: bool = ...): ... +def load_job_proxy(job_directory, strict_cwl_validation: bool = ...): ... + +class ToolProxy: + def __init__(self, tool, tool_path) -> None: ... + def job_proxy(self, input_dict, output_dict, job_directory: str = ...): ... + def input_instances(self): ... + def output_instances(self): ... + def docker_identifier(self): ... + def description(self): ... + def label(self): ... + +class CommandLineToolProxy(ToolProxy): + def description(self): ... + def label(self): ... + def input_instances(self): ... + def output_instances(self): ... + def docker_identifier(self): ... + +class ExpressionToolProxy(CommandLineToolProxy): ... + +class JobProxy: + def __init__(self, tool_proxy, input_dict, output_dict, job_directory) -> None: ... + def cwl_job(self): ... + @property + def is_command_line_job(self): ... + @property + def command_line(self): ... + @property + def stdin(self): ... + @property + def stdout(self): ... + @property + def environment(self): ... + @property + def generate_files(self): ... + def collect_outputs(self, tool_working_directory): ... + def save_job(self): ... + def output_id(self, output_name): ... + def output_path(self, output_name): ... + def output_secondary_files_dir(self, output_name, create: bool = ...): ... + def stage_files(self): ... + +class WorkflowProxy: + def __init__(self, workflow, workflow_path) -> None: ... + def step_proxies(self): ... + @property + def runnables(self): ... + def to_dict(self): ... + +class StepProxy: + def __init__(self, workflow_proxy, step) -> None: ... + def to_dict(self): ... + +class ConditionalInstance: + input_type = ... # type: Any + name = ... # type: Any + case = ... # type: Any + whens = ... # type: Any + def __init__(self, name, case, whens) -> None: ... + def to_dict(self): ... + +class SelectInputInstance: + input_type = ... # type: Any + name = ... # type: Any + label = ... # type: Any + description = ... # type: Any + options = ... # type: Any + def __init__(self, name, label, description, options) -> None: ... + def to_dict(self): ... + +class InputInstance: + input_type = ... # type: Any + name = ... # type: Any + label = ... # type: Any + description = ... # type: Any + required = ... # type: bool + array = ... # type: Any + area = ... # type: Any + def __init__(self, name, label, description, input_type, array: bool = ..., area: bool = ...) -> None: ... + def to_dict(self, itemwise: bool = ...): ... + +class OutputInstance: + name = ... # type: Any + output_data_type = ... # type: Any + output_type = ... # type: Any + path = ... # type: Any + def __init__(self, name, output_data_type, output_type, path: Optional[Any] = ...) -> None: ... diff --git a/typeshed/2.7/galaxy/tools/cwl/representation.pyi b/typeshed/2.7/galaxy/tools/cwl/representation.pyi new file mode 100644 index 000000000..ef2cc45fe --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/representation.pyi @@ -0,0 +1,12 @@ +# Stubs for galaxy.tools.cwl.representation (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +log = ... # type: Any +NOT_PRESENT = ... # type: Any +GALAXY_TO_CWL_TYPES = ... # type: Any + +def to_cwl_job(tool, param_dict, local_working_directory): ... +def to_galaxy_parameters(tool, as_dict): ... diff --git a/typeshed/2.7/galaxy/tools/cwl/runtime_actions.pyi b/typeshed/2.7/galaxy/tools/cwl/runtime_actions.pyi new file mode 100644 index 000000000..4f1558d99 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/runtime_actions.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.cwl.runtime_actions (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def handle_outputs(job_directory: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/cwl/schema.pyi b/typeshed/2.7/galaxy/tools/cwl/schema.pyi new file mode 100644 index 000000000..1c51ead4e --- /dev/null +++ b/typeshed/2.7/galaxy/tools/cwl/schema.pyi @@ -0,0 +1,22 @@ +# Stubs for galaxy.tools.cwl.schema (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .cwltool_deps import ensure_cwltool_available as ensure_cwltool_available, load_tool as load_tool, schema_salad as schema_salad, workflow as workflow +from collections import namedtuple + +RawProcessReference = namedtuple('RawProcessReference', ['process_object', 'uri']) + +ProcessDefinition = namedtuple('ProcessDefinition', ['process_object', 'metadata', 'document_loader', 'avsc_names', 'raw_process_reference']) + +class SchemaLoader: + def __init__(self, strict: bool = ...) -> None: ... + @property + def raw_document_loader(self): ... + def raw_process_reference(self, path): ... + def process_definition(self, raw_reference): ... + def tool(self, **kwds): ... + +schema_loader = ... # type: Any +non_strict_schema_loader = ... # type: Any diff --git a/typeshed/2.7/galaxy/tools/deps/__init__.pyi b/typeshed/2.7/galaxy/tools/deps/__init__.pyi new file mode 100644 index 000000000..2bf533cd6 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/__init__.pyi @@ -0,0 +1,41 @@ +# Stubs for galaxy.tools.deps (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .requirements import ToolRequirement as ToolRequirement, ToolRequirements as ToolRequirements +from .resolvers import NullDependency as NullDependency +from .resolvers.conda import CondaDependencyResolver as CondaDependencyResolver +from .resolvers.galaxy_packages import GalaxyPackageDependencyResolver as GalaxyPackageDependencyResolver +from .resolvers.tool_shed_packages import ToolShedPackageDependencyResolver as ToolShedPackageDependencyResolver + +log = ... # type: Any +CONFIG_VAL_NOT_FOUND = ... # type: Any + +def build_dependency_manager(config: Any) -> DependencyManager: ... + +class NullDependencyManager: + dependency_resolvers = ... # type: Any + def uses_tool_shed_dependencies(self): ... + def dependency_shell_commands(self, requirements: ToolRequirements, **kwds) -> List[str]: ... + def find_dep(self, name, version: Optional[Any] = ..., type: str = ..., **kwds): ... + +class DependencyManager: + default_base_path = ... # type: Any + resolver_classes = ... # type: Any + dependency_resolvers = ... # type: Any + def __init__(self, default_base_path, conf_file: Optional[Any] = ..., app_config: Any = ...) -> None: ... + def get_resolver_option(self, resolver, key, explicit_resolver_options: Any = ...): ... + def get_app_option(self, key, default: Optional[Any] = ...): ... + def dependency_shell_commands(self, requirements: ToolRequirements, **kwds) -> List[str]: ... + def requirements_to_dependencies(self, requirements, **kwds): ... + def uses_tool_shed_dependencies(self): ... + def find_dep(self, name, version: Optional[Any] = ..., type: str = ..., **kwds): ... + +class CachedDependencyManager(DependencyManager): + tool_dependency_cache_dir = ... # type: Any + def __init__(self, default_base_path, conf_file: Optional[Any] = ..., app_config: Any = ..., tool_dependency_cache_dir: Optional[Any] = ...) -> None: ... + def build_cache(self, requirements, **kwds): ... + def dependency_shell_commands(self, requirements: ToolRequirements, **kwds) -> List[str]: ... + def hash_dependencies(self, resolved_dependencies): ... + def get_hashed_dependencies_path(self, resolved_dependencies): ... diff --git a/typeshed/2.7/galaxy/tools/deps/brew_exts.pyi b/typeshed/2.7/galaxy/tools/deps/brew_exts.pyi new file mode 100644 index 000000000..c526375e6 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/brew_exts.pyi @@ -0,0 +1,74 @@ +# Stubs for galaxy.tools.deps.brew_exts (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +WHITESPACE_PATTERN = ... # type: Any +DESCRIPTION = ... # type: str +DEFAULT_HOMEBREW_ROOT = ... # type: str +NO_BREW_ERROR_MESSAGE = ... # type: str +CANNOT_DETERMINE_TAP_ERROR_MESSAGE = ... # type: str +VERBOSE = ... # type: bool +RELAXED = ... # type: bool +BREW_ARGS = ... # type: Any + +class BrewContext: + homebrew_prefix = ... # type: Any + homebrew_cellar = ... # type: Any + def __init__(self, args: Optional[Any] = ...) -> None: ... + +class RecipeContext: + @staticmethod + def from_args(args, brew_context: Optional[Any] = ...): ... + recipe = ... # type: Any + version = ... # type: Any + brew_context = ... # type: Any + def __init__(self, recipe, version, brew_context: Optional[Any] = ...) -> None: ... + @property + def cellar_path(self): ... + @property + def tap_path(self): ... + +def main(): ... + +class CommandLineException(Exception): + command = ... # type: Any + stdout = ... # type: Any + stderr = ... # type: Any + message = ... # type: Any + def __init__(self, command, stdout, stderr) -> None: ... + +def versioned_install(recipe_context, package: Optional[Any] = ..., version: Optional[Any] = ..., installed_deps: Any = ...): ... +def commit_for_version(recipe_context, package, version): ... +def print_versioned_deps(recipe_context, recipe, version): ... +def load_versioned_deps(cellar_path, relaxed: Optional[Any] = ...): ... +def unversioned_install(package): ... +def attempt_unlink_all(package, deps): ... +def attempt_unlink(package): ... +def brew_execute(args, env: Optional[Any] = ...): ... +def build_env_statements_from_recipe_context(recipe_context, **kwds): ... +def build_env_statements(cellar_root, cellar_path, relaxed: Optional[Any] = ..., custom_only: bool = ...): ... +def build_env_actions(deps, cellar_root, cellar_path, relaxed: Optional[Any] = ..., custom_only: bool = ...): ... + +class EnvAction: + variable = ... # type: Any + action = ... # type: Any + value = ... # type: Any + def __init__(self, keg_root, action_description) -> None: ... + @staticmethod + def build_env(env_actions): ... + def modify_environ(self, environ): ... + def to_statements(self): ... + +def brew_head_at_version(recipe_context, package, version): ... +def brew_head_at_commit(commit, tap_path): ... +def git_execute(args): ... +def execute(cmds, env: Optional[Any] = ...): ... +def brew_deps(package): ... +def brew_info(recipe): ... +def extended_brew_info(recipe): ... +def brew_versions_info(package, tap_path): ... +def recipe_cellar_path(cellar_path, recipe, version): ... +def ensure_brew_on_path(args): ... +def which(file): ... diff --git a/typeshed/2.7/galaxy/tools/deps/brew_util.pyi b/typeshed/2.7/galaxy/tools/deps/brew_util.pyi new file mode 100644 index 000000000..c791f1832 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/brew_util.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.tools.deps.brew_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from ..deps import brew_exts as brew_exts + +DEFAULT_TAP = ... # type: str + +class HomebrewRecipe: + recipe = ... # type: Any + version = ... # type: Any + tap = ... # type: Any + def __init__(self, recipe, version, tap) -> None: ... + +def requirements_to_recipes(requirements): ... +def requirement_to_recipe(requirement): ... +def requirements_to_recipe_contexts(requirements, brew_context): ... diff --git a/typeshed/2.7/galaxy/tools/deps/commands.pyi b/typeshed/2.7/galaxy/tools/deps/commands.pyi new file mode 100644 index 000000000..a11b90dc8 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/commands.pyi @@ -0,0 +1,22 @@ +# Stubs for galaxy.tools.deps.commands (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from galaxy.util import which as which + +def redirecting_io(sys: Any = ...): ... +def redirect_aware_commmunicate(p, sys: Any = ...): ... +def shell(cmds, env: Optional[Any] = ..., **kwds): ... +def shell_process(cmds, env: Optional[Any] = ..., **kwds): ... +def execute(cmds): ... +def argv_to_str(command_argv, quote: bool = ...): ... +def download_command(url, to: Any = ..., quote_url: bool = ...): ... + +class CommandLineException(Exception): + command = ... # type: Any + stdout = ... # type: Any + stderr = ... # type: Any + returncode = ... # type: Any + message = ... # type: Any + def __init__(self, command, stdout, stderr, returncode) -> None: ... diff --git a/typeshed/2.7/galaxy/tools/deps/conda_compat.pyi b/typeshed/2.7/galaxy/tools/deps/conda_compat.pyi new file mode 100644 index 000000000..0cc638263 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/conda_compat.pyi @@ -0,0 +1,21 @@ +# Stubs for galaxy.tools.deps.conda_compat (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from conda_build.metadata import MetaData as MetaData + +MetaData = ... # type: Any + +class _Memoized: + func = ... # type: Any + cache = ... # type: Any + def __init__(self, func) -> None: ... + def __call__(self, *args): ... + +def raw_metadata(recipe_dir): ... + +class _MetaData: + meta = ... # type: Any + def __init__(self, input_dir) -> None: ... + def get_value(self, field, default: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/conda_util.pyi b/typeshed/2.7/galaxy/tools/deps/conda_util.pyi new file mode 100644 index 000000000..1e418baab --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/conda_util.pyi @@ -0,0 +1,69 @@ +# Stubs for galaxy.tools.deps.conda_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +import installable +from sys import platform as _platform + +class CondaContext(installable.InstallableContext): + installable_description = ... # type: str + condarc_override = ... # type: Any + conda_exec = ... # type: Any + debug = ... # type: Any + shell_exec = ... # type: Any + copy_dependencies = ... # type: Any + conda_prefix = ... # type: Any + ensure_channels = ... # type: Any + ensured_channels = ... # type: bool + use_local = ... # type: Any + def __init__(self, conda_prefix: Optional[Any] = ..., conda_exec: Optional[Any] = ..., shell_exec: Optional[Any] = ..., debug: bool = ..., ensure_channels: str = ..., condarc_override: Optional[Any] = ..., use_path_exec: Any = ..., copy_dependencies: bool = ..., use_local: Any = ...) -> None: ... + @property + def conda_version(self): ... + @property + def conda_build_available(self): ... + def ensure_channels_configured(self): ... + def ensure_conda_build_installed_if_needed(self): ... + def conda_info(self): ... + def is_conda_installed(self): ... + def can_install_conda(self): ... + def load_condarc(self): ... + def save_condarc(self, conf): ... + @property + def condarc(self): ... + def command(self, operation, args): ... + def exec_command(self, operation, args): ... + def exec_create(self, args, allow_local: bool = ...): ... + def exec_remove(self, args): ... + def exec_install(self, args, allow_local: bool = ...): ... + def exec_clean(self, args: Any = ..., quiet: bool = ...): ... + def export_list(self, name, path): ... + def env_path(self, env_name): ... + @property + def envs_path(self): ... + def has_env(self, env_name): ... + @property + def deactivate(self): ... + @property + def activate(self): ... + def is_installed(self): ... + def can_install(self): ... + @property + def parent_path(self): ... + +class CondaTarget: + package = ... # type: Any + version = ... # type: Any + channel = ... # type: Any + def __init__(self, package, version: Optional[Any] = ..., channel: Optional[Any] = ...) -> None: ... + @property + def package_specifier(self): ... + @property + def install_environment(self): ... + def __hash__(self): ... + def __eq__(self, other): ... + def __ne__(self, other): ... + +def install_conda(conda_context: Optional[Any] = ..., force_conda_build: bool = ...): ... +def install_conda_target(conda_target, conda_context: Optional[Any] = ..., skip_environment: bool = ...): ... +def requirements_to_conda_targets(requirements, conda_context: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/container_resolvers/__init__.pyi b/typeshed/2.7/galaxy/tools/deps/container_resolvers/__init__.pyi new file mode 100644 index 000000000..4e8c8222c --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/container_resolvers/__init__.pyi @@ -0,0 +1,14 @@ +# Stubs for galaxy.tools.deps.container_resolvers (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from galaxy.util.dictifiable import Dictifiable + +class ContainerResolver(Dictifiable): + dict_collection_visible_keys = ... # type: Any + app_info = ... # type: Any + resolver_kwds = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., **kwds) -> None: ... + def resolve(self, tool_info): ... + def resolver_type(self): ... diff --git a/typeshed/2.7/galaxy/tools/deps/container_resolvers/explicit.pyi b/typeshed/2.7/galaxy/tools/deps/container_resolvers/explicit.pyi new file mode 100644 index 000000000..3f45f9529 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/container_resolvers/explicit.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.tools.deps.container_resolvers.explicit (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from ..container_resolvers import ContainerResolver + +class ExplicitContainerResolver(ContainerResolver): + resolver_type = ... # type: str + def resolve(self, enabled_container_types, tool_info): ... diff --git a/typeshed/2.7/galaxy/tools/deps/container_resolvers/mulled.pyi b/typeshed/2.7/galaxy/tools/deps/container_resolvers/mulled.pyi new file mode 100644 index 000000000..5f7a6b4ee --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/container_resolvers/mulled.pyi @@ -0,0 +1,55 @@ +# Stubs for galaxy.tools.deps.container_resolvers.mulled (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..container_resolvers import ContainerResolver +from collections import namedtuple + +CachedMulledImageSingleTarget = namedtuple('CachedMulledImageSingleTarget', ['package_name', 'version', 'build', 'image_identifier']) + +CachedV1MulledImageMultiTarget = namedtuple('CachedV1MulledImageMultiTarget', ['hash', 'build', 'image_identifier']) + +CachedV2MulledImageMultiTarget = namedtuple('CachedV2MulledImageMultiTarget', ['package_hash', 'version_hash', 'build', 'image_identifier']) + +class CachedMulledDockerContainerResolver(ContainerResolver): + resolver_type = ... # type: str + container_type = ... # type: str + namespace = ... # type: Any + hash_func = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., namespace: Optional[Any] = ..., hash_func: str = ...) -> None: ... + def resolve(self, enabled_container_types, tool_info): ... + +class CachedMulledSingularityContainerResolver(ContainerResolver): + resolver_type = ... # type: str + container_type = ... # type: str + cache_directory = ... # type: Any + hash_func = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., hash_func: str = ...) -> None: ... + def resolve(self, enabled_container_types, tool_info): ... + +class MulledDockerContainerResolver(ContainerResolver): + resolver_type = ... # type: str + container_type = ... # type: str + namespace = ... # type: Any + hash_func = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., namespace: str = ..., hash_func: str = ...) -> None: ... + def resolve(self, enabled_container_types, tool_info): ... + +class BuildMulledDockerContainerResolver(ContainerResolver): + resolver_type = ... # type: str + container_type = ... # type: str + namespace = ... # type: Any + hash_func = ... # type: Any + auto_init = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., namespace: str = ..., hash_func: str = ..., **kwds) -> None: ... + def resolve(self, enabled_container_types, tool_info): ... + +class BuildMulledSingularityContainerResolver(ContainerResolver): + resolver_type = ... # type: str + container_type = ... # type: str + cache_directory = ... # type: Any + hash_func = ... # type: Any + auto_init = ... # type: Any + def __init__(self, app_info: Optional[Any] = ..., hash_func: str = ..., **kwds) -> None: ... + def resolve(self, enabled_container_types, tool_info): ... diff --git a/typeshed/2.7/galaxy/tools/deps/containers.pyi b/typeshed/2.7/galaxy/tools/deps/containers.pyi new file mode 100644 index 000000000..5a18a6321 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/containers.pyi @@ -0,0 +1,99 @@ +# Stubs for galaxy.tools.deps.containers (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .container_resolvers.explicit import ExplicitContainerResolver as ExplicitContainerResolver +from .container_resolvers.mulled import BuildMulledDockerContainerResolver as BuildMulledDockerContainerResolver, BuildMulledSingularityContainerResolver as BuildMulledSingularityContainerResolver, CachedMulledDockerContainerResolver as CachedMulledDockerContainerResolver, CachedMulledSingularityContainerResolver as CachedMulledSingularityContainerResolver, MulledDockerContainerResolver as MulledDockerContainerResolver +from .requirements import ContainerDescription as ContainerDescription +from .requirements import DEFAULT_CONTAINER_RESOLVE_DEPENDENCIES as DEFAULT_CONTAINER_RESOLVE_DEPENDENCIES, DEFAULT_CONTAINER_SHELL as DEFAULT_CONTAINER_SHELL +from ..deps import docker_util as docker_util +from ..deps import singularity_util as singularity_util + +log = ... # type: Any +DOCKER_CONTAINER_TYPE = ... # type: str +SINGULARITY_CONTAINER_TYPE = ... # type: str +DEFAULT_CONTAINER_TYPE = ... # type: Any +ALL_CONTAINER_TYPES = ... # type: Any +LOAD_CACHED_IMAGE_COMMAND_TEMPLATE = ... # type: str + +class ContainerFinder: + app_info = ... # type: Any + container_registry = ... # type: Any + def __init__(self, app_info) -> None: ... + def find_best_container_description(self, enabled_container_types, tool_info): ... + def find_container(self, tool_info, destination_info, job_info): ... + +class NullContainerFinder: + def find_container(self, tool_info, destination_info, job_info): ... + +class ContainerRegistry: + resolver_classes = ... # type: Any + enable_beta_mulled_containers = ... # type: Any + app_info = ... # type: Any + container_resolvers = ... # type: Any + def __init__(self, app_info) -> None: ... + def find_best_container_description(self, enabled_container_types, tool_info): ... + +class AppInfo: + galaxy_root_dir = ... # type: Any + default_file_path = ... # type: Any + outputs_to_working_directory = ... # type: Any + container_image_cache_path = ... # type: Any + library_import_dir = ... # type: Any + enable_beta_mulled_containers = ... # type: Any + containers_resolvers_config_file = ... # type: Any + involucro_path = ... # type: Any + involucro_auto_init = ... # type: Any + def __init__(self, galaxy_root_dir: Optional[Any] = ..., default_file_path: Optional[Any] = ..., outputs_to_working_directory: bool = ..., container_image_cache_path: Optional[Any] = ..., library_import_dir: Optional[Any] = ..., enable_beta_mulled_containers: bool = ..., containers_resolvers_config_file: Optional[Any] = ..., involucro_path: Optional[Any] = ..., involucro_auto_init: bool = ...) -> None: ... + +class ToolInfo: + container_descriptions = ... # type: Any + requirements = ... # type: Any + requires_galaxy_python_environment = ... # type: Any + env_pass_through = ... # type: Any + def __init__(self, container_descriptions: Any = ..., requirements: Any = ..., requires_galaxy_python_environment: bool = ...) -> None: ... + +class JobInfo: + working_directory = ... # type: Any + job_directory = ... # type: Any + tool_directory = ... # type: Any + job_directory_type = ... # type: Any + def __init__(self, working_directory, tool_directory, job_directory, job_directory_type) -> None: ... + +class Container: + container_id = ... # type: Any + app_info = ... # type: Any + tool_info = ... # type: Any + destination_info = ... # type: Any + job_info = ... # type: Any + container_description = ... # type: Any + def __init__(self, container_id, app_info, tool_info, destination_info, job_info, container_description) -> None: ... + @property + def resolve_dependencies(self): ... + @property + def shell(self): ... + def containerize_command(self, command): ... + +def preprocess_volumes(volumes_raw_str, container_type): ... + +class HasDockerLikeVolumes: ... + +class DockerContainer(Container, HasDockerLikeVolumes): + container_type = ... # type: Any + def containerize_command(self, command): ... + +def docker_cache_path(cache_directory, container_id): ... + +class SingularityContainer(Container, HasDockerLikeVolumes): + container_type = ... # type: Any + def containerize_command(self, command): ... + +CONTAINER_CLASSES = ... # type: Any + +class NullContainer: + def __init__(self) -> None: ... + def __bool__(self): ... + __nonzero__ = ... # type: Any + +NULL_CONTAINER = ... # type: Any diff --git a/typeshed/2.7/galaxy/tools/deps/dependencies.pyi b/typeshed/2.7/galaxy/tools/deps/dependencies.pyi new file mode 100644 index 000000000..04907feff --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/dependencies.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy.tools.deps.dependencies (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class DependenciesDescription: + requirements = ... # type: Any + installed_tool_dependencies = ... # type: Any + def __init__(self, requirements: Any = ..., installed_tool_dependencies: Any = ...) -> None: ... + def to_dict(self): ... + @staticmethod + def from_dict(as_dict): ... diff --git a/typeshed/2.7/galaxy/tools/deps/docker_util.pyi b/typeshed/2.7/galaxy/tools/deps/docker_util.pyi new file mode 100644 index 000000000..e98b338cc --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/docker_util.pyi @@ -0,0 +1,41 @@ +# Stubs for galaxy.tools.deps.docker_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .commands import argv_to_str as argv_to_str + +DEFAULT_DOCKER_COMMAND = ... # type: str +DEFAULT_SUDO = ... # type: bool +DEFAULT_SUDO_COMMAND = ... # type: str +DEFAULT_HOST = ... # type: Any +DEFAULT_VOLUME_MOUNT_TYPE = ... # type: str +DEFAULT_WORKING_DIRECTORY = ... # type: Any +DEFAULT_NET = ... # type: Any +DEFAULT_MEMORY = ... # type: Any +DEFAULT_VOLUMES_FROM = ... # type: Any +DEFAULT_AUTO_REMOVE = ... # type: bool +DEFAULT_SET_USER = ... # type: str +DEFAULT_RUN_EXTRA_ARGUMENTS = ... # type: Any + +class DockerVolume: + from_path = ... # type: Any + to_path = ... # type: Any + how = ... # type: Any + def __init__(self, path, to_path: Optional[Any] = ..., how: Any = ...) -> None: ... + @staticmethod + def volumes_from_str(volumes_as_str): ... + @staticmethod + def volume_from_str(as_str): ... + +def kill_command(container, signal: Optional[Any] = ..., **kwds): ... +def logs_command(container, **kwds): ... +def build_command(image, docker_build_path, **kwds): ... +def build_save_image_command(image, destination, **kwds): ... +def build_pull_command(tag, **kwds): ... +def build_docker_cache_command(image, **kwds): ... +def build_docker_images_command(truncate: bool = ..., **kwds): ... +def build_docker_load_command(**kwds): ... +def build_docker_run_command(container_command, image, interactive: bool = ..., terminal: bool = ..., tag: Optional[Any] = ..., volumes: Any = ..., volumes_from: Any = ..., memory: Any = ..., env_directives: Any = ..., working_directory: Any = ..., name: Optional[Any] = ..., net: Any = ..., run_extra_arguments: Any = ..., docker_cmd: Any = ..., sudo: Any = ..., sudo_cmd: Any = ..., auto_rm: Any = ..., set_user: Any = ..., host: Any = ...): ... +def command_list(command, command_args: Any = ..., **kwds): ... +def command_shell(command, command_args: Any = ..., **kwds): ... diff --git a/typeshed/2.7/galaxy/tools/deps/dockerfiles.pyi b/typeshed/2.7/galaxy/tools/deps/dockerfiles.pyi new file mode 100644 index 000000000..3cf02d563 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/dockerfiles.pyi @@ -0,0 +1,15 @@ +# Stubs for galaxy.tools.deps.dockerfiles (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..deps import commands as commands +from ..deps import docker_util as docker_util +from ..deps.containers import docker_cache_path as docker_cache_path +from ..deps.requirements import parse_requirements_from_xml as parse_requirements_from_xml +from ...tools import loader_directory as loader_directory + +log = ... # type: Any + +def docker_host_args(**kwds): ... +def dockerfile_build(path, dockerfile: Optional[Any] = ..., error: Any = ..., **kwds): ... diff --git a/typeshed/2.7/galaxy/tools/deps/installable.pyi b/typeshed/2.7/galaxy/tools/deps/installable.pyi new file mode 100644 index 000000000..818eaa26e --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/installable.pyi @@ -0,0 +1,15 @@ +# Stubs for galaxy.tools.deps.installable (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +log = ... # type: Any + +class InstallableContext: + def is_installed(self): ... + def can_install(self): ... + def installable_description(self): ... + def parent_path(self): ... + +def ensure_installed(installable_context, install_func, auto_init): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/__init__.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/__init__.pyi new file mode 100644 index 000000000..a3f6bf315 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/__init__.pyi @@ -0,0 +1,4 @@ +# Stubs for galaxy.tools.deps.mulled (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/_cli.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/_cli.pyi new file mode 100644 index 000000000..db35991cc --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/_cli.pyi @@ -0,0 +1,5 @@ +# Stubs for galaxy.tools.deps.mulled._cli (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def arg_parser(argv, globals): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build.pyi new file mode 100644 index 000000000..25650508b --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build.pyi @@ -0,0 +1,24 @@ +# Stubs for galaxy.tools.deps.mulled.mulled_build (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +import installable +from sys import platform as _platform + +class BuildExistsException(Exception): ... + +class InvolucroContext(installable.InstallableContext): + installable_description = ... # type: str + involucro_bin = ... # type: str + shell_exec = ... # type: Any + verbose = ... # type: Any + def __init__(self, involucro_bin: Optional[Any] = ..., shell_exec: Optional[Any] = ..., verbose: str = ...) -> None: ... + def build_command(self, involucro_args): ... + def exec_command(self, involucro_args): ... + def is_installed(self): ... + def can_install(self): ... + @property + def parent_path(self): ... + +def main(argv: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_channel.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_channel.pyi new file mode 100644 index 000000000..c0039bf4d --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_channel.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.deps.mulled.mulled_build_channel (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def main(argv: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_files.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_files.pyi new file mode 100644 index 000000000..0057d4d8b --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_files.pyi @@ -0,0 +1,10 @@ +# Stubs for galaxy.tools.deps.mulled.mulled_build_files (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from collections import namedtuple + +def main(argv: Optional[Any] = ...): ... + +_Line = namedtuple('_Line', ['targets', 'image_build', 'name_override']) diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_tool.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_tool.pyi new file mode 100644 index 000000000..e4af0daca --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_build_tool.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.tools.deps.mulled.mulled_build_tool (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def main(argv: Optional[Any] = ...): ... +def requirements_to_mulled_targets(requirements): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/mulled_search.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_search.pyi new file mode 100644 index 000000000..9c8e9c23e --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/mulled_search.pyi @@ -0,0 +1,23 @@ +# Stubs for galaxy.tools.deps.mulled.mulled_search (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +requests = ... # type: Any +Schema = ... # type: Any +TEXT = ... # type: Any +STORED = ... # type: Any +create_in = ... # type: Any +QueryParser = ... # type: Any +QUAY_API_URL = ... # type: str + +class QuaySearch: + index = ... # type: Any + organization = ... # type: Any + def __init__(self, organization) -> None: ... + def build_index(self): ... + def search_repository(self, search_string, non_strict): ... + def get_additional_repository_information(self, repository_string): ... + +def main(argv: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/mulled/util.pyi b/typeshed/2.7/galaxy/tools/deps/mulled/util.pyi new file mode 100644 index 000000000..33063c28d --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/mulled/util.pyi @@ -0,0 +1,23 @@ +# Stubs for galaxy.tools.deps.mulled.util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from collections import namedtuple + +def quay_versions(namespace, pkg_name): ... +def mulled_tags_for(namespace, image, tag_prefix: Optional[Any] = ...): ... +def split_tag(tag): ... +def version_sorted(elements): ... + +Target = namedtuple('Target', ['package_name', 'version', 'build']) + +def build_target(package_name, version: Optional[Any] = ..., build: Optional[Any] = ..., tag: Optional[Any] = ...): ... +def conda_build_target_str(target): ... +def v1_image_name(targets, image_build: Optional[Any] = ..., name_override: Optional[Any] = ...): ... +def v2_image_name(targets, image_build: Optional[Any] = ..., name_override: Optional[Any] = ...): ... + +image_name = ... # type: Any + +# Names in __all__ with no definition: +# Target diff --git a/typeshed/2.7/galaxy/tools/deps/requirements.pyi b/typeshed/2.7/galaxy/tools/deps/requirements.pyi new file mode 100644 index 000000000..9cb78c3ae --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/requirements.pyi @@ -0,0 +1,75 @@ +# Stubs for galaxy.tools.deps.requirements (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Dict, List, Optional + +DEFAULT_REQUIREMENT_TYPE = ... # type: str +DEFAULT_REQUIREMENT_VERSION = ... # type: Any + +class ToolRequirement: + name = ... # type: Any + type = ... # type: Any + version = ... # type: Any + specs = ... # type: Any + def __init__(self, name: Optional[Any] = ..., type: Optional[Any] = ..., version: Optional[Any] = ..., specs: Any = ...) -> None: ... + def to_dict(self) -> Dict[str, Any]: ... + def copy(self): ... + @staticmethod + def from_dict(dict: Dict[str, Any]) -> ToolRequirement: ... + def __eq__(self, other): ... + def __ne__(self, other): ... + def __hash__(self): ... + +class RequirementSpecification: + uri = ... # type: Any + version = ... # type: Any + def __init__(self, uri, version: Optional[Any] = ...) -> None: ... + @property + def specifies_version(self): ... + @property + def short_name(self): ... + def to_dict(self): ... + @staticmethod + def from_dict(dict: Dict[str, Any]) -> ToolRequirements: ... + def __eq__(self, other): ... + def __ne__(self, other): ... + def __hash__(self): ... + +class ToolRequirements: + tool_requirements = ... # type: Any + def __init__(self, tool_requirements: Optional[Any] = ...) -> None: ... + @staticmethod + def from_list(requirements: List[ToolRequirement]) -> ToolRequirements: ... + @property + def resolvable(self): ... + @property + def packages(self): ... + def to_list(self) -> List[ToolRequirement]: ... + def append(self, requirement): ... + def __eq__(self, other): ... + def __ne__(self, other): ... + def __iter__(self): ... + def __getitem__(self, ii): ... + def __len__(self): ... + def __hash__(self): ... + +class ToolRequirementsException(Exception): ... + +DEFAULT_CONTAINER_TYPE = ... # type: str +DEFAULT_CONTAINER_RESOLVE_DEPENDENCIES = ... # type: bool +DEFAULT_CONTAINER_SHELL = ... # type: str + +class ContainerDescription: + identifier = ... # type: Any + type = ... # type: Any + resolve_dependencies = ... # type: Any + shell = ... # type: Any + def __init__(self, identifier: Optional[Any] = ..., type: Any = ..., resolve_dependencies: Any = ..., shell: Any = ...) -> None: ... + def to_dict(self): ... + @staticmethod + def from_dict(dict): ... + +def parse_requirements_from_dict(root_dict): ... +def parse_requirements_from_xml(xml_root): ... +def container_from_element(container_elem): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/__init__.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/__init__.pyi new file mode 100644 index 000000000..a1ffb20a5 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/__init__.pyi @@ -0,0 +1,62 @@ +# Stubs for galaxy.tools.deps.resolvers (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from galaxy.util.dictifiable import Dictifiable +from ..requirements import ToolRequirement as ToolRequirement + +class DependencyResolver(Dictifiable): + dict_collection_visible_keys = ... # type: Any + disabled = ... # type: bool + resolves_simple_dependencies = ... # type: bool + can_uninstall_dependencies = ... # type: bool + config_options = ... # type: Any + def resolve(self, requirement, **kwds): ... + +class MultipleDependencyResolver: + def resolve_all(self, requirements, **kwds): ... + +class ListableDependencyResolver: + def list_dependencies(self): ... + +class MappableDependencyResolver: ... + +FROM_UNVERSIONED = ... # type: Any + +class RequirementMapping: + from_name = ... # type: Any + from_version = ... # type: Any + to_name = ... # type: Any + to_version = ... # type: Any + def __init__(self, from_name, from_version, to_name, to_version) -> None: ... + def matches_requirement(self, requirement): ... + def apply(self, requirement): ... + @staticmethod + def from_dict(raw_mapping): ... + +class SpecificationAwareDependencyResolver: ... +class SpecificationPatternDependencyResolver: ... + +class InstallableDependencyResolver: + def install_dependency(self, name, version, type, **kwds): ... + +class Dependency(Dictifiable): + dict_collection_visible_keys = ... # type: Any + cacheable = ... # type: bool + def shell_commands(self, requirement): ... + def exact(self): ... + @property + def resolver_msg(self): ... + +class NullDependency(Dependency): + dependency_type = ... # type: Any + exact = ... # type: bool + version = ... # type: Any + name = ... # type: Any + def __init__(self, version: Optional[Any] = ..., name: Optional[Any] = ...) -> None: ... + @property + def resolver_msg(self): ... + def shell_commands(self, requirement): ... + +class DependencyException(Exception): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/brewed_tool_shed_packages.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/brewed_tool_shed_packages.pyi new file mode 100644 index 000000000..d581de350 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/brewed_tool_shed_packages.pyi @@ -0,0 +1,33 @@ +# Stubs for galaxy.tools.deps.resolvers.brewed_tool_shed_packages (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from xml.etree import ElementTree as ET +from .resolver_mixins import UsesHomebrewMixin, UsesInstalledRepositoriesMixin, UsesToolDependencyDirMixin +from ..resolvers import DependencyResolver + +class HomebrewToolShedDependencyResolver(DependencyResolver, UsesHomebrewMixin, UsesToolDependencyDirMixin, UsesInstalledRepositoriesMixin): + resolver_type = ... # type: str + def __init__(self, dependency_manager, **kwds) -> None: ... + def resolve(self, requirement, **kwds): ... + +class RawDependencies: + root = ... # type: Any + dependencies = ... # type: Any + def __init__(self, dependencies_file) -> None: ... + def find(self, package_name, package_version): ... + +class RawDependency: + dependencies = ... # type: Any + package_el = ... # type: Any + repository_el = ... # type: Any + def __init__(self, dependencies, package_el, repository_el) -> None: ... + @property + def repository_owner(self): ... + @property + def repository_name(self): ... + @property + def package_name(self): ... + @property + def package_version(self): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/conda.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/conda.pyi new file mode 100644 index 000000000..333954de7 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/conda.pyi @@ -0,0 +1,72 @@ +# Stubs for galaxy.tools.deps.resolvers.conda (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..resolvers import Dependency, DependencyResolver, InstallableDependencyResolver, ListableDependencyResolver, MappableDependencyResolver, MultipleDependencyResolver, SpecificationPatternDependencyResolver + +DEFAULT_ENSURE_CHANNELS = ... # type: str + +class CondaDependencyResolver(DependencyResolver, MultipleDependencyResolver, ListableDependencyResolver, InstallableDependencyResolver, SpecificationPatternDependencyResolver, MappableDependencyResolver): + dict_collection_visible_keys = ... # type: Any + resolver_type = ... # type: str + config_options = ... # type: Any + can_uninstall_dependencies = ... # type: bool + versionless = ... # type: Any + dependency_manager = ... # type: Any + conda_prefix_parent = ... # type: Any + ensure_channels = ... # type: Any + auto_init = ... # type: Any + conda_context = ... # type: Any + disabled = ... # type: Any + auto_install = ... # type: Any + copy_dependencies = ... # type: Any + def __init__(self, dependency_manager, **kwds) -> None: ... + def clean(self, **kwds): ... + def uninstall(self, requirements): ... + def uninstall_environments(self, environments): ... + def install_all(self, conda_targets): ... + def resolve_all(self, requirements, **kwds): ... + def merged_environment_name(self, conda_targets): ... + def resolve(self, requirement, **kwds): ... + def unused_dependency_paths(self, toolbox_requirements_status): ... + def list_dependencies(self): ... + def install_dependency(self, name, version, type, **kwds): ... + @property + def prefix(self): ... + +class MergedCondaDependency(Dependency): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: str + activate = ... # type: Any + conda_context = ... # type: Any + environment_path = ... # type: Any + cache_path = ... # type: Any + def __init__(self, conda_context, environment_path, exact, name: Optional[Any] = ..., version: Optional[Any] = ..., preserve_python_environment: bool = ...) -> None: ... + @property + def exact(self): ... + @property + def name(self): ... + @property + def version(self): ... + def shell_commands(self, requirement): ... + +class CondaDependency(Dependency): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: str + cacheable = ... # type: bool + activate = ... # type: Any + conda_context = ... # type: Any + environment_path = ... # type: Any + cache_path = ... # type: Any + def __init__(self, conda_context, environment_path, exact, name: Optional[Any] = ..., version: Optional[Any] = ..., preserve_python_environment: bool = ...) -> None: ... + @property + def exact(self): ... + @property + def name(self): ... + @property + def version(self): ... + def build_cache(self, cache_path): ... + def set_cache_path(self, cache_path): ... + def build_environment(self): ... + def shell_commands(self, requirement): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/galaxy_packages.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/galaxy_packages.pyi new file mode 100644 index 000000000..cb4551ffe --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/galaxy_packages.pyi @@ -0,0 +1,35 @@ +# Stubs for galaxy.tools.deps.resolvers.galaxy_packages (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .resolver_mixins import UsesToolDependencyDirMixin +from ..resolvers import Dependency, DependencyResolver, ListableDependencyResolver, MappableDependencyResolver + +class GalaxyPackageDependency(Dependency): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: str + script = ... # type: Any + path = ... # type: Any + version = ... # type: Any + name = ... # type: Any + def __init__(self, script, path, version, name, exact: bool = ...) -> None: ... + @property + def exact(self): ... + def shell_commands(self, requirement): ... + +class ToolShedDependency(GalaxyPackageDependency): + dependency_type = ... # type: str + +class BaseGalaxyPackageDependencyResolver(DependencyResolver, UsesToolDependencyDirMixin): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: Any + versionless = ... # type: Any + def __init__(self, dependency_manager, **kwds) -> None: ... + def resolve(self, requirement, **kwds): ... + +class GalaxyPackageDependencyResolver(BaseGalaxyPackageDependencyResolver, ListableDependencyResolver, MappableDependencyResolver): + resolver_type = ... # type: str + def __init__(self, dependency_manager, **kwds) -> None: ... + def resolve(self, requirement, **kwds): ... + def list_dependencies(self): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/homebrew.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/homebrew.pyi new file mode 100644 index 000000000..789617317 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/homebrew.pyi @@ -0,0 +1,14 @@ +# Stubs for galaxy.tools.deps.resolvers.homebrew (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .resolver_mixins import UsesHomebrewMixin +from ..resolvers import DependencyResolver + +class HomebrewDependencyResolver(DependencyResolver, UsesHomebrewMixin): + resolver_type = ... # type: str + versionless = ... # type: Any + prefer_version = ... # type: Any + def __init__(self, dependency_manager, **kwds) -> None: ... + def resolve(self, requirement, **kwds): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/modules.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/modules.pyi new file mode 100644 index 000000000..5762d957d --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/modules.pyi @@ -0,0 +1,42 @@ +# Stubs for galaxy.tools.deps.resolvers.modules (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from ..resolvers import Dependency, DependencyResolver, MappableDependencyResolver + +class ModuleDependencyResolver(DependencyResolver, MappableDependencyResolver): + dict_collection_visible_keys = ... # type: Any + resolver_type = ... # type: str + versionless = ... # type: Any + modulecmd = ... # type: Any + modulepath = ... # type: Any + default_indicator = ... # type: Any + module_checker = ... # type: Any + def __init__(self, dependency_manager, **kwds) -> None: ... + def resolve(self, requirement, **kwds): ... + +class DirectoryModuleChecker: + module_dependency_resolver = ... # type: Any + directories = ... # type: Any + def __init__(self, module_dependency_resolver, modulepath, prefetch) -> None: ... + def has_module(self, module, version): ... + +class AvailModuleChecker: + module_dependency_resolver = ... # type: Any + modulepath = ... # type: Any + default_indicator = ... # type: Any + prefetched_modules = ... # type: Any + def __init__(self, module_dependency_resolver, modulepath, prefetch, default_indicator: Any = ...) -> None: ... + def has_module(self, module, version): ... + +class ModuleDependency(Dependency): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: str + module_dependency_resolver = ... # type: Any + module_name = ... # type: Any + module_version = ... # type: Any + def __init__(self, module_dependency_resolver, module_name, module_version: Optional[Any] = ..., exact: bool = ...) -> None: ... + @property + def exact(self): ... + def shell_commands(self, requirement): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/resolver_mixins.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/resolver_mixins.pyi new file mode 100644 index 000000000..2b90a98d5 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/resolver_mixins.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.tools.deps.resolvers.resolver_mixins (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from ..brew_exts import build_env_statements as build_env_statements, DEFAULT_HOMEBREW_ROOT as DEFAULT_HOMEBREW_ROOT, recipe_cellar_path as recipe_cellar_path +from ..resolvers import Dependency as Dependency, NullDependency as NullDependency + +class UsesHomebrewMixin: ... +class UsesToolDependencyDirMixin: ... +class UsesInstalledRepositoriesMixin: ... + +class HomebrewDependency(Dependency): + commands = ... # type: Any + def __init__(self, commands, exact: bool = ...) -> None: ... + @property + def exact(self): ... + def shell_commands(self, requirement): ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/tool_shed_packages.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/tool_shed_packages.pyi new file mode 100644 index 000000000..224d377c2 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/tool_shed_packages.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy.tools.deps.resolvers.tool_shed_packages (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .galaxy_packages import BaseGalaxyPackageDependencyResolver +from .resolver_mixins import UsesInstalledRepositoriesMixin + +class ToolShedPackageDependencyResolver(BaseGalaxyPackageDependencyResolver, UsesInstalledRepositoriesMixin): + resolver_type = ... # type: str + dependency_type = ... # type: Any + resolves_simple_dependencies = ... # type: bool + def __init__(self, dependency_manager, **kwds) -> None: ... diff --git a/typeshed/2.7/galaxy/tools/deps/resolvers/unlinked_tool_shed_packages.pyi b/typeshed/2.7/galaxy/tools/deps/resolvers/unlinked_tool_shed_packages.pyi new file mode 100644 index 000000000..ddf2ee041 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/resolvers/unlinked_tool_shed_packages.pyi @@ -0,0 +1,25 @@ +# Stubs for galaxy.tools.deps.resolvers.unlinked_tool_shed_packages (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .galaxy_packages import BaseGalaxyPackageDependencyResolver +from ..resolvers import Dependency + +class UnlinkedToolShedPackageDependencyResolver(BaseGalaxyPackageDependencyResolver): + dict_collection_visible_keys = ... # type: Any + resolver_type = ... # type: str + preferred_owners = ... # type: Any + select_by_owner = ... # type: Any + def __init__(self, dependency_manager, **kwds) -> None: ... + +class CandidateDependency(Dependency): + dict_collection_visible_keys = ... # type: Any + dependency_type = ... # type: str + @property + def exact(self): ... + dependency = ... # type: Any + path = ... # type: Any + owner = ... # type: Any + def __init__(self, dependency, path, owner: Any = ...) -> None: ... + def shell_commands(self, requirement): ... diff --git a/typeshed/2.7/galaxy/tools/deps/singularity_util.pyi b/typeshed/2.7/galaxy/tools/deps/singularity_util.pyi new file mode 100644 index 000000000..a701d1fd8 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/singularity_util.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.deps.singularity_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +def build_singularity_run_command(container_command, image, volumes: Any = ..., env: Any = ..., working_directory: Any = ..., singularity_cmd: Any = ..., run_extra_arguments: Any = ..., sudo: Any = ..., sudo_cmd: Any = ...): ... diff --git a/typeshed/2.7/galaxy/tools/deps/views.pyi b/typeshed/2.7/galaxy/tools/deps/views.pyi new file mode 100644 index 000000000..2f5799018 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/deps/views.pyi @@ -0,0 +1,32 @@ +# Stubs for galaxy.tools.deps.views (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +class DependencyResolversView: + def __init__(self, app) -> None: ... + def index(self): ... + def show(self, index): ... + def reload(self): ... + def manager_requirements(self): ... + def resolver_requirements(self, index): ... + def manager_dependency(self, **kwds): ... + def resolver_dependency(self, index, **kwds): ... + def show_dependencies(self, tool_requirements_d, installed_tool_dependencies: Optional[Any] = ...): ... + def uninstall_dependencies(self, index: Optional[Any] = ..., **payload): ... + @property + def unused_dependency_paths(self): ... + def remove_unused_dependency_paths(self, envs): ... + def install_dependencies(self, requirements): ... + def install_dependency(self, index: Optional[Any] = ..., **payload): ... + @property + def installable_resolvers(self): ... + @property + def uninstallable_resolvers(self): ... + @property + def tool_ids_by_requirements(self): ... + @property + def toolbox_requirements_status(self): ... + def get_requirements_status(self, tool_requirements_d, installed_tool_dependencies: Optional[Any] = ...): ... + def clean(self, index: Optional[Any] = ..., **kwds): ... diff --git a/typeshed/2.7/galaxy/tools/fetcher.pyi b/typeshed/2.7/galaxy/tools/fetcher.pyi new file mode 100644 index 000000000..221bc58a8 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/fetcher.pyi @@ -0,0 +1,10 @@ +# Stubs for galaxy.tools.fetcher (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class ToolLocationFetcher: + resolver_classes = ... # type: Any + def __init__(self) -> None: ... + def to_tool_path(self, path_or_uri_like, **kwds): ... diff --git a/typeshed/2.7/galaxy/tools/lint.pyi b/typeshed/2.7/galaxy/tools/lint.pyi new file mode 100644 index 000000000..9cd7a2631 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/lint.pyi @@ -0,0 +1,33 @@ +# Stubs for galaxy.tools.lint (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .parser import get_tool_source as get_tool_source + +LEVEL_ALL = ... # type: str +LEVEL_WARN = ... # type: str +LEVEL_ERROR = ... # type: str + +def lint_tool_source(tool_source, level: Any = ..., fail_level: Any = ..., extra_modules: Any = ..., skip_types: Any = ...): ... +def lint_xml(tool_xml, level: Any = ..., fail_level: Any = ..., extra_modules: Any = ..., skip_types: Any = ...): ... +def lint_tool_source_with(lint_context, tool_source, extra_modules: Any = ...): ... +def lint_xml_with(lint_context, tool_xml, extra_modules: Any = ...): ... + +class LintContext: + skip_types = ... # type: Any + level = ... # type: Any + found_errors = ... # type: bool + found_warns = ... # type: bool + def __init__(self, level, skip_types: Any = ...) -> None: ... + printed_linter_info = ... # type: bool + valid_messages = ... # type: Any + info_messages = ... # type: Any + warn_messages = ... # type: Any + error_messages = ... # type: Any + def lint(self, name, lint_func, lint_target): ... + def valid(self, message, *args): ... + def info(self, message, *args): ... + def error(self, message, *args): ... + def warn(self, message, *args): ... + def failed(self, fail_level): ... diff --git a/typeshed/2.7/galaxy/tools/lint_util.pyi b/typeshed/2.7/galaxy/tools/lint_util.pyi new file mode 100644 index 000000000..e1e1ac02b --- /dev/null +++ b/typeshed/2.7/galaxy/tools/lint_util.pyi @@ -0,0 +1,5 @@ +# Stubs for galaxy.tools.lint_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def is_datasource(tool_xml): ... diff --git a/typeshed/2.7/galaxy/tools/linters/__init__.pyi b/typeshed/2.7/galaxy/tools/linters/__init__.pyi new file mode 100644 index 000000000..7f56312cb --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/__init__.pyi @@ -0,0 +1,4 @@ +# Stubs for galaxy.tools.linters (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + diff --git a/typeshed/2.7/galaxy/tools/linters/citations.pyi b/typeshed/2.7/galaxy/tools/linters/citations.pyi new file mode 100644 index 000000000..5378b8ded --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/citations.pyi @@ -0,0 +1,5 @@ +# Stubs for galaxy.tools.linters.citations (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def lint_citations(tool_xml, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/command.pyi b/typeshed/2.7/galaxy/tools/linters/command.pyi new file mode 100644 index 000000000..2e6863537 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/command.pyi @@ -0,0 +1,6 @@ +# Stubs for galaxy.tools.linters.command (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def lint_command(tool_xml, lint_ctx): ... +def get_command(tool_xml): ... diff --git a/typeshed/2.7/galaxy/tools/linters/cwl.pyi b/typeshed/2.7/galaxy/tools/linters/cwl.pyi new file mode 100644 index 000000000..a94292e46 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/cwl.pyi @@ -0,0 +1,12 @@ +# Stubs for galaxy.tools.linters.cwl (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +lint_tool_types = ... # type: Any + +def lint_cwl_validation(tool_source, lint_ctx): ... +def lint_new_draft(tool_source, lint_ctx): ... +def lint_docker_image(tool_source, lint_ctx): ... +def lint_description(tool_source, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/general.pyi b/typeshed/2.7/galaxy/tools/linters/general.pyi new file mode 100644 index 000000000..812e6e9f7 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/general.pyi @@ -0,0 +1,19 @@ +# Stubs for galaxy.tools.linters.general (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +ERROR_VERSION_MSG = ... # type: str +VALID_VERSION_MSG = ... # type: str +ERROR_NAME_MSG = ... # type: str +VALID_NAME_MSG = ... # type: str +ERROR_ID_MSG = ... # type: str +VALID_ID_MSG = ... # type: str +PROFILE_PATTERN = ... # type: Any +PROFILE_INFO_DEFAULT_MSG = ... # type: str +PROFILE_INFO_SPECIFIED_MSG = ... # type: str +PROFILE_INVALID_MSG = ... # type: str +lint_tool_types = ... # type: Any + +def lint_general(tool_source, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/help.pyi b/typeshed/2.7/galaxy/tools/linters/help.pyi new file mode 100644 index 000000000..306fa3bda --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/help.pyi @@ -0,0 +1,6 @@ +# Stubs for galaxy.tools.linters.help (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def lint_help(tool_xml, lint_ctx): ... +def rst_invalid(text): ... diff --git a/typeshed/2.7/galaxy/tools/linters/inputs.pyi b/typeshed/2.7/galaxy/tools/linters/inputs.pyi new file mode 100644 index 000000000..c06f46c9e --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/inputs.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.tools.linters.inputs (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from ..lint_util import is_datasource as is_datasource + +def lint_inputs(tool_xml, lint_ctx): ... +def lint_repeats(tool_xml, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/outputs.pyi b/typeshed/2.7/galaxy/tools/linters/outputs.pyi new file mode 100644 index 000000000..ecb922098 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/outputs.pyi @@ -0,0 +1,5 @@ +# Stubs for galaxy.tools.linters.outputs (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def lint_output(tool_xml, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/stdio.pyi b/typeshed/2.7/galaxy/tools/linters/stdio.pyi new file mode 100644 index 000000000..d7c2927c9 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/stdio.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.linters.stdio (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from .command import get_command as get_command + +def lint_stdio(tool_source, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/tests.pyi b/typeshed/2.7/galaxy/tools/linters/tests.pyi new file mode 100644 index 000000000..d9c7cf0f9 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/tests.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.linters.tests (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from ..lint_util import is_datasource as is_datasource + +def lint_tsts(tool_xml, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/linters/xml_order.pyi b/typeshed/2.7/galaxy/tools/linters/xml_order.pyi new file mode 100644 index 000000000..a3904f6c2 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/linters/xml_order.pyi @@ -0,0 +1,10 @@ +# Stubs for galaxy.tools.linters.xml_order (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +TAG_ORDER = ... # type: Any +DATASOURCE_TAG_ORDER = ... # type: Any + +def lint_xml_order(tool_xml, lint_ctx): ... diff --git a/typeshed/2.7/galaxy/tools/loader.pyi b/typeshed/2.7/galaxy/tools/loader.pyi new file mode 100644 index 000000000..4e7cd7fdd --- /dev/null +++ b/typeshed/2.7/galaxy/tools/loader.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.tools.loader (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from galaxy.util.xml_macros import imported_macro_paths as imported_macro_paths, raw_tool_xml_tree as raw_tool_xml_tree, template_macro_params as template_macro_params + +load_tool = ... # type: Any diff --git a/typeshed/2.7/galaxy/tools/loader_directory.pyi b/typeshed/2.7/galaxy/tools/loader_directory.pyi new file mode 100644 index 000000000..628289f72 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/loader_directory.pyi @@ -0,0 +1,15 @@ +# Stubs for galaxy.tools.loader_directory (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def find_possible_tools_from_path(path, recursive: bool = ..., enable_beta_formats: bool = ...): ... +def load_tool_sources_from_path(path, load_exception_handler: Any = ..., recursive: bool = ..., register_load_errors: bool = ...): ... +def load_tool_elements_from_path(path, load_exception_handler: Any = ..., recursive: bool = ..., register_load_errors: bool = ...): ... +def is_tool_load_error(obj): ... +def looks_like_a_tool_xml(path): ... +def is_a_yaml_with_class(path, classes): ... +def looks_like_a_tool_yaml(path): ... +def looks_like_a_cwl_artifact(path, classes: Optional[Any] = ...): ... +def looks_like_a_tool_cwl(path): ... diff --git a/typeshed/2.7/galaxy/tools/locations/__init__.pyi b/typeshed/2.7/galaxy/tools/locations/__init__.pyi new file mode 100644 index 000000000..af99abd8b --- /dev/null +++ b/typeshed/2.7/galaxy/tools/locations/__init__.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.locations (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +class ToolLocationResolver: + def scheme(self): ... + def get_tool_source_path(self, uri_like): ... diff --git a/typeshed/2.7/galaxy/tools/locations/dockstore.pyi b/typeshed/2.7/galaxy/tools/locations/dockstore.pyi new file mode 100644 index 000000000..3420e1eba --- /dev/null +++ b/typeshed/2.7/galaxy/tools/locations/dockstore.pyi @@ -0,0 +1,19 @@ +# Stubs for galaxy.tools.locations.dockstore (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from ..locations import ToolLocationResolver + +class DockStoreResolver(ToolLocationResolver): + scheme = ... # type: str + def get_tool_source_path(self, uri_like): ... + +class _Ga4ghToolClient: + base_url = ... # type: Any + def __init__(self, base_url: str = ...) -> None: ... + def get_tools(self): ... + def get_tool(self, tool_id): ... + def get_tool_version(self, tool_id, version: str = ...): ... + def get_tool_descriptor(self, tool_id, version: str = ..., tool_type: str = ...): ... + def get_tool_cwl(self, tool_id, version: str = ..., as_string: bool = ...): ... diff --git a/typeshed/2.7/galaxy/tools/locations/file.pyi b/typeshed/2.7/galaxy/tools/locations/file.pyi new file mode 100644 index 000000000..8268d650f --- /dev/null +++ b/typeshed/2.7/galaxy/tools/locations/file.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.tools.locations.file (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from ..locations import ToolLocationResolver as ToolLocationResolver + +class HttpToolResolver(ToolLocationResolver): + scheme = ... # type: str + def get_tool_source_path(self, uri_like): ... diff --git a/typeshed/2.7/galaxy/tools/locations/http.pyi b/typeshed/2.7/galaxy/tools/locations/http.pyi new file mode 100644 index 000000000..2687afcef --- /dev/null +++ b/typeshed/2.7/galaxy/tools/locations/http.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy.tools.locations.http (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from ..locations import ToolLocationResolver + +class HttpToolResolver(ToolLocationResolver): + scheme = ... # type: str + def __init__(self, **kwds) -> None: ... + def get_tool_source_path(self, uri_like): ... + +class HttpsToolResolver(HttpToolResolver): + scheme = ... # type: str diff --git a/typeshed/2.7/galaxy/tools/parser/__init__.pyi b/typeshed/2.7/galaxy/tools/parser/__init__.pyi new file mode 100644 index 000000000..0b1bc8142 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/__init__.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.tools.parser (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from .factory import get_input_source as get_input_source, get_tool_source as get_tool_source +from .interface import ToolSource as ToolSource +from .output_objects import ToolOutputCollectionPart as ToolOutputCollectionPart diff --git a/typeshed/2.7/galaxy/tools/parser/cwl.pyi b/typeshed/2.7/galaxy/tools/parser/cwl.pyi new file mode 100644 index 000000000..1b754a91b --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/cwl.pyi @@ -0,0 +1,41 @@ +# Stubs for galaxy.tools.parser.cwl (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from .interface import PageSource as PageSource +from .interface import PagesSource as PagesSource +from .interface import ToolSource as ToolSource +from .interface import ToolStdioExitCode as ToolStdioExitCode +from .output_actions import ToolOutputActionGroup as ToolOutputActionGroup +from .output_objects import ToolOutput as ToolOutput +from .yaml import YamlInputSource as YamlInputSource + +log = ... # type: Any + +class CwlToolSource(ToolSource): + def __init__(self, tool_file, strict_cwl_validation: bool = ...) -> None: ... + @property + def tool_proxy(self): ... + def parse_tool_type(self): ... + def parse_id(self): ... + def parse_name(self): ... + def parse_command(self): ... + def parse_environment_variables(self): ... + def parse_edam_operations(self): ... + def parse_edam_topics(self): ... + def parse_help(self): ... + def parse_sanitize(self): ... + def parse_strict_shell(self): ... + def parse_stdio(self): ... + def parse_interpreter(self): ... + def parse_version(self): ... + def parse_description(self): ... + def parse_input_pages(self): ... + def parse_outputs(self, tool): ... + def parse_requirements_and_containers(self): ... + def parse_profile(self): ... + +class CwlPageSource(PageSource): + def __init__(self, tool_proxy) -> None: ... + def parse_input_sources(self): ... diff --git a/typeshed/2.7/galaxy/tools/parser/factory.pyi b/typeshed/2.7/galaxy/tools/parser/factory.pyi new file mode 100644 index 000000000..c6b63d099 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/factory.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.tools.parser.factory (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from galaxy.tools.loader import load_tool as load_tool_xml + +def get_tool_source(config_file: Optional[Any] = ..., xml_tree: Optional[Any] = ..., enable_beta_formats: bool = ..., tool_location_fetcher: Optional[Any] = ...): ... +def get_input_source(content): ... diff --git a/typeshed/2.7/galaxy/tools/parser/interface.pyi b/typeshed/2.7/galaxy/tools/parser/interface.pyi new file mode 100644 index 000000000..e219c74a3 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/interface.pyi @@ -0,0 +1,96 @@ +# Stubs for galaxy.tools.parser.interface (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +NOT_IMPLEMENTED_MESSAGE = ... # type: str + +class ToolSource: + default_is_multi_byte = ... # type: bool + def parse_id(self): ... + def parse_version(self): ... + def parse_tool_module(self): ... + def parse_action_module(self): ... + def parse_tool_type(self): ... + def parse_name(self): ... + def parse_description(self): ... + def parse_is_multi_byte(self): ... + def parse_display_interface(self, default): ... + def parse_require_login(self, default): ... + def parse_request_param_translation_elem(self): ... + def parse_command(self): ... + def parse_environment_variables(self): ... + def parse_interpreter(self): ... + def parse_redirect_url_params_elem(self): ... + def parse_version_command(self): ... + def parse_version_command_interpreter(self): ... + def parse_parallelism(self): ... + def parse_hidden(self): ... + def parse_sanitize(self): ... + def parse_refresh(self): ... + def parse_requirements_and_containers(self): ... + def parse_input_pages(self): ... + def parse_outputs(self, tool): ... + def parse_strict_shell(self): ... + def parse_stdio(self): ... + def parse_help(self): ... + def parse_profile(self): ... + def parse_tests_to_dict(self): ... + +class PagesSource: + page_sources = ... # type: Any + def __init__(self, page_sources) -> None: ... + @property + def inputs_defined(self): ... + +class PageSource: + def parse_display(self): ... + def parse_input_sources(self): ... + +class InputSource: + default_optional = ... # type: bool + def elem(self): ... + def get(self, key, value: Optional[Any] = ...): ... + def get_bool(self, key, default): ... + def parse_label(self): ... + def parse_help(self): ... + def parse_sanitizer_elem(self): ... + def parse_validator_elems(self): ... + def parse_optional(self, default: Optional[Any] = ...): ... + def parse_dynamic_options_elem(self): ... + def parse_static_options(self): ... + def parse_conversion_tuples(self): ... + def parse_nested_inputs_source(self): ... + def parse_test_input_source(self): ... + def parse_when_input_sources(self): ... + +class ToolStdioRegex: + match = ... # type: str + stdout_match = ... # type: bool + stderr_match = ... # type: bool + error_level = ... # type: str + desc = ... # type: str + def __init__(self) -> None: ... + +class ToolStdioExitCode: + range_start = ... # type: Any + range_end = ... # type: Any + error_level = ... # type: str + desc = ... # type: str + def __init__(self) -> None: ... + +class TestCollectionDef: + elements = ... # type: Any + collection_type = ... # type: Any + name = ... # type: Any + def __init__(self, elem, parse_param_elem) -> None: ... + def collect_inputs(self): ... + +class TestCollectionOutputDef: + name = ... # type: Any + collection_type = ... # type: Any + count = ... # type: Any + attrib = ... # type: Any + element_tests = ... # type: Any + def __init__(self, name, attrib, element_tests) -> None: ... diff --git a/typeshed/2.7/galaxy/tools/parser/output_actions.pyi b/typeshed/2.7/galaxy/tools/parser/output_actions.pyi new file mode 100644 index 000000000..5945acdcd --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/output_actions.pyi @@ -0,0 +1,215 @@ +# Stubs for galaxy.tools.parser.output_actions (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +log = ... # type: Any +COLLECTION_ATTRIBUTES = ... # type: Any + +class ToolOutputActionGroup: + tag = ... # type: str + parent = ... # type: Any + actions = ... # type: Any + def __init__(self, parent, config_elem) -> None: ... + def apply_action(self, output_dataset, other_values): ... + @property + def tool(self): ... + def __len__(self): ... + +class ToolOutputActionConditionalWhen(ToolOutputActionGroup): + tag = ... # type: str + @classmethod + def from_elem(cls, parent, when_elem): ... + value = ... # type: Any + def __init__(self, parent, config_elem, value) -> None: ... + def is_case(self, output_dataset, other_values): ... + def get_ref(self, output_dataset, other_values): ... + def apply_action(self, output_dataset, other_values): ... + +class ValueToolOutputActionConditionalWhen(ToolOutputActionConditionalWhen): + tag = ... # type: str + def is_case(self, output_dataset, other_values): ... + +class DatatypeIsInstanceToolOutputActionConditionalWhen(ToolOutputActionConditionalWhen): + tag = ... # type: str + value = ... # type: Any + def __init__(self, parent, config_elem, value) -> None: ... + def is_case(self, output_dataset, other_values): ... + +class ToolOutputActionConditional: + tag = ... # type: str + parent = ... # type: Any + name = ... # type: Any + cases = ... # type: Any + def __init__(self, parent, config_elem) -> None: ... + def apply_action(self, output_dataset, other_values): ... + @property + def tool(self): ... + +class ToolOutputAction: + tag = ... # type: str + @classmethod + def from_elem(cls, parent, elem): ... + parent = ... # type: Any + default = ... # type: Any + option = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def apply_action(self, output_dataset, other_values): ... + @property + def tool(self): ... + +class ToolOutputActionOption: + tag = ... # type: str + @classmethod + def from_elem(cls, parent, elem): ... + parent = ... # type: Any + filters = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def get_value(self, other_values): ... + @property + def tool(self): ... + +class NullToolOutputActionOption(ToolOutputActionOption): + tag = ... # type: str + def get_value(self, other_values): ... + +class FromFileToolOutputActionOption(ToolOutputActionOption): + tag = ... # type: str + name = ... # type: Any + column = ... # type: Any + offset = ... # type: Any + separator = ... # type: Any + options = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def get_value(self, other_values): ... + +class FromParamToolOutputActionOption(ToolOutputActionOption): + tag = ... # type: str + name = ... # type: Any + column = ... # type: Any + offset = ... # type: Any + param_attribute = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def get_value(self, other_values): ... + +class FromDataTableOutputActionOption(ToolOutputActionOption): + tag = ... # type: str + name = ... # type: Any + missing_tool_data_table_name = ... # type: Any + options = ... # type: Any + column = ... # type: Any + offset = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def get_value(self, other_values): ... + +class MetadataToolOutputAction(ToolOutputAction): + tag = ... # type: str + name = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def apply_action(self, output_dataset, other_values): ... + +class FormatToolOutputAction(ToolOutputAction): + tag = ... # type: str + default = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def apply_action(self, output_dataset, other_values): ... + +class ToolOutputActionOptionFilter: + tag = ... # type: str + @classmethod + def from_elem(cls, parent, elem): ... + parent = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + @property + def tool(self): ... + +class ParamValueToolOutputActionOptionFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + ref = ... # type: Any + value = ... # type: Any + column = ... # type: Any + keep = ... # type: Any + compare = ... # type: Any + cast = ... # type: Any + param_attribute = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class InsertColumnToolOutputActionOptionFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + ref = ... # type: Any + value = ... # type: Any + column = ... # type: Any + iterate = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class MultipleSplitterFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + column = ... # type: Any + separator = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class ColumnStripFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + column = ... # type: Any + strip = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class ColumnReplaceFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + old_column = ... # type: Any + old_value = ... # type: Any + new_value = ... # type: Any + new_column = ... # type: Any + column = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class MetadataValueFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + ref = ... # type: Any + name = ... # type: Any + column = ... # type: Any + keep = ... # type: Any + compare = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class BooleanFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + column = ... # type: Any + keep = ... # type: Any + cast = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +class StringFunctionFilter(ToolOutputActionOptionFilter): + tag = ... # type: str + column = ... # type: Any + function = ... # type: Any + def __init__(self, parent, elem) -> None: ... + def filter_options(self, options, other_values): ... + +action_types = ... # type: Any +option_types = ... # type: Any +filter_types = ... # type: Any + +def parse_cast_attribute(cast): ... +def parse_compare_type(compare): ... +def compare_eq(value1, value2): ... +def compare_neq(value1, value2): ... +def compare_gt(value1, value2): ... +def compare_gte(value1, value2): ... +def compare_lt(value1, value2): ... +def compare_lte(value1, value2): ... +def compare_in(value1, value2): ... +def compare_startswith(value1, value2): ... +def compare_endswith(value1, value2): ... +def compare_re_search(value1, value2): ... + +compare_types = ... # type: Any diff --git a/typeshed/2.7/galaxy/tools/parser/output_collection_def.pyi b/typeshed/2.7/galaxy/tools/parser/output_collection_def.pyi new file mode 100644 index 000000000..2cc4b1bd7 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/output_collection_def.pyi @@ -0,0 +1,29 @@ +# Stubs for galaxy.tools.parser.output_collection_def (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +DEFAULT_EXTRA_FILENAME_PATTERN = ... # type: str +DEFAULT_SORT_BY = ... # type: str +DEFAULT_SORT_COMP = ... # type: str +NAMED_PATTERNS = ... # type: Any +INPUT_DBKEY_TOKEN = ... # type: str +LEGACY_DEFAULT_DBKEY = ... # type: Any + +def dataset_collector_descriptions_from_elem(elem, legacy: bool = ...): ... +def dataset_collector_descriptions_from_list(discover_datasets_dicts): ... + +class DatasetCollectionDescription: + pattern = ... # type: Any + default_dbkey = ... # type: Any + default_ext = ... # type: Any + default_visible = ... # type: Any + directory = ... # type: Any + assign_primary_output = ... # type: Any + sort_reverse = ... # type: bool + sort_key = ... # type: Any + sort_comp = ... # type: Any + def __init__(self, **kwargs) -> None: ... + +DEFAULT_DATASET_COLLECTOR_DESCRIPTION = ... # type: Any diff --git a/typeshed/2.7/galaxy/tools/parser/output_objects.pyi b/typeshed/2.7/galaxy/tools/parser/output_objects.pyi new file mode 100644 index 000000000..68f824eaf --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/output_objects.pyi @@ -0,0 +1,68 @@ +# Stubs for galaxy.tools.parser.output_objects (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from galaxy.util.dictifiable import Dictifiable + +class ToolOutputBase(Dictifiable): + name = ... # type: Any + label = ... # type: Any + filters = ... # type: Any + hidden = ... # type: Any + collection = ... # type: bool + def __init__(self, name, label: Optional[Any] = ..., filters: Optional[Any] = ..., hidden: bool = ...) -> None: ... + +class ToolOutput(ToolOutputBase): + dict_collection_visible_keys = ... # type: Any + format = ... # type: Any + format_source = ... # type: Any + metadata_source = ... # type: Any + parent = ... # type: Any + actions = ... # type: Any + change_format = ... # type: Any + implicit = ... # type: Any + from_work_dir = ... # type: Any + def __init__(self, name, format: Optional[Any] = ..., format_source: Optional[Any] = ..., metadata_source: Optional[Any] = ..., parent: Optional[Any] = ..., label: Optional[Any] = ..., filters: Optional[Any] = ..., actions: Optional[Any] = ..., hidden: bool = ..., implicit: bool = ...) -> None: ... + def __len__(self): ... + def __getitem__(self, index): ... + def __iter__(self): ... + def to_dict(self, view: str = ..., value_mapper: Optional[Any] = ..., app: Optional[Any] = ...): ... + +class ToolOutputCollection(ToolOutputBase): + collection = ... # type: bool + default_format = ... # type: Any + structure = ... # type: Any + outputs = ... # type: Any + inherit_format = ... # type: Any + inherit_metadata = ... # type: Any + metadata_source = ... # type: Any + format_source = ... # type: Any + change_format = ... # type: Any + def __init__(self, name, structure, label: Optional[Any] = ..., filters: Optional[Any] = ..., hidden: bool = ..., default_format: str = ..., default_format_source: Optional[Any] = ..., default_metadata_source: Optional[Any] = ..., inherit_format: bool = ..., inherit_metadata: bool = ...) -> None: ... + def known_outputs(self, inputs, type_registry): ... + @property + def dynamic_structure(self): ... + @property + def dataset_collector_descriptions(self): ... + +class ToolOutputCollectionStructure: + collection_type = ... # type: Any + collection_type_source = ... # type: Any + structured_like = ... # type: Any + dataset_collector_descriptions = ... # type: Any + dynamic = ... # type: Any + def __init__(self, collection_type, collection_type_source, structured_like, dataset_collector_descriptions) -> None: ... + +class ToolOutputCollectionPart: + output_collection_def = ... # type: Any + element_identifier = ... # type: Any + output_def = ... # type: Any + parent_ids = ... # type: Any + def __init__(self, output_collection_def, element_identifier, output_def, parent_ids: Any = ...) -> None: ... + @property + def effective_output_name(self): ... + @staticmethod + def is_named_collection_part_name(name): ... + @staticmethod + def split_output_name(name): ... diff --git a/typeshed/2.7/galaxy/tools/parser/util.pyi b/typeshed/2.7/galaxy/tools/parser/util.pyi new file mode 100644 index 000000000..97b33962c --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/util.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.tools.parser.util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from .interface import ToolStdioExitCode as ToolStdioExitCode +from .interface import ToolStdioRegex as ToolStdioRegex + +def error_on_exit_code(): ... +def aggressive_error_checks(): ... diff --git a/typeshed/2.7/galaxy/tools/parser/xml.pyi b/typeshed/2.7/galaxy/tools/parser/xml.pyi new file mode 100644 index 000000000..ffdd7e92f --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/xml.pyi @@ -0,0 +1,89 @@ +# Stubs for galaxy.tools.parser.xml (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .interface import InputSource as InputSource, PageSource as PageSource, PagesSource as PagesSource, TestCollectionDef as TestCollectionDef, TestCollectionOutputDef as TestCollectionOutputDef, ToolSource as ToolSource, ToolStdioExitCode as ToolStdioExitCode, ToolStdioRegex as ToolStdioRegex +from .output_actions import ToolOutputActionGroup as ToolOutputActionGroup +from .output_collection_def import dataset_collector_descriptions_from_elem as dataset_collector_descriptions_from_elem +from .output_objects import ToolOutput as ToolOutput, ToolOutputCollection as ToolOutputCollection, ToolOutputCollectionStructure as ToolOutputCollectionStructure +from .util import aggressive_error_checks as aggressive_error_checks, error_on_exit_code as error_on_exit_code + +log = ... # type: Any + +class XmlToolSource(ToolSource): + xml_tree = ... # type: Any + root = ... # type: Any + legacy_defaults = ... # type: Any + def __init__(self, xml_tree, source_path: Optional[Any] = ...) -> None: ... + def parse_version(self): ... + def parse_id(self): ... + def parse_tool_module(self): ... + def parse_action_module(self): ... + def parse_tool_type(self): ... + def parse_name(self): ... + def parse_edam_operations(self): ... + def parse_edam_topics(self): ... + def parse_description(self): ... + def parse_is_multi_byte(self): ... + def parse_display_interface(self, default): ... + def parse_require_login(self, default): ... + def parse_request_param_translation_elem(self): ... + def parse_command(self): ... + def parse_environment_variables(self): ... + def parse_interpreter(self): ... + def parse_version_command(self): ... + def parse_version_command_interpreter(self): ... + def parse_parallelism(self): ... + def parse_hidden(self): ... + def parse_redirect_url_params_elem(self): ... + def parse_sanitize(self): ... + def parse_refresh(self): ... + def parse_requirements_and_containers(self): ... + def parse_input_pages(self): ... + def parse_outputs(self, tool): ... + def parse_stdio(self): ... + def parse_strict_shell(self): ... + def parse_help(self): ... + def parse_tests_to_dict(self): ... + def parse_profile(self): ... + +class StdioParser: + stdio_exit_codes = ... # type: Any + stdio_regexes = ... # type: Any + def __init__(self, root) -> None: ... + def parse_stdio_exit_codes(self, stdio_elem): ... + def parse_stdio_regexes(self, stdio_elem): ... + def parse_error_level(self, err_level): ... + +class XmlPagesSource(PagesSource): + input_elem = ... # type: Any + def __init__(self, root) -> None: ... + @property + def inputs_defined(self): ... + +class XmlPageSource(PageSource): + parent_elem = ... # type: Any + def __init__(self, parent_elem) -> None: ... + def parse_display(self): ... + def parse_input_sources(self): ... + +class XmlInputSource(InputSource): + input_elem = ... # type: Any + input_type = ... # type: Any + def __init__(self, input_elem) -> None: ... + def parse_input_type(self): ... + def elem(self): ... + def get(self, key, value: Optional[Any] = ...): ... + def get_bool(self, key, default): ... + def parse_label(self): ... + def parse_help(self): ... + def parse_sanitizer_elem(self): ... + def parse_validator_elems(self): ... + def parse_dynamic_options_elem(self): ... + def parse_static_options(self): ... + def parse_optional(self, default: Optional[Any] = ...): ... + def parse_conversion_tuples(self): ... + def parse_nested_inputs_source(self): ... + def parse_test_input_source(self): ... + def parse_when_input_sources(self): ... diff --git a/typeshed/2.7/galaxy/tools/parser/yaml.pyi b/typeshed/2.7/galaxy/tools/parser/yaml.pyi new file mode 100644 index 000000000..ccf2afdd7 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/parser/yaml.pyi @@ -0,0 +1,56 @@ +# Stubs for galaxy.tools.parser.yaml (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .interface import InputSource as InputSource +from .interface import PageSource as PageSource +from .interface import PagesSource as PagesSource +from .interface import ToolSource as ToolSource +from .output_actions import ToolOutputActionGroup as ToolOutputActionGroup +from .output_collection_def import dataset_collector_descriptions_from_list as dataset_collector_descriptions_from_list +from .output_objects import ToolOutput as ToolOutput, ToolOutputCollection as ToolOutputCollection, ToolOutputCollectionStructure as ToolOutputCollectionStructure +from .util import error_on_exit_code as error_on_exit_code + +class YamlToolSource(ToolSource): + root_dict = ... # type: Any + def __init__(self, root_dict, source_path: Optional[Any] = ...) -> None: ... + def parse_id(self): ... + def parse_version(self): ... + def parse_name(self): ... + def parse_description(self): ... + def parse_edam_operations(self): ... + def parse_edam_topics(self): ... + def parse_is_multi_byte(self): ... + def parse_sanitize(self): ... + def parse_display_interface(self, default): ... + def parse_require_login(self, default): ... + def parse_command(self): ... + def parse_environment_variables(self): ... + def parse_interpreter(self): ... + def parse_version_command(self): ... + def parse_version_command_interpreter(self): ... + def parse_requirements_and_containers(self): ... + def parse_input_pages(self): ... + def parse_strict_shell(self): ... + def parse_stdio(self): ... + def parse_help(self): ... + def parse_outputs(self, tool): ... + def parse_tests_to_dict(self): ... + def parse_profile(self): ... + +class YamlPageSource(PageSource): + inputs_list = ... # type: Any + def __init__(self, inputs_list) -> None: ... + def parse_input_sources(self): ... + +class YamlInputSource(InputSource): + input_dict = ... # type: Any + def __init__(self, input_dict) -> None: ... + def get(self, key, default: Optional[Any] = ...): ... + def get_bool(self, key, default): ... + def parse_input_type(self): ... + def parse_nested_inputs_source(self): ... + def parse_test_input_source(self): ... + def parse_when_input_sources(self): ... + def parse_static_options(self): ... diff --git a/typeshed/2.7/galaxy/tools/verify/__init__.pyi b/typeshed/2.7/galaxy/tools/verify/__init__.pyi new file mode 100644 index 000000000..624255387 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/__init__.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.tools.verify (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from .asserts import verify_assertions as verify_assertions +from .test_data import TestDataResolver as TestDataResolver + +log = ... # type: Any +DEFAULT_TEST_DATA_RESOLVER = ... # type: Any + +def verify(item_label, output_content, attributes, filename: Optional[Any] = ..., get_filename: Optional[Any] = ..., keep_outputs_dir: Optional[Any] = ..., verify_extra_files: Optional[Any] = ...): ... +def make_temp_fname(fname: Optional[Any] = ...): ... +def check_command(command, description): ... +def files_diff(file1, file2, attributes: Optional[Any] = ...): ... +def files_re_match(file1, file2, attributes: Optional[Any] = ...): ... +def files_re_match_multiline(file1, file2, attributes: Optional[Any] = ...): ... +def files_contains(file1, file2, attributes: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/tools/verify/asserts/__init__.pyi b/typeshed/2.7/galaxy/tools/verify/asserts/__init__.pyi new file mode 100644 index 000000000..3ba17d3da --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/asserts/__init__.pyi @@ -0,0 +1,14 @@ +# Stubs for galaxy.tools.verify.asserts (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +log = ... # type: Any +assertion_module_names = ... # type: Any +assertion_modules = ... # type: Any +full_assertion_module_name = ... # type: Any +assertion_module = ... # type: Any + +def verify_assertions(data, assertion_description_list): ... +def verify_assertion(data, assertion_description): ... diff --git a/typeshed/2.7/galaxy/tools/verify/asserts/tabular.pyi b/typeshed/2.7/galaxy/tools/verify/asserts/tabular.pyi new file mode 100644 index 000000000..4515eab5f --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/asserts/tabular.pyi @@ -0,0 +1,6 @@ +# Stubs for galaxy.tools.verify.asserts.tabular (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def get_first_line(output): ... +def assert_has_n_columns(output, n, sep: str = ...): ... diff --git a/typeshed/2.7/galaxy/tools/verify/asserts/text.pyi b/typeshed/2.7/galaxy/tools/verify/asserts/text.pyi new file mode 100644 index 000000000..549d53481 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/asserts/text.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.tools.verify.asserts.text (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def assert_has_text(output, text): ... +def assert_not_has_text(output, text): ... +def assert_has_line(output, line): ... +def assert_has_text_matching(output, expression): ... +def assert_has_line_matching(output, expression): ... diff --git a/typeshed/2.7/galaxy/tools/verify/asserts/xml.pyi b/typeshed/2.7/galaxy/tools/verify/asserts/xml.pyi new file mode 100644 index 000000000..57af9c728 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/asserts/xml.pyi @@ -0,0 +1,15 @@ +# Stubs for galaxy.tools.verify.asserts.xml (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def to_xml(output): ... +def xml_find_text(output, path): ... +def xml_find(output, path): ... +def assert_is_valid_xml(output): ... +def assert_has_element_with_path(output, path): ... +def assert_has_n_elements_with_path(output, path, n): ... +def assert_element_text_matches(output, path, expression): ... +def assert_element_text_is(output, path, text): ... +def assert_attribute_matches(output, path, attribute, expression): ... +def assert_attribute_is(output, path, attribute, text): ... +def assert_element_text(output, path, verify_assertions_function, children): ... diff --git a/typeshed/2.7/galaxy/tools/verify/test_data.pyi b/typeshed/2.7/galaxy/tools/verify/test_data.pyi new file mode 100644 index 000000000..1fe6f0d38 --- /dev/null +++ b/typeshed/2.7/galaxy/tools/verify/test_data.pyi @@ -0,0 +1,31 @@ +# Stubs for galaxy.tools.verify.test_data (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +UPDATE_TEMPLATE = ... # type: Any +UPDATE_FAILED_TEMPLATE = ... # type: Any +LIST_SEP = ... # type: Any + +class TestDataResolver: + resolvers = ... # type: Any + def __init__(self, env_var: str = ..., environ: Any = ...) -> None: ... + def get_filename(self, name): ... + +def build_resolver(uri, environ): ... + +class FileDataResolver: + file_dir = ... # type: Any + def __init__(self, file_dir) -> None: ... + def exists(self, filename): ... + def path(self, filename): ... + +class GitDataResolver(FileDataResolver): + repository = ... # type: Any + updated = ... # type: bool + fetch_data = ... # type: Any + def __init__(self, repository, environ) -> None: ... + def exists(self, filename): ... + def update_repository(self): ... + def execute(self, cmd): ... diff --git a/typeshed/2.7/galaxy/util/__init__.pyi b/typeshed/2.7/galaxy/util/__init__.pyi new file mode 100644 index 000000000..d2c9a1ee5 --- /dev/null +++ b/typeshed/2.7/galaxy/util/__init__.pyi @@ -0,0 +1,131 @@ +# Stubs for galaxy.util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +import collections +from six.moves.urllib import parse as urlparse, request as urlrequest +from .inflection import English as English, Inflector as Inflector + +grp = ... # type: Any +docutils_core = ... # type: Any +docutils_html4css1 = ... # type: Any +inflector = ... # type: Any +log = ... # type: Any +CHUNK_SIZE = ... # type: int +DATABASE_MAX_STRING_SIZE = ... # type: int +DATABASE_MAX_STRING_SIZE_PRETTY = ... # type: str +gzip_magic = ... # type: str +bz2_magic = ... # type: str +DEFAULT_ENCODING = ... # type: Any +NULL_CHAR = ... # type: str +BINARY_CHARS = ... # type: Any +FILENAME_VALID_CHARS = ... # type: str + +def remove_protocol_from_url(url): ... +def is_binary(value, binary_chars: Optional[Any] = ...): ... +def is_uuid(value): ... +def directory_hash_id(id): ... +def get_charset_from_http_headers(headers, default: Optional[Any] = ...): ... +def synchronized(func): ... +def file_iter(fname, sep: Optional[Any] = ...): ... +def file_reader(fp, chunk_size: Any = ...): ... +def unique_id(KEY_SIZE: int = ...): ... +def parse_xml(fname): ... +def parse_xml_string(xml_string): ... +def xml_to_string(elem, pretty: bool = ...): ... +def xml_element_compare(elem1, elem2): ... +def xml_element_list_compare(elem_list1, elem_list2): ... +def xml_element_to_dict(elem): ... +def pretty_print_xml(elem, level: int = ...): ... +def get_file_size(value, default: Optional[Any] = ...): ... +def shrink_stream_by_size(value, size, join_by: str = ..., left_larger: bool = ..., beginning_on_size_error: bool = ..., end_on_size_error: bool = ...): ... +def shrink_string_by_size(value, size, join_by: str = ..., left_larger: bool = ..., beginning_on_size_error: bool = ..., end_on_size_error: bool = ...): ... +def pretty_print_time_interval(time: bool = ..., precise: bool = ...): ... +def pretty_print_json(json_data, is_json_string: bool = ...): ... + +valid_chars = ... # type: Any +mapped_chars = ... # type: Any + +def restore_text(text, character_map: Any = ...): ... +def sanitize_text(text, valid_characters: Any = ..., character_map: Any = ..., invalid_character: str = ...): ... +def sanitize_lists_to_string(values, valid_characters: Any = ..., character_map: Any = ..., invalid_character: str = ...): ... +def sanitize_param(value, valid_characters: Any = ..., character_map: Any = ..., invalid_character: str = ...): ... + +valid_filename_chars = ... # type: Any +invalid_filenames = ... # type: Any + +def sanitize_for_filename(text, default: Optional[Any] = ...): ... +def mask_password_from_url(url): ... +def ready_name_for_url(raw_name): ... +def which(file): ... +def safe_makedirs(path): ... +def in_directory(file, directory, local_path_module: Any = ...): ... +def merge_sorted_iterables(operator, *iterables): ... + +class Params: + NEVER_SANITIZE = ... # type: Any + def __init__(self, params, sanitize: bool = ...) -> None: ... + def flatten(self): ... + def __getattr__(self, name): ... + def get(self, key, default): ... + def __len__(self): ... + def __iter__(self): ... + def update(self, values): ... + +def rst_to_html(s): ... +def xml_text(root, name: Optional[Any] = ...): ... + +truthy = ... # type: Any +falsy = ... # type: Any + +def asbool(obj): ... +def string_as_bool(string): ... +def string_as_bool_or_none(string): ... +def listify(item, do_strip: bool = ...): ... +def commaify(amount): ... +def roundify(amount, sfs: int = ...): ... +def unicodify(value, encoding: Any = ..., error: str = ..., default: Optional[Any] = ...): ... +def smart_str(s, encoding: Any = ..., strings_only: bool = ..., errors: str = ...): ... +def object_to_string(obj): ... +def string_to_object(s): ... + +class ParamsWithSpecs(collections.defaultdict): + specs = ... # type: Any + params = ... # type: Any + def __init__(self, specs: Optional[Any] = ..., params: Optional[Any] = ...) -> None: ... + def __missing__(self, name): ... + def __getattr__(self, name): ... + +def compare_urls(url1, url2, compare_scheme: bool = ..., compare_hostname: bool = ..., compare_path: bool = ...): ... +def read_dbnames(filename): ... +def read_build_sites(filename, check_builds: bool = ...): ... +def relativize_symlinks(path, start: Optional[Any] = ..., followlinks: bool = ...): ... +def stringify_dictionary_keys(in_dict): ... +def recursively_stringify_dictionary_keys(d): ... +def mkstemp_ln(src, prefix: str = ...): ... +def umask_fix_perms(path, umask, unmasked_perms, gid: Optional[Any] = ...): ... +def docstring_trim(docstring): ... +def nice_size(size): ... +def size_to_bytes(size): ... +def send_mail(frm, to, subject, body, config, html: Optional[Any] = ...): ... +def force_symlink(source, link_name): ... +def move_merge(source, target): ... +def safe_str_cmp(a, b): ... + +galaxy_root_path = ... # type: Any + +def galaxy_directory(): ... +def config_directories_from_setting(directories_setting, galaxy_root: Any = ...): ... +def parse_int(value, min_val: Optional[Any] = ..., max_val: Optional[Any] = ..., default: Optional[Any] = ..., allow_none: bool = ...): ... +def parse_non_hex_float(s): ... +def build_url(base_url, port: int = ..., scheme: str = ..., pathspec: Optional[Any] = ..., params: Optional[Any] = ..., doseq: bool = ...): ... +def url_get(base_url, password_mgr: Optional[Any] = ..., pathspec: Optional[Any] = ..., params: Optional[Any] = ...): ... +def download_to_file(url, dest_file_path, timeout: int = ..., chunk_size: Any = ...): ... +def safe_relpath(path): ... + +class ExecutionTimer: + begin = ... # type: Any + def __init__(self) -> None: ... + @property + def elapsed(self): ... diff --git a/typeshed/2.7/galaxy/util/aliaspickler.pyi b/typeshed/2.7/galaxy/util/aliaspickler.pyi new file mode 100644 index 000000000..95c60a9b1 --- /dev/null +++ b/typeshed/2.7/galaxy/util/aliaspickler.pyi @@ -0,0 +1,20 @@ +# Stubs for galaxy.util.aliaspickler (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import pickle +from six.moves import cStringIO as StringIO + +class AliasUnpickler(pickle.Unpickler): + aliases = ... # type: Any + def __init__(self, aliases, *args, **kw) -> None: ... + def find_class(self, module, name): ... + +class AliasPickleModule: + aliases = ... # type: Any + def __init__(self, aliases) -> None: ... + def dump(self, obj, fileobj, protocol: int = ...): ... + def dumps(self, obj, protocol: int = ...): ... + def load(self, fileobj): ... + def loads(self, string): ... diff --git a/typeshed/2.7/galaxy/util/bunch.pyi b/typeshed/2.7/galaxy/util/bunch.pyi new file mode 100644 index 000000000..87dc09bd0 --- /dev/null +++ b/typeshed/2.7/galaxy/util/bunch.pyi @@ -0,0 +1,17 @@ +# Stubs for galaxy.util.bunch (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +class Bunch: + def __init__(self, **kwds) -> None: ... + def dict(self): ... + def get(self, key, default: Optional[Any] = ...): ... + def __iter__(self): ... + def items(self): ... + def keys(self): ... + def values(self): ... + def __nonzero__(self): ... + def __setitem__(self, k, v): ... + def __contains__(self, item): ... diff --git a/typeshed/2.7/galaxy/util/checkers.pyi b/typeshed/2.7/galaxy/util/checkers.pyi new file mode 100644 index 000000000..cdcb3efb6 --- /dev/null +++ b/typeshed/2.7/galaxy/util/checkers.pyi @@ -0,0 +1,14 @@ +# Stubs for galaxy.util.checkers (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def check_html(file_path, chunk: Optional[Any] = ...): ... +def check_binary(name, file_path: bool = ...): ... +def check_gzip(file_path): ... +def check_bz2(file_path): ... +def check_zip(file_path): ... +def is_bz2(file_path): ... +def is_gzip(file_path): ... +def check_image(file_path): ... diff --git a/typeshed/2.7/galaxy/util/compression_utils.pyi b/typeshed/2.7/galaxy/util/compression_utils.pyi new file mode 100644 index 000000000..0c6ca3a79 --- /dev/null +++ b/typeshed/2.7/galaxy/util/compression_utils.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.util.compression_utils (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from .checkers import is_bz2 as is_bz2, is_gzip as is_gzip + +def get_fileobj(filename, mode: str = ..., gzip_only: bool = ..., bz2_only: bool = ..., zip_only: bool = ...): ... diff --git a/typeshed/2.7/galaxy/util/dictifiable.pyi b/typeshed/2.7/galaxy/util/dictifiable.pyi new file mode 100644 index 000000000..babdeb4d3 --- /dev/null +++ b/typeshed/2.7/galaxy/util/dictifiable.pyi @@ -0,0 +1,8 @@ +# Stubs for galaxy.util.dictifiable (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +class Dictifiable: + def to_dict(self, view: str = ..., value_mapper: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/util/expressions.pyi b/typeshed/2.7/galaxy/util/expressions.pyi new file mode 100644 index 000000000..f1eca5ee8 --- /dev/null +++ b/typeshed/2.7/galaxy/util/expressions.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.util.expressions (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from collections import MutableMapping + +class ExpressionContext(MutableMapping): + dict = ... # type: Any + parent = ... # type: Any + def __init__(self, dict, parent: Optional[Any] = ...) -> None: ... + def __delitem__(self, key): ... + def __iter__(self): ... + def __len__(self): ... + def __getitem__(self, key): ... + def __setitem__(self, key, value): ... + def __contains__(self, key): ... + def __nonzero__(self): ... diff --git a/typeshed/2.7/galaxy/util/filelock.pyi b/typeshed/2.7/galaxy/util/filelock.pyi new file mode 100644 index 000000000..f74dd9a4c --- /dev/null +++ b/typeshed/2.7/galaxy/util/filelock.pyi @@ -0,0 +1,21 @@ +# Stubs for galaxy.util.filelock (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class FileLockException(Exception): ... + +class FileLock: + is_locked = ... # type: bool + lockfile = ... # type: Any + file_name = ... # type: Any + timeout = ... # type: Any + delay = ... # type: Any + def __init__(self, file_name, timeout: int = ..., delay: float = ...) -> None: ... + fd = ... # type: Any + def acquire(self): ... + def release(self): ... + def __enter__(self): ... + def __exit__(self, type, value, traceback): ... + def __del__(self): ... diff --git a/typeshed/2.7/galaxy/util/hash_util.pyi b/typeshed/2.7/galaxy/util/hash_util.pyi new file mode 100644 index 000000000..1a81a16aa --- /dev/null +++ b/typeshed/2.7/galaxy/util/hash_util.pyi @@ -0,0 +1,14 @@ +# Stubs for galaxy.util.hash_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +import hashlib as hashlib + +sha1 = ... # type: Any +sha = ... # type: Any +md5 = ... # type: Any + +def new_secure_hash(text_type: Optional[Any] = ...): ... +def hmac_new(key, value): ... +def is_hashable(value): ... diff --git a/typeshed/2.7/galaxy/util/heartbeat.pyi b/typeshed/2.7/galaxy/util/heartbeat.pyi new file mode 100644 index 000000000..e7152ae9a --- /dev/null +++ b/typeshed/2.7/galaxy/util/heartbeat.pyi @@ -0,0 +1,30 @@ +# Stubs for galaxy.util.heartbeat (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +import threading + +def get_current_thread_object_dict(): ... + +class Heartbeat(threading.Thread): + config = ... # type: Any + should_stop = ... # type: bool + period = ... # type: Any + fname = ... # type: Any + file = ... # type: Any + fname_nonsleeping = ... # type: Any + file_nonsleeping = ... # type: Any + pid = ... # type: Any + nonsleeping_heartbeats = ... # type: Any + wait_event = ... # type: Any + def __init__(self, config, name: str = ..., period: int = ..., fname: str = ...) -> None: ... + def run(self): ... + def open_logs(self): ... + def close_logs(self): ... + def dump(self): ... + def shutdown(self): ... + def thread_is_sleeping(self, last_stack_frame): ... + def get_interesting_stack_frame(self, stack_frames): ... + def print_nonsleeping(self, threads_object_dict): ... + def dump_signal_handler(self, signum, frame): ... diff --git a/typeshed/2.7/galaxy/util/image_util.pyi b/typeshed/2.7/galaxy/util/image_util.pyi new file mode 100644 index 000000000..ce04019bf --- /dev/null +++ b/typeshed/2.7/galaxy/util/image_util.pyi @@ -0,0 +1,13 @@ +# Stubs for galaxy.util.image_util (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from PIL import Image as PIL + +PIL = ... # type: Any +log = ... # type: Any + +def image_type(filename): ... +def check_image_type(filename, types): ... +def get_image_ext(file_path): ... diff --git a/typeshed/2.7/galaxy/util/inflection.pyi b/typeshed/2.7/galaxy/util/inflection.pyi new file mode 100644 index 000000000..92f01cb91 --- /dev/null +++ b/typeshed/2.7/galaxy/util/inflection.pyi @@ -0,0 +1,46 @@ +# Stubs for galaxy.util.inflection (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class Base: + def cond_plural(self, number_of_records, word): ... + def titleize(self, word, uppercase: str = ...): ... + def camelize(self, word): ... + def underscore(self, word): ... + def humanize(self, word, uppercase: str = ...): ... + def variablize(self, word): ... + def tableize(self, class_name): ... + def classify(self, table_name): ... + def ordinalize(self, number): ... + def unaccent(self, text): ... + def string_replace(self, word, find, replace): ... + def urlize(self, text): ... + def demodulize(self, module_name): ... + def modulize(self, module_description): ... + def foreignKey(self, class_name, separate_class_name_and_id_with_underscore: int = ...): ... + +class English(Base): + def pluralize(self, word): ... + def singularize(self, word): ... + +class Inflector: + Inflector = ... # type: Any + def __init__(self, Inflector: Any = ...) -> None: ... + def pluralize(self, word): ... + def singularize(self, word): ... + def cond_plural(self, number_of_records, word): ... + def titleize(self, word, uppercase: str = ...): ... + def camelize(self, word): ... + def underscore(self, word): ... + def humanize(self, word, uppercase: str = ...): ... + def variablize(self, word): ... + def tableize(self, class_name): ... + def classify(self, table_name): ... + def ordinalize(self, number): ... + def unaccent(self, text): ... + def urlize(self, text): ... + def demodulize(self, module_name): ... + def modulize(self, module_description): ... + def foreignKey(self, class_name, separate_class_name_and_id_with_underscore: int = ...): ... diff --git a/typeshed/2.7/galaxy/util/json.pyi b/typeshed/2.7/galaxy/util/json.pyi new file mode 100644 index 000000000..d124bd660 --- /dev/null +++ b/typeshed/2.7/galaxy/util/json.pyi @@ -0,0 +1,12 @@ +# Stubs for galaxy.util.json (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def json_fix(val): ... +def safe_dumps(*args, **kwargs): ... +def validate_jsonrpc_request(request, regular_methods, notification_methods): ... +def validate_jsonrpc_response(response, id: Optional[Any] = ...): ... +def jsonrpc_request(method, params: Optional[Any] = ..., id: Optional[Any] = ..., jsonrpc: str = ...): ... +def jsonrpc_response(request: Optional[Any] = ..., id: Optional[Any] = ..., result: Optional[Any] = ..., error: Optional[Any] = ..., jsonrpc: str = ...): ... diff --git a/typeshed/2.7/galaxy/util/lazy_process.pyi b/typeshed/2.7/galaxy/util/lazy_process.pyi new file mode 100644 index 000000000..045e42f44 --- /dev/null +++ b/typeshed/2.7/galaxy/util/lazy_process.pyi @@ -0,0 +1,22 @@ +# Stubs for galaxy.util.lazy_process (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class LazyProcess: + command_and_args = ... # type: Any + thread_lock = ... # type: Any + allow_process_request = ... # type: bool + process = ... # type: Any + def __init__(self, command_and_args) -> None: ... + def start_process(self): ... + def shutdown(self): ... + @property + def running(self): ... + +class NoOpLazyProcess: + def start_process(self): ... + def shutdown(self): ... + @property + def running(self): ... diff --git a/typeshed/2.7/galaxy/util/object_wrapper.pyi b/typeshed/2.7/galaxy/util/object_wrapper.pyi new file mode 100644 index 000000000..8a5cda6e6 --- /dev/null +++ b/typeshed/2.7/galaxy/util/object_wrapper.pyi @@ -0,0 +1,95 @@ +# Stubs for galaxy.util.object_wrapper (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from six.moves import copyreg as copy_reg +from galaxy.util import sanitize_lists_to_string as _sanitize_lists_to_string + +NoneType = ... # type: Any +NotImplementedType = ... # type: Any +EllipsisType = ... # type: Any +XRangeType = ... # type: Any +SliceType = ... # type: Any +BufferType = ... # type: Any +DictProxyType = ... # type: Any +log = ... # type: Any +__CALLABLE_TYPES__ = ... # type: Any +__WRAP_NO_SUBCLASS__ = ... # type: Any +__DONT_SANITIZE_TYPES__ = ... # type: Any +__DONT_WRAP_TYPES__ = ... # type: Any +__WRAP_SEQUENCES__ = ... # type: Any +__WRAP_SETS__ = ... # type: Any +__WRAP_MAPPINGS__ = ... # type: Any +VALID_CHARACTERS = ... # type: Any +CHARACTER_MAP = ... # type: Any +INVALID_CHARACTER = ... # type: str + +def coerce(x, y): ... +def cmp(x, y): ... +def sanitize_lists_to_string(values, valid_characters: Any = ..., character_map: Any = ..., invalid_character: Any = ...): ... +def wrap_with_safe_string(value, no_wrap_classes: Optional[Any] = ...): ... + +class SafeStringWrapper: + __UNSANITIZED_ATTRIBUTE_NAME__ = ... # type: str + __NO_WRAP_NAMES__ = ... # type: Any + def __new__(cls, *arg, **kwd): ... + unsanitized = ... # type: Any + __safe_string_wrapper_function__ = ... # type: Any + def __init__(self, value, safe_string_wrapper_function: Any = ...) -> None: ... + def __lt__(self, other): ... + def __le__(self, other): ... + def __eq__(self, other): ... + def __ne__(self, other): ... + def __gt__(self, other): ... + def __ge__(self, other): ... + def __cmp__(self, other): ... + def __hash__(self): ... + def __bool__(self): ... + __nonzero__ = ... # type: Any + def __getattr__(self, name): ... + def __setattr__(self, name, value): ... + def __delattr__(self, name): ... + def __getattribute__(self, name): ... + def __len__(self): ... + def __getitem__(self, key): ... + def __setitem__(self, key, value): ... + def __delitem__(self, key): ... + def __iter__(self): ... + def __contains__(self, item): ... + def __getslice__(self, i, j): ... + def __setslice__(self, i, j, value): ... + def __delslice__(self, i, j): ... + def __add__(self, other): ... + def __sub__(self, other): ... + def __mul__(self, other): ... + def __floordiv__(self, other): ... + def __mod__(self, other): ... + def __divmod__(self, other): ... + def __pow__(self, *other): ... + def __lshift__(self, other): ... + def __rshift__(self, other): ... + def __and__(self, other): ... + def __xor__(self, other): ... + def __or__(self, other): ... + def __div__(self, other): ... + def __truediv__(self, other): ... + def __rpow__(self, other): ... + def __neg__(self): ... + def __pos__(self): ... + def __abs__(self): ... + def __invert__(self): ... + def __complex__(self): ... + def __int__(self): ... + def __float__(self): ... + def __oct__(self): ... + def __hex__(self): ... + def __index__(self): ... + def __coerce__(self, other): ... + def __enter__(self): ... + def __exit__(self, *args): ... + +class CallableSafeStringWrapper(SafeStringWrapper): + def __call__(self, *args, **kwds): ... + +def pickle_SafeStringWrapper(safe_object): ... diff --git a/typeshed/2.7/galaxy/util/odict.pyi b/typeshed/2.7/galaxy/util/odict.pyi new file mode 100644 index 000000000..459e30699 --- /dev/null +++ b/typeshed/2.7/galaxy/util/odict.pyi @@ -0,0 +1,27 @@ +# Stubs for galaxy.util.odict (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from six.moves import UserDict + +dict_alias = ... # type: Any + +class odict(UserDict): + def __init__(self, dict: Optional[Any] = ...) -> None: ... + def __delitem__(self, key): ... + def __setitem__(self, key, item): ... + def clear(self): ... + def copy(self): ... + def items(self): ... + def keys(self): ... + def popitem(self): ... + def setdefault(self, key, failobj: Optional[Any] = ...): ... + def update(self, dict): ... + def values(self): ... + def iterkeys(self): ... + def itervalues(self): ... + def iteritems(self): ... + def __iter__(self): ... + def reverse(self): ... + def insert(self, index, key, item): ... diff --git a/typeshed/2.7/galaxy/util/oset.pyi b/typeshed/2.7/galaxy/util/oset.pyi new file mode 100644 index 000000000..1d1f7bd80 --- /dev/null +++ b/typeshed/2.7/galaxy/util/oset.pyi @@ -0,0 +1,19 @@ +# Stubs for galaxy.util.oset (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +import collections + +class OrderedSet(collections.MutableSet): + end = ... # type: Any + map = ... # type: Any + def __init__(self, iterable: Optional[Any] = ...) -> None: ... + def __len__(self): ... + def __contains__(self, key): ... + def add(self, key): ... + def discard(self, key): ... + def __iter__(self): ... + def __reversed__(self): ... + def pop(self, last: bool = ...): ... + def __eq__(self, other): ... diff --git a/typeshed/2.7/galaxy/util/plugin_config.pyi b/typeshed/2.7/galaxy/util/plugin_config.pyi new file mode 100644 index 000000000..887a82b7b --- /dev/null +++ b/typeshed/2.7/galaxy/util/plugin_config.pyi @@ -0,0 +1,11 @@ +# Stubs for galaxy.util.plugin_config (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +yaml = ... # type: Any + +def plugins_dict(module, plugin_type_identifier): ... +def load_plugins(plugins_dict, plugin_source, extra_kwds: Any = ...): ... +def plugin_source_from_path(path): ... diff --git a/typeshed/2.7/galaxy/util/properties.pyi b/typeshed/2.7/galaxy/util/properties.pyi new file mode 100644 index 000000000..b59fdd0c8 --- /dev/null +++ b/typeshed/2.7/galaxy/util/properties.pyi @@ -0,0 +1,19 @@ +# Stubs for galaxy.util.properties (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional +from six.moves.configparser import ConfigParser + +def find_config_file(default, old_default, explicit, cwd: Optional[Any] = ...): ... +def load_app_properties(kwds: Any = ..., ini_file: Optional[Any] = ..., ini_section: str = ..., config_prefix: str = ...): ... + +class NicerConfigParser(ConfigParser): + filename = ... # type: Any + def __init__(self, filename, *args, **kw) -> None: ... + read_file = ... # type: Any + def defaults(self): ... + class InterpolateWrapper: + def __init__(self, original) -> None: ... + def __getattr__(self, name): ... + def before_get(self, parser, section, option, value, defaults): ... diff --git a/typeshed/2.7/galaxy/util/simplegraph.pyi b/typeshed/2.7/galaxy/util/simplegraph.pyi new file mode 100644 index 000000000..b1aba1a6e --- /dev/null +++ b/typeshed/2.7/galaxy/util/simplegraph.pyi @@ -0,0 +1,26 @@ +# Stubs for galaxy.util.simplegraph (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +class SimpleGraphNode: + index = ... # type: Any + data = ... # type: Any + def __init__(self, index, **data) -> None: ... + +class SimpleGraphEdge: + source_index = ... # type: Any + target_index = ... # type: Any + data = ... # type: Any + def __init__(self, source_index, target_index, **data) -> None: ... + +class SimpleGraph: + nodes = ... # type: Any + edges = ... # type: Any + def __init__(self, nodes: Optional[Any] = ..., edges: Optional[Any] = ...) -> None: ... + def add_node(self, node_id, **data): ... + def add_edge(self, source_id, target_id, **data): ... + def gen_node_dicts(self): ... + def gen_edge_dicts(self): ... + def as_dict(self): ... diff --git a/typeshed/2.7/galaxy/util/sleeper.pyi b/typeshed/2.7/galaxy/util/sleeper.pyi new file mode 100644 index 000000000..600adf989 --- /dev/null +++ b/typeshed/2.7/galaxy/util/sleeper.pyi @@ -0,0 +1,11 @@ +# Stubs for galaxy.util.sleeper (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +class Sleeper: + condition = ... # type: Any + def __init__(self) -> None: ... + def sleep(self, seconds): ... + def wake(self): ... diff --git a/typeshed/2.7/galaxy/util/sockets.pyi b/typeshed/2.7/galaxy/util/sockets.pyi new file mode 100644 index 000000000..100aba9a9 --- /dev/null +++ b/typeshed/2.7/galaxy/util/sockets.pyi @@ -0,0 +1,7 @@ +# Stubs for galaxy.util.sockets (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any, Optional + +def unused_port(range: Optional[Any] = ...): ... diff --git a/typeshed/2.7/galaxy/util/specs.pyi b/typeshed/2.7/galaxy/util/specs.pyi new file mode 100644 index 000000000..e3a95b9de --- /dev/null +++ b/typeshed/2.7/galaxy/util/specs.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.util.specs (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def to_str_or_none(value): ... +def to_bool_or_none(value): ... +def to_bool(value): ... +def to_float_or_none(value): ... +def is_in(*args): ... diff --git a/typeshed/2.7/galaxy/util/sqlite.pyi b/typeshed/2.7/galaxy/util/sqlite.pyi new file mode 100644 index 000000000..53c7eaeaf --- /dev/null +++ b/typeshed/2.7/galaxy/util/sqlite.pyi @@ -0,0 +1,6 @@ +# Stubs for galaxy.util.sqlite (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +def is_read_only_query(query): ... +def connect(path): ... diff --git a/typeshed/2.7/galaxy/util/submodules.pyi b/typeshed/2.7/galaxy/util/submodules.pyi new file mode 100644 index 000000000..dbae0501f --- /dev/null +++ b/typeshed/2.7/galaxy/util/submodules.pyi @@ -0,0 +1,9 @@ +# Stubs for galaxy.util.submodules (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +log = ... # type: Any + +def submodules(module): ... diff --git a/typeshed/2.7/galaxy/util/topsort.pyi b/typeshed/2.7/galaxy/util/topsort.pyi new file mode 100644 index 000000000..79396d98a --- /dev/null +++ b/typeshed/2.7/galaxy/util/topsort.pyi @@ -0,0 +1,20 @@ +# Stubs for galaxy.util.topsort (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any +from galaxy.util.odict import odict as OrderedDict + +class CycleError(Exception): + preds = ... # type: Any + def __init__(self, sofar, numpreds, succs) -> None: ... + def get_partial(self): ... + def get_pred_counts(self): ... + def get_succs(self): ... + def get_elements(self): ... + def get_pairlist(self): ... + def get_preds(self): ... + def pick_a_cycle(self): ... + +def topsort(pairlist): ... +def topsort_levels(pairlist): ... diff --git a/typeshed/2.7/galaxy/util/xml_macros.pyi b/typeshed/2.7/galaxy/util/xml_macros.pyi new file mode 100644 index 000000000..27607dfd1 --- /dev/null +++ b/typeshed/2.7/galaxy/util/xml_macros.pyi @@ -0,0 +1,18 @@ +# Stubs for galaxy.util.xml_macros (Python 3.4) +# +# NOTE: This dynamically typed stub was automatically generated by stubgen. + +from typing import Any + +REQUIRED_PARAMETER = ... # type: Any + +def load(path): ... +def template_macro_params(root): ... +def raw_tool_xml_tree(path): ... +def imported_macro_paths(root): ... + +class XmlMacroDef: + elements = ... # type: Any + parameters = ... # type: Any + def __init__(self, el) -> None: ... + def macro_tokens(self, expand_el): ...