From 405d244e8d2067fcfd84902158467c4642ef5998 Mon Sep 17 00:00:00 2001 From: Antonio Gonzalez Date: Sat, 25 Mar 2023 08:08:39 -0600 Subject: [PATCH] fix documentation --- .../processing-recommendations.rst | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst b/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst index 6b0b56949..0c0009de5 100755 --- a/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst +++ b/qiita_pet/support_files/doc/source/processingdata/processing-recommendations.rst @@ -66,15 +66,15 @@ recommend that all sequence files go through adapter and host filtering within t subsequent meta-analyses. We currently provide the several options for your convenience. For each the `fastp` command is set to autodetect and remove universal adapter sequences (i.e., 'GATCGGAAGAGCACACGTCTGAACTCCAGTCAC' for R1 reads and 'GATCGGAAGAGCGTCGTGTAGGGAAAGGAGTGT' for R2 reads). We also provide the following host reference genomes for filtering against; each also filters against three phi x sequences (i.e., `HM753704.1 `_, `JF719728.1 `_, `J02482.1 `_): - auto-detect adapters and artifacts + phix filtering: This is a `deblur artifacts `_ reference, mainly for debugging and testing. Includes another adapter sequence (i.e., 'ATCTCGTATGCCGTCTTCTGC'). -- auto-detect adapters and **cheetah** + phix filtering. Includes cheetah (*Acinonyx jubatus*) reference `GCF_003709585.1 (Aci_jub_2) `_. `Download link `_ -- auto-detect adapters and **cow** + phix filtering. Includes cow (*Bos taurus*) reference `GCF_000003205.7 (Btau_5.0.1) `_. `Download link `_ -- auto-detect adapters and **hamster** + phix filtering. Includes golden hamster (*Mesocricetus auratus*) reference `GCF_017639785.1 (BCM_Maur_2.0) `_. `Download link `_ -- auto-detect adapters and **horse** + phix filtering. Includes horse (*Equus caballus*) reference `GCF_000002305.2 (EquCab2.0) `_. `Download link `_ +- auto-detect adapters and **cheetah** + phix filtering. Includes cheetah (*Acinonyx jubatus*) reference `GCF_003709585.1 (Aci_jub_2) `_. `GCF_003709585.1 fna `_ +- auto-detect adapters and **cow** + phix filtering. Includes cow (*Bos taurus*) reference `GCF_000003205.7 (Btau_5.0.1) `_. `GCF_000003205.7 fna `_ +- auto-detect adapters and **hamster** + phix filtering. Includes golden hamster (*Mesocricetus auratus*) reference `GCF_017639785.1 (BCM_Maur_2.0) `_. `GCF_017639785.1 fna `_ +- auto-detect adapters and **horse** + phix filtering. Includes horse (*Equus caballus*) reference `GCF_000002305.2 (EquCab2.0) `_. `GCF_000002305.2 fna `_ - auto-detect adapters and **merge_genomes** + phix filtering. Includes the genomes of cheetah, cow, hamster, horse, mouse, pig, rabbit, and rat described here. -- auto-detect adapters and **mouse** + phix filtering. Includes house mouse (*Mus musculus*) reference `GCF_000001635.27 (GRCm39) `_. `Download link `_ -- auto-detect adapters and **pig** + phix filtering. Includes pig (*Sus scrofa*) reference `GCF_000003025.6 (Sscrofa11.1) `_. `Download link `_ -- auto-detect adapters and **rabbit** + phix filtering. Includes rabbit (*Oryctolagus cuniculus*) reference `GCF_000003625.3 (OryCun2.0) `_. `Download link `_ -- auto-detect adapters and **rat** + phix filtering. Includes Norway rat (*Rattus norvegicus*) reference `GCF_000001895.5 (Rnor_6.0) `_. `Download link `_ +- auto-detect adapters and **mouse** + phix filtering. Includes house mouse (*Mus musculus*) reference `GCF_000001635.27 (GRCm39) `_. `GCF_000001635.27 fna `_ +- auto-detect adapters and **pig** + phix filtering. Includes pig (*Sus scrofa*) reference `GCF_000003025.6 (Sscrofa11.1) `_. `GCF_000003025.6 fna `_ +- auto-detect adapters and **rabbit** + phix filtering. Includes rabbit (*Oryctolagus cuniculus*) reference `GCF_000003625.3 (OryCun2.0) `_. `GCF_000003625.3 fna `_ +- auto-detect adapters and **rat** + phix filtering. Includes Norway rat (*Rattus norvegicus*) reference `GCF_000001895.5 (Rnor_6.0) `_. `GCF_000001895.5 fna `_ - auto-detect adapters only filtering. Only includes the two adapter sequences noted above. Note that the command produces up to 6 output artifacts based on the aligner and database selected: