diff --git a/src/doc/reference.md b/src/doc/reference.md
index ebcea7cf9de68..c34a136a68e88 100644
--- a/src/doc/reference.md
+++ b/src/doc/reference.md
@@ -1383,44 +1383,87 @@ a = Cat { name: "Spotty".to_string(), weight: 2.7 };
 In this example, `Cat` is a _struct-like enum variant_,
 whereas `Dog` is simply called an enum variant.
 
-### Static items
+### Constant items
 
 ```{.ebnf .gram}
-static_item : "static" ident ':' type '=' expr ';' ;
+const_item : "const" ident ':' type '=' expr ';' ;
 ```
 
-A *static item* is a named _constant value_ stored in the global data section
-of a crate. Immutable static items are stored in the read-only data section.
-The constant value bound to a static item is, like all constant values,
-evaluated at compile time. Static items have the `static` lifetime, which
-outlives all other lifetimes in a Rust program. Only values stored in the
-global data section (such as string constants and static items) can have the
-`static` lifetime; dynamically constructed values cannot safely be assigned the
-`static` lifetime. Static items are declared with the `static` keyword. A
-static item must have a _constant expression_ giving its definition.
+A *constant item* is a named _constant value_ which is not associated with a
+specific memory location in the program. Constants are essentially inlined
+wherever they are used, meaning that they are copied directly into the relevant
+context when used. References to the same constant are not necessarily
+guaranteed to refer to the same memory address.
+
+Constant values must not have destructors, and otherwise permit most forms of
+data. Constants may refer to the address of other constants, in which case the
+address will have the `static` lifetime. The compiler is, however, still at
+liberty to translate the constant many times, so the address referred to may not
+be stable.
 
-Static items must be explicitly typed. The type may be `bool`, `char`,
-a number, or a type derived from those primitive types. The derived types are
-references with the `static` lifetime, fixed-size arrays, tuples, and structs.
+Constants must be explicitly typed. The type may be `bool`, `char`, a number, or
+a type derived from those primitive types. The derived types are references with
+the `static` lifetime, fixed-size arrays, tuples, enum variants, and structs.
 
 ```
-static BIT1: uint = 1 << 0;
-static BIT2: uint = 1 << 1;
+const BIT1: uint = 1 << 0;
+const BIT2: uint = 1 << 1;
 
-static BITS: [uint, ..2] = [BIT1, BIT2];
-static STRING: &'static str = "bitstring";
+const BITS: [uint, ..2] = [BIT1, BIT2];
+const STRING: &'static str = "bitstring";
 
 struct BitsNStrings<'a> {
     mybits: [uint, ..2],
     mystring: &'a str
 }
 
-static BITS_N_STRINGS: BitsNStrings<'static> = BitsNStrings {
+const BITS_N_STRINGS: BitsNStrings<'static> = BitsNStrings {
     mybits: BITS,
     mystring: STRING
 };
 ```
 
+### Static items
+
+```{.ebnf .gram}
+static_item : "static" ident ':' type '=' expr ';' ;
+```
+
+A *static item* is similar to a *constant*, except that it represents a precise
+memory location in the program. A static is never "inlined" at the usage site,
+and all references to it refer to the same memory location. Static items have
+the `static` lifetime, which outlives all other lifetimes in a Rust program.
+Static items may be placed in read-only memory if they do not contain any
+interior mutability.
+
+Statics may contain interior mutability through the `UnsafeCell` language item.
+All access to a static is safe, but there are a number of restrictions on
+statics:
+
+* Statics may not contain any destructors.
+* The types of static values must ascribe to `Sync` to allow threadsafe access.
+* Statics may not refer to other statics by value, only by reference.
+* Constants cannot refer to statics.
+
+Constants should in general be preferred over statics, unless large amounts of
+data are being stored, or single-address and mutability properties are required.
+
+```
+use std::sync::atomic;
+
+// Note that INIT_ATOMIC_UINT is a *const*, but it may be used to initialize a
+// static. This static can be modified, so it is not placed in read-only memory.
+static COUNTER: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+
+// This table is a candidate to be placed in read-only memory.
+static TABLE: &'static [uint] = &[1, 2, 3, /* ... */];
+
+for slot in TABLE.iter() {
+    println!("{}", slot);
+}
+COUNTER.fetch_add(1, atomic::SeqCst);
+```
+
 #### Mutable statics
 
 If a static item is declared with the `mut` keyword, then it is allowed to
@@ -1455,6 +1498,9 @@ unsafe fn bump_levels_unsafe2() -> uint {
 }
 ```
 
+Mutable statics have the same restrictions as normal statics, except that the
+type of the value is not required to ascribe to `Sync`.
+
 ### Traits
 
 A _trait_ describes a set of method types.
diff --git a/src/etc/unicode.py b/src/etc/unicode.py
index a74bb74897135..0b128686690f0 100755
--- a/src/etc/unicode.py
+++ b/src/etc/unicode.py
@@ -333,14 +333,14 @@ def emit_property_module(f, mod, tbl, emit_fn):
 def emit_regex_module(f, cats, w_data):
     f.write("pub mod regex {\n")
     regex_class = "&'static [(char, char)]"
-    class_table = "&'static [(&'static str, %s)]" % regex_class
+    class_table = "&'static [(&'static str, &'static %s)]" % regex_class
 
     emit_table(f, "UNICODE_CLASSES", cats, class_table,
-        pfun=lambda x: "(\"%s\",super::%s::%s_table)" % (x[0], x[1], x[0]))
+        pfun=lambda x: "(\"%s\",&super::%s::%s_table)" % (x[0], x[1], x[0]))
 
-    f.write("    pub static PERLD: %s = super::general_category::Nd_table;\n\n"
+    f.write("    pub static PERLD: &'static %s = &super::general_category::Nd_table;\n\n"
             % regex_class)
-    f.write("    pub static PERLS: %s = super::property::White_Space_table;\n\n"
+    f.write("    pub static PERLS: &'static %s = &super::property::White_Space_table;\n\n"
             % regex_class)
 
     emit_table(f, "PERLW", w_data, regex_class)
diff --git a/src/liballoc/heap.rs b/src/liballoc/heap.rs
index 9a4390747198c..5a0f860ff844e 100644
--- a/src/liballoc/heap.rs
+++ b/src/liballoc/heap.rs
@@ -85,7 +85,7 @@ pub fn stats_print() {
 ///
 /// This preserves the non-null invariant for types like `Box<T>`. The address may overlap with
 /// non-zero-size memory allocations.
-pub static EMPTY: *mut () = 0x1 as *mut ();
+pub const EMPTY: *mut () = 0x1 as *mut ();
 
 /// The allocator for unique pointers.
 #[cfg(not(test))]
diff --git a/src/libcollections/trie.rs b/src/libcollections/trie.rs
index 66f41d2ba1f32..fe8ced7f2aaaf 100644
--- a/src/libcollections/trie.rs
+++ b/src/libcollections/trie.rs
@@ -34,10 +34,10 @@ use slice::{Items, MutItems};
 use slice;
 
 // FIXME: #5244: need to manually update the TrieNode constructor
-static SHIFT: uint = 4;
-static SIZE: uint = 1 << SHIFT;
-static MASK: uint = SIZE - 1;
-static NUM_CHUNKS: uint = uint::BITS / SHIFT;
+const SHIFT: uint = 4;
+const SIZE: uint = 1 << SHIFT;
+const MASK: uint = SIZE - 1;
+const NUM_CHUNKS: uint = uint::BITS / SHIFT;
 
 #[deriving(Clone)]
 enum Child<T> {
diff --git a/src/libcore/atomic.rs b/src/libcore/atomic.rs
index 3e53746f58fe9..cc6fe06665bc8 100644
--- a/src/libcore/atomic.rs
+++ b/src/libcore/atomic.rs
@@ -77,19 +77,19 @@ pub enum Ordering {
 
 /// An `AtomicBool` initialized to `false`
 #[unstable = "may be renamed, pending conventions for static initalizers"]
-pub static INIT_ATOMIC_BOOL: AtomicBool =
+pub const INIT_ATOMIC_BOOL: AtomicBool =
         AtomicBool { v: UnsafeCell { value: 0 }, nocopy: marker::NoCopy };
 /// An `AtomicInt` initialized to `0`
 #[unstable = "may be renamed, pending conventions for static initalizers"]
-pub static INIT_ATOMIC_INT: AtomicInt =
+pub const INIT_ATOMIC_INT: AtomicInt =
         AtomicInt { v: UnsafeCell { value: 0 }, nocopy: marker::NoCopy };
 /// An `AtomicUint` initialized to `0`
 #[unstable = "may be renamed, pending conventions for static initalizers"]
-pub static INIT_ATOMIC_UINT: AtomicUint =
+pub const INIT_ATOMIC_UINT: AtomicUint =
         AtomicUint { v: UnsafeCell { value: 0, }, nocopy: marker::NoCopy };
 
 // NB: Needs to be -1 (0b11111111...) to make fetch_nand work correctly
-static UINT_TRUE: uint = -1;
+const UINT_TRUE: uint = -1;
 
 #[stable]
 impl AtomicBool {
diff --git a/src/libcore/cell.rs b/src/libcore/cell.rs
index 1cad9a3f8ca22..d644fd0063ed3 100644
--- a/src/libcore/cell.rs
+++ b/src/libcore/cell.rs
@@ -219,8 +219,8 @@ pub struct RefCell<T> {
 // Values [1, MAX-1] represent the number of `Ref` active
 // (will not outgrow its range since `uint` is the size of the address space)
 type BorrowFlag = uint;
-static UNUSED: BorrowFlag = 0;
-static WRITING: BorrowFlag = -1;
+const UNUSED: BorrowFlag = 0;
+const WRITING: BorrowFlag = -1;
 
 impl<T> RefCell<T> {
     /// Create a new `RefCell` containing `value`
diff --git a/src/libcore/char.rs b/src/libcore/char.rs
index 1e87d11d37367..8f3ecf0633cf3 100644
--- a/src/libcore/char.rs
+++ b/src/libcore/char.rs
@@ -63,7 +63,7 @@ static MAX_THREE_B: u32 =  0x10000u32;
 */
 
 /// The highest valid code point
-pub static MAX: char = '\U0010ffff';
+pub const MAX: char = '\U0010ffff';
 
 /// Converts from `u32` to a `char`
 #[inline]
diff --git a/src/libcore/num/f32.rs b/src/libcore/num/f32.rs
index bcea4bd8d3c29..b439f5577cbea 100644
--- a/src/libcore/num/f32.rs
+++ b/src/libcore/num/f32.rs
@@ -20,29 +20,29 @@ use num::{FPNormal, FPCategory, FPZero, FPSubnormal, FPInfinite, FPNaN};
 use num::Float;
 use option::Option;
 
-pub static RADIX: uint = 2u;
+pub const RADIX: uint = 2u;
 
-pub static MANTISSA_DIGITS: uint = 24u;
-pub static DIGITS: uint = 6u;
+pub const MANTISSA_DIGITS: uint = 24u;
+pub const DIGITS: uint = 6u;
 
-pub static EPSILON: f32 = 1.19209290e-07_f32;
+pub const EPSILON: f32 = 1.19209290e-07_f32;
 
 /// Smallest finite f32 value
-pub static MIN_VALUE: f32 = -3.40282347e+38_f32;
+pub const MIN_VALUE: f32 = -3.40282347e+38_f32;
 /// Smallest positive, normalized f32 value
-pub static MIN_POS_VALUE: f32 = 1.17549435e-38_f32;
+pub const MIN_POS_VALUE: f32 = 1.17549435e-38_f32;
 /// Largest finite f32 value
-pub static MAX_VALUE: f32 = 3.40282347e+38_f32;
+pub const MAX_VALUE: f32 = 3.40282347e+38_f32;
 
-pub static MIN_EXP: int = -125;
-pub static MAX_EXP: int = 128;
+pub const MIN_EXP: int = -125;
+pub const MAX_EXP: int = 128;
 
-pub static MIN_10_EXP: int = -37;
-pub static MAX_10_EXP: int = 38;
+pub const MIN_10_EXP: int = -37;
+pub const MAX_10_EXP: int = 38;
 
-pub static NAN: f32 = 0.0_f32/0.0_f32;
-pub static INFINITY: f32 = 1.0_f32/0.0_f32;
-pub static NEG_INFINITY: f32 = -1.0_f32/0.0_f32;
+pub const NAN: f32 = 0.0_f32/0.0_f32;
+pub const INFINITY: f32 = 1.0_f32/0.0_f32;
+pub const NEG_INFINITY: f32 = -1.0_f32/0.0_f32;
 
 /// Various useful constants.
 pub mod consts {
@@ -53,55 +53,55 @@ pub mod consts {
     // of `Float`.
 
     /// Archimedes' constant
-    pub static PI: f32 = 3.14159265358979323846264338327950288_f32;
+    pub const PI: f32 = 3.14159265358979323846264338327950288_f32;
 
     /// pi * 2.0
-    pub static PI_2: f32 = 6.28318530717958647692528676655900576_f32;
+    pub const PI_2: f32 = 6.28318530717958647692528676655900576_f32;
 
     /// pi/2.0
-    pub static FRAC_PI_2: f32 = 1.57079632679489661923132169163975144_f32;
+    pub const FRAC_PI_2: f32 = 1.57079632679489661923132169163975144_f32;
 
     /// pi/3.0
-    pub static FRAC_PI_3: f32 = 1.04719755119659774615421446109316763_f32;
+    pub const FRAC_PI_3: f32 = 1.04719755119659774615421446109316763_f32;
 
     /// pi/4.0
-    pub static FRAC_PI_4: f32 = 0.785398163397448309615660845819875721_f32;
+    pub const FRAC_PI_4: f32 = 0.785398163397448309615660845819875721_f32;
 
     /// pi/6.0
-    pub static FRAC_PI_6: f32 = 0.52359877559829887307710723054658381_f32;
+    pub const FRAC_PI_6: f32 = 0.52359877559829887307710723054658381_f32;
 
     /// pi/8.0
-    pub static FRAC_PI_8: f32 = 0.39269908169872415480783042290993786_f32;
+    pub const FRAC_PI_8: f32 = 0.39269908169872415480783042290993786_f32;
 
     /// 1.0/pi
-    pub static FRAC_1_PI: f32 = 0.318309886183790671537767526745028724_f32;
+    pub const FRAC_1_PI: f32 = 0.318309886183790671537767526745028724_f32;
 
     /// 2.0/pi
-    pub static FRAC_2_PI: f32 = 0.636619772367581343075535053490057448_f32;
+    pub const FRAC_2_PI: f32 = 0.636619772367581343075535053490057448_f32;
 
     /// 2.0/sqrt(pi)
-    pub static FRAC_2_SQRTPI: f32 = 1.12837916709551257389615890312154517_f32;
+    pub const FRAC_2_SQRTPI: f32 = 1.12837916709551257389615890312154517_f32;
 
     /// sqrt(2.0)
-    pub static SQRT2: f32 = 1.41421356237309504880168872420969808_f32;
+    pub const SQRT2: f32 = 1.41421356237309504880168872420969808_f32;
 
     /// 1.0/sqrt(2.0)
-    pub static FRAC_1_SQRT2: f32 = 0.707106781186547524400844362104849039_f32;
+    pub const FRAC_1_SQRT2: f32 = 0.707106781186547524400844362104849039_f32;
 
     /// Euler's number
-    pub static E: f32 = 2.71828182845904523536028747135266250_f32;
+    pub const E: f32 = 2.71828182845904523536028747135266250_f32;
 
     /// log2(e)
-    pub static LOG2_E: f32 = 1.44269504088896340735992468100189214_f32;
+    pub const LOG2_E: f32 = 1.44269504088896340735992468100189214_f32;
 
     /// log10(e)
-    pub static LOG10_E: f32 = 0.434294481903251827651128918916605082_f32;
+    pub const LOG10_E: f32 = 0.434294481903251827651128918916605082_f32;
 
     /// ln(2.0)
-    pub static LN_2: f32 = 0.693147180559945309417232121458176568_f32;
+    pub const LN_2: f32 = 0.693147180559945309417232121458176568_f32;
 
     /// ln(10.0)
-    pub static LN_10: f32 = 2.30258509299404568401799145468436421_f32;
+    pub const LN_10: f32 = 2.30258509299404568401799145468436421_f32;
 }
 
 impl Float for f32 {
@@ -143,8 +143,8 @@ impl Float for f32 {
     /// is going to be tested, it is generally faster to use the specific
     /// predicate instead.
     fn classify(self) -> FPCategory {
-        static EXP_MASK: u32 = 0x7f800000;
-        static MAN_MASK: u32 = 0x007fffff;
+        const EXP_MASK: u32 = 0x7f800000;
+        const MAN_MASK: u32 = 0x007fffff;
 
         let bits: u32 = unsafe { mem::transmute(self) };
         match (bits & MAN_MASK, bits & EXP_MASK) {
diff --git a/src/libcore/num/f64.rs b/src/libcore/num/f64.rs
index a3ae8e7c79ea3..d980009c0db0d 100644
--- a/src/libcore/num/f64.rs
+++ b/src/libcore/num/f64.rs
@@ -24,31 +24,31 @@ use option::Option;
 // constants are implemented in favour of referencing the respective
 // members of `Bounded` and `Float`.
 
-pub static RADIX: uint = 2u;
+pub const RADIX: uint = 2u;
 
-pub static MANTISSA_DIGITS: uint = 53u;
-pub static DIGITS: uint = 15u;
+pub const MANTISSA_DIGITS: uint = 53u;
+pub const DIGITS: uint = 15u;
 
-pub static EPSILON: f64 = 2.2204460492503131e-16_f64;
+pub const EPSILON: f64 = 2.2204460492503131e-16_f64;
 
 /// Smallest finite f64 value
-pub static MIN_VALUE: f64 = -1.7976931348623157e+308_f64;
+pub const MIN_VALUE: f64 = -1.7976931348623157e+308_f64;
 /// Smallest positive, normalized f64 value
-pub static MIN_POS_VALUE: f64 = 2.2250738585072014e-308_f64;
+pub const MIN_POS_VALUE: f64 = 2.2250738585072014e-308_f64;
 /// Largest finite f64 value
-pub static MAX_VALUE: f64 = 1.7976931348623157e+308_f64;
+pub const MAX_VALUE: f64 = 1.7976931348623157e+308_f64;
 
-pub static MIN_EXP: int = -1021;
-pub static MAX_EXP: int = 1024;
+pub const MIN_EXP: int = -1021;
+pub const MAX_EXP: int = 1024;
 
-pub static MIN_10_EXP: int = -307;
-pub static MAX_10_EXP: int = 308;
+pub const MIN_10_EXP: int = -307;
+pub const MAX_10_EXP: int = 308;
 
-pub static NAN: f64 = 0.0_f64/0.0_f64;
+pub const NAN: f64 = 0.0_f64/0.0_f64;
 
-pub static INFINITY: f64 = 1.0_f64/0.0_f64;
+pub const INFINITY: f64 = 1.0_f64/0.0_f64;
 
-pub static NEG_INFINITY: f64 = -1.0_f64/0.0_f64;
+pub const NEG_INFINITY: f64 = -1.0_f64/0.0_f64;
 
 /// Various useful constants.
 pub mod consts {
@@ -59,55 +59,55 @@ pub mod consts {
     // of `Float`.
 
     /// Archimedes' constant
-    pub static PI: f64 = 3.14159265358979323846264338327950288_f64;
+    pub const PI: f64 = 3.14159265358979323846264338327950288_f64;
 
     /// pi * 2.0
-    pub static PI_2: f64 = 6.28318530717958647692528676655900576_f64;
+    pub const PI_2: f64 = 6.28318530717958647692528676655900576_f64;
 
     /// pi/2.0
-    pub static FRAC_PI_2: f64 = 1.57079632679489661923132169163975144_f64;
+    pub const FRAC_PI_2: f64 = 1.57079632679489661923132169163975144_f64;
 
     /// pi/3.0
-    pub static FRAC_PI_3: f64 = 1.04719755119659774615421446109316763_f64;
+    pub const FRAC_PI_3: f64 = 1.04719755119659774615421446109316763_f64;
 
     /// pi/4.0
-    pub static FRAC_PI_4: f64 = 0.785398163397448309615660845819875721_f64;
+    pub const FRAC_PI_4: f64 = 0.785398163397448309615660845819875721_f64;
 
     /// pi/6.0
-    pub static FRAC_PI_6: f64 = 0.52359877559829887307710723054658381_f64;
+    pub const FRAC_PI_6: f64 = 0.52359877559829887307710723054658381_f64;
 
     /// pi/8.0
-    pub static FRAC_PI_8: f64 = 0.39269908169872415480783042290993786_f64;
+    pub const FRAC_PI_8: f64 = 0.39269908169872415480783042290993786_f64;
 
     /// 1.0/pi
-    pub static FRAC_1_PI: f64 = 0.318309886183790671537767526745028724_f64;
+    pub const FRAC_1_PI: f64 = 0.318309886183790671537767526745028724_f64;
 
     /// 2.0/pi
-    pub static FRAC_2_PI: f64 = 0.636619772367581343075535053490057448_f64;
+    pub const FRAC_2_PI: f64 = 0.636619772367581343075535053490057448_f64;
 
     /// 2.0/sqrt(pi)
-    pub static FRAC_2_SQRTPI: f64 = 1.12837916709551257389615890312154517_f64;
+    pub const FRAC_2_SQRTPI: f64 = 1.12837916709551257389615890312154517_f64;
 
     /// sqrt(2.0)
-    pub static SQRT2: f64 = 1.41421356237309504880168872420969808_f64;
+    pub const SQRT2: f64 = 1.41421356237309504880168872420969808_f64;
 
     /// 1.0/sqrt(2.0)
-    pub static FRAC_1_SQRT2: f64 = 0.707106781186547524400844362104849039_f64;
+    pub const FRAC_1_SQRT2: f64 = 0.707106781186547524400844362104849039_f64;
 
     /// Euler's number
-    pub static E: f64 = 2.71828182845904523536028747135266250_f64;
+    pub const E: f64 = 2.71828182845904523536028747135266250_f64;
 
     /// log2(e)
-    pub static LOG2_E: f64 = 1.44269504088896340735992468100189214_f64;
+    pub const LOG2_E: f64 = 1.44269504088896340735992468100189214_f64;
 
     /// log10(e)
-    pub static LOG10_E: f64 = 0.434294481903251827651128918916605082_f64;
+    pub const LOG10_E: f64 = 0.434294481903251827651128918916605082_f64;
 
     /// ln(2.0)
-    pub static LN_2: f64 = 0.693147180559945309417232121458176568_f64;
+    pub const LN_2: f64 = 0.693147180559945309417232121458176568_f64;
 
     /// ln(10.0)
-    pub static LN_10: f64 = 2.30258509299404568401799145468436421_f64;
+    pub const LN_10: f64 = 2.30258509299404568401799145468436421_f64;
 }
 
 impl Float for f64 {
@@ -149,8 +149,8 @@ impl Float for f64 {
     /// is going to be tested, it is generally faster to use the specific
     /// predicate instead.
     fn classify(self) -> FPCategory {
-        static EXP_MASK: u64 = 0x7ff0000000000000;
-        static MAN_MASK: u64 = 0x000fffffffffffff;
+        const EXP_MASK: u64 = 0x7ff0000000000000;
+        const MAN_MASK: u64 = 0x000fffffffffffff;
 
         let bits: u64 = unsafe { mem::transmute(self) };
         match (bits & MAN_MASK, bits & EXP_MASK) {
diff --git a/src/libcore/num/int_macros.rs b/src/libcore/num/int_macros.rs
index ff0494725f849..0f8950344c8a0 100644
--- a/src/libcore/num/int_macros.rs
+++ b/src/libcore/num/int_macros.rs
@@ -16,20 +16,20 @@ macro_rules! int_module (($T:ty, $bits:expr) => (
 // FIXME(#11621): Should be deprecated once CTFE is implemented in favour of
 // calling the `mem::size_of` function.
 #[unstable]
-pub static BITS : uint = $bits;
+pub const BITS : uint = $bits;
 // FIXME(#11621): Should be deprecated once CTFE is implemented in favour of
 // calling the `mem::size_of` function.
 #[unstable]
-pub static BYTES : uint = ($bits / 8);
+pub const BYTES : uint = ($bits / 8);
 
 // FIXME(#11621): Should be deprecated once CTFE is implemented in favour of
 // calling the `Bounded::min_value` function.
 #[unstable]
-pub static MIN: $T = (-1 as $T) << (BITS - 1);
+pub const MIN: $T = (-1 as $T) << (BITS - 1);
 // FIXME(#9837): Compute MIN like this so the high bits that shouldn't exist are 0.
 // FIXME(#11621): Should be deprecated once CTFE is implemented in favour of
 // calling the `Bounded::max_value` function.
 #[unstable]
-pub static MAX: $T = !MIN;
+pub const MAX: $T = !MIN;
 
 ))
diff --git a/src/libcore/num/uint_macros.rs b/src/libcore/num/uint_macros.rs
index b0c570af04ac0..2a94f851646c4 100644
--- a/src/libcore/num/uint_macros.rs
+++ b/src/libcore/num/uint_macros.rs
@@ -14,13 +14,13 @@
 macro_rules! uint_module (($T:ty, $T_SIGNED:ty, $bits:expr) => (
 
 #[unstable]
-pub static BITS : uint = $bits;
+pub const BITS : uint = $bits;
 #[unstable]
-pub static BYTES : uint = ($bits / 8);
+pub const BYTES : uint = ($bits / 8);
 
 #[unstable]
-pub static MIN: $T = 0 as $T;
+pub const MIN: $T = 0 as $T;
 #[unstable]
-pub static MAX: $T = 0 as $T - 1 as $T;
+pub const MAX: $T = 0 as $T - 1 as $T;
 
 ))
diff --git a/src/libcore/str.rs b/src/libcore/str.rs
index 6099af0e78fb6..1cbe955274b65 100644
--- a/src/libcore/str.rs
+++ b/src/libcore/str.rs
@@ -1049,9 +1049,9 @@ pub struct CharRange {
 }
 
 /// Mask of the value bits of a continuation byte
-static CONT_MASK: u8 = 0b0011_1111u8;
+const CONT_MASK: u8 = 0b0011_1111u8;
 /// Value of the tag bits (tag mask is !CONT_MASK) of a continuation byte
-static TAG_CONT_U8: u8 = 0b1000_0000u8;
+const TAG_CONT_U8: u8 = 0b1000_0000u8;
 
 /// Unsafe operations
 pub mod raw {
diff --git a/src/liblibc/lib.rs b/src/liblibc/lib.rs
index affa452eb49de..90416045b5cc8 100644
--- a/src/liblibc/lib.rs
+++ b/src/liblibc/lib.rs
@@ -2003,108 +2003,108 @@ pub mod consts {
         pub mod c95 {
             use types::os::arch::c95::{c_int, c_uint};
 
-            pub static EXIT_FAILURE : c_int = 1;
-            pub static EXIT_SUCCESS : c_int = 0;
-            pub static RAND_MAX : c_int = 32767;
-            pub static EOF : c_int = -1;
-            pub static SEEK_SET : c_int = 0;
-            pub static SEEK_CUR : c_int = 1;
-            pub static SEEK_END : c_int = 2;
-            pub static _IOFBF : c_int = 0;
-            pub static _IONBF : c_int = 4;
-            pub static _IOLBF : c_int = 64;
-            pub static BUFSIZ : c_uint = 512_u32;
-            pub static FOPEN_MAX : c_uint = 20_u32;
-            pub static FILENAME_MAX : c_uint = 260_u32;
-            pub static L_tmpnam : c_uint = 16_u32;
-            pub static TMP_MAX : c_uint = 32767_u32;
-
-            pub static WSAEINTR: c_int = 10004;
-            pub static WSAEBADF: c_int = 10009;
-            pub static WSAEACCES: c_int = 10013;
-            pub static WSAEFAULT: c_int = 10014;
-            pub static WSAEINVAL: c_int = 10022;
-            pub static WSAEMFILE: c_int = 10024;
-            pub static WSAEWOULDBLOCK: c_int = 10035;
-            pub static WSAEINPROGRESS: c_int = 10036;
-            pub static WSAEALREADY: c_int = 10037;
-            pub static WSAENOTSOCK: c_int = 10038;
-            pub static WSAEDESTADDRREQ: c_int = 10039;
-            pub static WSAEMSGSIZE: c_int = 10040;
-            pub static WSAEPROTOTYPE: c_int = 10041;
-            pub static WSAENOPROTOOPT: c_int = 10042;
-            pub static WSAEPROTONOSUPPORT: c_int = 10043;
-            pub static WSAESOCKTNOSUPPORT: c_int = 10044;
-            pub static WSAEOPNOTSUPP: c_int = 10045;
-            pub static WSAEPFNOSUPPORT: c_int = 10046;
-            pub static WSAEAFNOSUPPORT: c_int = 10047;
-            pub static WSAEADDRINUSE: c_int = 10048;
-            pub static WSAEADDRNOTAVAIL: c_int = 10049;
-            pub static WSAENETDOWN: c_int = 10050;
-            pub static WSAENETUNREACH: c_int = 10051;
-            pub static WSAENETRESET: c_int = 10052;
-            pub static WSAECONNABORTED: c_int = 10053;
-            pub static WSAECONNRESET: c_int = 10054;
-            pub static WSAENOBUFS: c_int = 10055;
-            pub static WSAEISCONN: c_int = 10056;
-            pub static WSAENOTCONN: c_int = 10057;
-            pub static WSAESHUTDOWN: c_int = 10058;
-            pub static WSAETOOMANYREFS: c_int = 10059;
-            pub static WSAETIMEDOUT: c_int = 10060;
-            pub static WSAECONNREFUSED: c_int = 10061;
-            pub static WSAELOOP: c_int = 10062;
-            pub static WSAENAMETOOLONG: c_int = 10063;
-            pub static WSAEHOSTDOWN: c_int = 10064;
-            pub static WSAEHOSTUNREACH: c_int = 10065;
-            pub static WSAENOTEMPTY: c_int = 10066;
-            pub static WSAEPROCLIM: c_int = 10067;
-            pub static WSAEUSERS: c_int = 10068;
-            pub static WSAEDQUOT: c_int = 10069;
-            pub static WSAESTALE: c_int = 10070;
-            pub static WSAEREMOTE: c_int = 10071;
-            pub static WSASYSNOTREADY: c_int = 10091;
-            pub static WSAVERNOTSUPPORTED: c_int = 10092;
-            pub static WSANOTINITIALISED: c_int = 10093;
-            pub static WSAEDISCON: c_int = 10101;
-            pub static WSAENOMORE: c_int = 10102;
-            pub static WSAECANCELLED: c_int = 10103;
-            pub static WSAEINVALIDPROCTABLE: c_int = 10104;
-            pub static WSAEINVALIDPROVIDER: c_int = 10105;
-            pub static WSAEPROVIDERFAILEDINIT: c_int = 10106;
+            pub const EXIT_FAILURE : c_int = 1;
+            pub const EXIT_SUCCESS : c_int = 0;
+            pub const RAND_MAX : c_int = 32767;
+            pub const EOF : c_int = -1;
+            pub const SEEK_SET : c_int = 0;
+            pub const SEEK_CUR : c_int = 1;
+            pub const SEEK_END : c_int = 2;
+            pub const _IOFBF : c_int = 0;
+            pub const _IONBF : c_int = 4;
+            pub const _IOLBF : c_int = 64;
+            pub const BUFSIZ : c_uint = 512_u32;
+            pub const FOPEN_MAX : c_uint = 20_u32;
+            pub const FILENAME_MAX : c_uint = 260_u32;
+            pub const L_tmpnam : c_uint = 16_u32;
+            pub const TMP_MAX : c_uint = 32767_u32;
+
+            pub const WSAEINTR: c_int = 10004;
+            pub const WSAEBADF: c_int = 10009;
+            pub const WSAEACCES: c_int = 10013;
+            pub const WSAEFAULT: c_int = 10014;
+            pub const WSAEINVAL: c_int = 10022;
+            pub const WSAEMFILE: c_int = 10024;
+            pub const WSAEWOULDBLOCK: c_int = 10035;
+            pub const WSAEINPROGRESS: c_int = 10036;
+            pub const WSAEALREADY: c_int = 10037;
+            pub const WSAENOTSOCK: c_int = 10038;
+            pub const WSAEDESTADDRREQ: c_int = 10039;
+            pub const WSAEMSGSIZE: c_int = 10040;
+            pub const WSAEPROTOTYPE: c_int = 10041;
+            pub const WSAENOPROTOOPT: c_int = 10042;
+            pub const WSAEPROTONOSUPPORT: c_int = 10043;
+            pub const WSAESOCKTNOSUPPORT: c_int = 10044;
+            pub const WSAEOPNOTSUPP: c_int = 10045;
+            pub const WSAEPFNOSUPPORT: c_int = 10046;
+            pub const WSAEAFNOSUPPORT: c_int = 10047;
+            pub const WSAEADDRINUSE: c_int = 10048;
+            pub const WSAEADDRNOTAVAIL: c_int = 10049;
+            pub const WSAENETDOWN: c_int = 10050;
+            pub const WSAENETUNREACH: c_int = 10051;
+            pub const WSAENETRESET: c_int = 10052;
+            pub const WSAECONNABORTED: c_int = 10053;
+            pub const WSAECONNRESET: c_int = 10054;
+            pub const WSAENOBUFS: c_int = 10055;
+            pub const WSAEISCONN: c_int = 10056;
+            pub const WSAENOTCONN: c_int = 10057;
+            pub const WSAESHUTDOWN: c_int = 10058;
+            pub const WSAETOOMANYREFS: c_int = 10059;
+            pub const WSAETIMEDOUT: c_int = 10060;
+            pub const WSAECONNREFUSED: c_int = 10061;
+            pub const WSAELOOP: c_int = 10062;
+            pub const WSAENAMETOOLONG: c_int = 10063;
+            pub const WSAEHOSTDOWN: c_int = 10064;
+            pub const WSAEHOSTUNREACH: c_int = 10065;
+            pub const WSAENOTEMPTY: c_int = 10066;
+            pub const WSAEPROCLIM: c_int = 10067;
+            pub const WSAEUSERS: c_int = 10068;
+            pub const WSAEDQUOT: c_int = 10069;
+            pub const WSAESTALE: c_int = 10070;
+            pub const WSAEREMOTE: c_int = 10071;
+            pub const WSASYSNOTREADY: c_int = 10091;
+            pub const WSAVERNOTSUPPORTED: c_int = 10092;
+            pub const WSANOTINITIALISED: c_int = 10093;
+            pub const WSAEDISCON: c_int = 10101;
+            pub const WSAENOMORE: c_int = 10102;
+            pub const WSAECANCELLED: c_int = 10103;
+            pub const WSAEINVALIDPROCTABLE: c_int = 10104;
+            pub const WSAEINVALIDPROVIDER: c_int = 10105;
+            pub const WSAEPROVIDERFAILEDINIT: c_int = 10106;
         }
         pub mod c99 {
         }
         pub mod posix88 {
             use types::os::arch::c95::c_int;
 
-            pub static O_RDONLY : c_int = 0;
-            pub static O_WRONLY : c_int = 1;
-            pub static O_RDWR : c_int = 2;
-            pub static O_APPEND : c_int = 8;
-            pub static O_CREAT : c_int = 256;
-            pub static O_EXCL : c_int = 1024;
-            pub static O_TRUNC : c_int = 512;
-            pub static S_IFIFO : c_int = 4096;
-            pub static S_IFCHR : c_int = 8192;
-            pub static S_IFBLK : c_int = 12288;
-            pub static S_IFDIR : c_int = 16384;
-            pub static S_IFREG : c_int = 32768;
-            pub static S_IFLNK : c_int = 40960;
-            pub static S_IFMT : c_int = 61440;
-            pub static S_IEXEC : c_int = 64;
-            pub static S_IWRITE : c_int = 128;
-            pub static S_IREAD : c_int = 256;
-            pub static S_IRWXU : c_int = 448;
-            pub static S_IXUSR : c_int = 64;
-            pub static S_IWUSR : c_int = 128;
-            pub static S_IRUSR : c_int = 256;
-            pub static F_OK : c_int = 0;
-            pub static R_OK : c_int = 4;
-            pub static W_OK : c_int = 2;
-            pub static X_OK : c_int = 1;
-            pub static STDIN_FILENO : c_int = 0;
-            pub static STDOUT_FILENO : c_int = 1;
-            pub static STDERR_FILENO : c_int = 2;
+            pub const O_RDONLY : c_int = 0;
+            pub const O_WRONLY : c_int = 1;
+            pub const O_RDWR : c_int = 2;
+            pub const O_APPEND : c_int = 8;
+            pub const O_CREAT : c_int = 256;
+            pub const O_EXCL : c_int = 1024;
+            pub const O_TRUNC : c_int = 512;
+            pub const S_IFIFO : c_int = 4096;
+            pub const S_IFCHR : c_int = 8192;
+            pub const S_IFBLK : c_int = 12288;
+            pub const S_IFDIR : c_int = 16384;
+            pub const S_IFREG : c_int = 32768;
+            pub const S_IFLNK : c_int = 40960;
+            pub const S_IFMT : c_int = 61440;
+            pub const S_IEXEC : c_int = 64;
+            pub const S_IWRITE : c_int = 128;
+            pub const S_IREAD : c_int = 256;
+            pub const S_IRWXU : c_int = 448;
+            pub const S_IXUSR : c_int = 64;
+            pub const S_IWUSR : c_int = 128;
+            pub const S_IRUSR : c_int = 256;
+            pub const F_OK : c_int = 0;
+            pub const R_OK : c_int = 4;
+            pub const W_OK : c_int = 2;
+            pub const X_OK : c_int = 1;
+            pub const STDIN_FILENO : c_int = 0;
+            pub const STDOUT_FILENO : c_int = 1;
+            pub const STDERR_FILENO : c_int = 2;
         }
         pub mod posix01 {
         }
@@ -2113,265 +2113,265 @@ pub mod consts {
         pub mod bsd44 {
             use types::os::arch::c95::c_int;
 
-            pub static AF_INET: c_int = 2;
-            pub static AF_INET6: c_int = 23;
-            pub static SOCK_STREAM: c_int = 1;
-            pub static SOCK_DGRAM: c_int = 2;
-            pub static SOCK_RAW: c_int = 3;
-            pub static IPPROTO_TCP: c_int = 6;
-            pub static IPPROTO_IP: c_int = 0;
-            pub static IPPROTO_IPV6: c_int = 41;
-            pub static IP_MULTICAST_TTL: c_int = 3;
-            pub static IP_MULTICAST_LOOP: c_int = 4;
-            pub static IP_ADD_MEMBERSHIP: c_int = 5;
-            pub static IP_DROP_MEMBERSHIP: c_int = 6;
-            pub static IPV6_ADD_MEMBERSHIP: c_int = 5;
-            pub static IPV6_DROP_MEMBERSHIP: c_int = 6;
-            pub static IP_TTL: c_int = 4;
-            pub static IP_HDRINCL: c_int = 2;
-
-            pub static TCP_NODELAY: c_int = 0x0001;
-            pub static SOL_SOCKET: c_int = 0xffff;
-            pub static SO_KEEPALIVE: c_int = 8;
-            pub static SO_BROADCAST: c_int = 32;
-            pub static SO_REUSEADDR: c_int = 4;
-            pub static SO_ERROR: c_int = 0x1007;
-
-            pub static IFF_LOOPBACK: c_int = 4;
-
-            pub static SHUT_RD: c_int = 0;
-            pub static SHUT_WR: c_int = 1;
-            pub static SHUT_RDWR: c_int = 2;
+            pub const AF_INET: c_int = 2;
+            pub const AF_INET6: c_int = 23;
+            pub const SOCK_STREAM: c_int = 1;
+            pub const SOCK_DGRAM: c_int = 2;
+            pub const SOCK_RAW: c_int = 3;
+            pub const IPPROTO_TCP: c_int = 6;
+            pub const IPPROTO_IP: c_int = 0;
+            pub const IPPROTO_IPV6: c_int = 41;
+            pub const IP_MULTICAST_TTL: c_int = 3;
+            pub const IP_MULTICAST_LOOP: c_int = 4;
+            pub const IP_ADD_MEMBERSHIP: c_int = 5;
+            pub const IP_DROP_MEMBERSHIP: c_int = 6;
+            pub const IPV6_ADD_MEMBERSHIP: c_int = 5;
+            pub const IPV6_DROP_MEMBERSHIP: c_int = 6;
+            pub const IP_TTL: c_int = 4;
+            pub const IP_HDRINCL: c_int = 2;
+
+            pub const TCP_NODELAY: c_int = 0x0001;
+            pub const SOL_SOCKET: c_int = 0xffff;
+            pub const SO_KEEPALIVE: c_int = 8;
+            pub const SO_BROADCAST: c_int = 32;
+            pub const SO_REUSEADDR: c_int = 4;
+            pub const SO_ERROR: c_int = 0x1007;
+
+            pub const IFF_LOOPBACK: c_int = 4;
+
+            pub const SHUT_RD: c_int = 0;
+            pub const SHUT_WR: c_int = 1;
+            pub const SHUT_RDWR: c_int = 2;
         }
         pub mod extra {
             use types::os::arch::c95::{c_int, c_long};
             use types::os::arch::extra::{WORD, DWORD, BOOL, HANDLE};
 
-            pub static TRUE : BOOL = 1;
-            pub static FALSE : BOOL = 0;
-
-            pub static O_TEXT : c_int = 16384;
-            pub static O_BINARY : c_int = 32768;
-            pub static O_NOINHERIT: c_int = 128;
-
-            pub static ERROR_SUCCESS : c_int = 0;
-            pub static ERROR_INVALID_FUNCTION: c_int = 1;
-            pub static ERROR_FILE_NOT_FOUND: c_int = 2;
-            pub static ERROR_ACCESS_DENIED: c_int = 5;
-            pub static ERROR_INVALID_HANDLE : c_int = 6;
-            pub static ERROR_BROKEN_PIPE: c_int = 109;
-            pub static ERROR_DISK_FULL : c_int = 112;
-            pub static ERROR_CALL_NOT_IMPLEMENTED : c_int = 120;
-            pub static ERROR_INSUFFICIENT_BUFFER : c_int = 122;
-            pub static ERROR_INVALID_NAME : c_int = 123;
-            pub static ERROR_ALREADY_EXISTS : c_int = 183;
-            pub static ERROR_PIPE_BUSY: c_int = 231;
-            pub static ERROR_NO_DATA: c_int = 232;
-            pub static ERROR_INVALID_ADDRESS : c_int = 487;
-            pub static ERROR_PIPE_CONNECTED: c_int = 535;
-            pub static ERROR_NOTHING_TO_TERMINATE: c_int = 758;
-            pub static ERROR_OPERATION_ABORTED: c_int = 995;
-            pub static ERROR_IO_PENDING: c_int = 997;
-            pub static ERROR_FILE_INVALID : c_int = 1006;
-            pub static ERROR_NOT_FOUND: c_int = 1168;
-            pub static INVALID_HANDLE_VALUE: HANDLE = -1 as HANDLE;
-
-            pub static DELETE : DWORD = 0x00010000;
-            pub static READ_CONTROL : DWORD = 0x00020000;
-            pub static SYNCHRONIZE : DWORD = 0x00100000;
-            pub static WRITE_DAC : DWORD = 0x00040000;
-            pub static WRITE_OWNER : DWORD = 0x00080000;
-
-            pub static PROCESS_CREATE_PROCESS : DWORD = 0x0080;
-            pub static PROCESS_CREATE_THREAD : DWORD = 0x0002;
-            pub static PROCESS_DUP_HANDLE : DWORD = 0x0040;
-            pub static PROCESS_QUERY_INFORMATION : DWORD = 0x0400;
-            pub static PROCESS_QUERY_LIMITED_INFORMATION : DWORD = 0x1000;
-            pub static PROCESS_SET_INFORMATION : DWORD = 0x0200;
-            pub static PROCESS_SET_QUOTA : DWORD = 0x0100;
-            pub static PROCESS_SUSPEND_RESUME : DWORD = 0x0800;
-            pub static PROCESS_TERMINATE : DWORD = 0x0001;
-            pub static PROCESS_VM_OPERATION : DWORD = 0x0008;
-            pub static PROCESS_VM_READ : DWORD = 0x0010;
-            pub static PROCESS_VM_WRITE : DWORD = 0x0020;
-
-            pub static STARTF_FORCEONFEEDBACK : DWORD = 0x00000040;
-            pub static STARTF_FORCEOFFFEEDBACK : DWORD = 0x00000080;
-            pub static STARTF_PREVENTPINNING : DWORD = 0x00002000;
-            pub static STARTF_RUNFULLSCREEN : DWORD = 0x00000020;
-            pub static STARTF_TITLEISAPPID : DWORD = 0x00001000;
-            pub static STARTF_TITLEISLINKNAME : DWORD = 0x00000800;
-            pub static STARTF_USECOUNTCHARS : DWORD = 0x00000008;
-            pub static STARTF_USEFILLATTRIBUTE : DWORD = 0x00000010;
-            pub static STARTF_USEHOTKEY : DWORD = 0x00000200;
-            pub static STARTF_USEPOSITION : DWORD = 0x00000004;
-            pub static STARTF_USESHOWWINDOW : DWORD = 0x00000001;
-            pub static STARTF_USESIZE : DWORD = 0x00000002;
-            pub static STARTF_USESTDHANDLES : DWORD = 0x00000100;
-
-            pub static WAIT_ABANDONED : DWORD = 0x00000080;
-            pub static WAIT_OBJECT_0 : DWORD = 0x00000000;
-            pub static WAIT_TIMEOUT : DWORD = 0x00000102;
-            pub static WAIT_FAILED : DWORD = -1;
-
-            pub static DUPLICATE_CLOSE_SOURCE : DWORD = 0x00000001;
-            pub static DUPLICATE_SAME_ACCESS : DWORD = 0x00000002;
-
-            pub static INFINITE : DWORD = -1;
-            pub static STILL_ACTIVE : DWORD = 259;
-
-            pub static MEM_COMMIT : DWORD = 0x00001000;
-            pub static MEM_RESERVE : DWORD = 0x00002000;
-            pub static MEM_DECOMMIT : DWORD = 0x00004000;
-            pub static MEM_RELEASE : DWORD = 0x00008000;
-            pub static MEM_RESET : DWORD = 0x00080000;
-            pub static MEM_RESET_UNDO : DWORD = 0x1000000;
-            pub static MEM_LARGE_PAGES : DWORD = 0x20000000;
-            pub static MEM_PHYSICAL : DWORD = 0x00400000;
-            pub static MEM_TOP_DOWN : DWORD = 0x00100000;
-            pub static MEM_WRITE_WATCH : DWORD = 0x00200000;
-
-            pub static PAGE_EXECUTE : DWORD = 0x10;
-            pub static PAGE_EXECUTE_READ : DWORD = 0x20;
-            pub static PAGE_EXECUTE_READWRITE : DWORD = 0x40;
-            pub static PAGE_EXECUTE_WRITECOPY : DWORD = 0x80;
-            pub static PAGE_NOACCESS : DWORD = 0x01;
-            pub static PAGE_READONLY : DWORD = 0x02;
-            pub static PAGE_READWRITE : DWORD = 0x04;
-            pub static PAGE_WRITECOPY : DWORD = 0x08;
-            pub static PAGE_GUARD : DWORD = 0x100;
-            pub static PAGE_NOCACHE : DWORD = 0x200;
-            pub static PAGE_WRITECOMBINE : DWORD = 0x400;
-
-            pub static SEC_COMMIT : DWORD = 0x8000000;
-            pub static SEC_IMAGE : DWORD = 0x1000000;
-            pub static SEC_IMAGE_NO_EXECUTE : DWORD = 0x11000000;
-            pub static SEC_LARGE_PAGES : DWORD = 0x80000000;
-            pub static SEC_NOCACHE : DWORD = 0x10000000;
-            pub static SEC_RESERVE : DWORD = 0x4000000;
-            pub static SEC_WRITECOMBINE : DWORD = 0x40000000;
-
-            pub static FILE_MAP_ALL_ACCESS : DWORD = 0xf001f;
-            pub static FILE_MAP_READ : DWORD = 0x4;
-            pub static FILE_MAP_WRITE : DWORD = 0x2;
-            pub static FILE_MAP_COPY : DWORD = 0x1;
-            pub static FILE_MAP_EXECUTE : DWORD = 0x20;
-
-            pub static PROCESSOR_ARCHITECTURE_INTEL : WORD = 0;
-            pub static PROCESSOR_ARCHITECTURE_ARM : WORD = 5;
-            pub static PROCESSOR_ARCHITECTURE_IA64 : WORD = 6;
-            pub static PROCESSOR_ARCHITECTURE_AMD64 : WORD = 9;
-            pub static PROCESSOR_ARCHITECTURE_UNKNOWN : WORD = 0xffff;
-
-            pub static MOVEFILE_COPY_ALLOWED: DWORD = 2;
-            pub static MOVEFILE_CREATE_HARDLINK: DWORD = 16;
-            pub static MOVEFILE_DELAY_UNTIL_REBOOT: DWORD = 4;
-            pub static MOVEFILE_FAIL_IF_NOT_TRACKABLE: DWORD = 32;
-            pub static MOVEFILE_REPLACE_EXISTING: DWORD = 1;
-            pub static MOVEFILE_WRITE_THROUGH: DWORD = 8;
-
-            pub static SYMBOLIC_LINK_FLAG_DIRECTORY: DWORD = 1;
-
-            pub static FILE_SHARE_DELETE: DWORD = 0x4;
-            pub static FILE_SHARE_READ: DWORD = 0x1;
-            pub static FILE_SHARE_WRITE: DWORD = 0x2;
-
-            pub static CREATE_ALWAYS: DWORD = 2;
-            pub static CREATE_NEW: DWORD = 1;
-            pub static OPEN_ALWAYS: DWORD = 4;
-            pub static OPEN_EXISTING: DWORD = 3;
-            pub static TRUNCATE_EXISTING: DWORD = 5;
-
-            pub static FILE_APPEND_DATA: DWORD = 0x00000004;
-            pub static FILE_READ_DATA: DWORD = 0x00000001;
-            pub static FILE_WRITE_DATA: DWORD = 0x00000002;
-
-            pub static FILE_ATTRIBUTE_ARCHIVE: DWORD = 0x20;
-            pub static FILE_ATTRIBUTE_COMPRESSED: DWORD = 0x800;
-            pub static FILE_ATTRIBUTE_DEVICE: DWORD = 0x40;
-            pub static FILE_ATTRIBUTE_DIRECTORY: DWORD = 0x10;
-            pub static FILE_ATTRIBUTE_ENCRYPTED: DWORD = 0x4000;
-            pub static FILE_ATTRIBUTE_HIDDEN: DWORD = 0x2;
-            pub static FILE_ATTRIBUTE_INTEGRITY_STREAM: DWORD = 0x8000;
-            pub static FILE_ATTRIBUTE_NORMAL: DWORD = 0x80;
-            pub static FILE_ATTRIBUTE_NOT_CONTENT_INDEXED: DWORD = 0x2000;
-            pub static FILE_ATTRIBUTE_NO_SCRUB_DATA: DWORD = 0x20000;
-            pub static FILE_ATTRIBUTE_OFFLINE: DWORD = 0x1000;
-            pub static FILE_ATTRIBUTE_READONLY: DWORD = 0x1;
-            pub static FILE_ATTRIBUTE_REPARSE_POINT: DWORD = 0x400;
-            pub static FILE_ATTRIBUTE_SPARSE_FILE: DWORD = 0x200;
-            pub static FILE_ATTRIBUTE_SYSTEM: DWORD = 0x4;
-            pub static FILE_ATTRIBUTE_TEMPORARY: DWORD = 0x100;
-            pub static FILE_ATTRIBUTE_VIRTUAL: DWORD = 0x10000;
-
-            pub static FILE_FLAG_BACKUP_SEMANTICS: DWORD = 0x02000000;
-            pub static FILE_FLAG_DELETE_ON_CLOSE: DWORD = 0x04000000;
-            pub static FILE_FLAG_NO_BUFFERING: DWORD = 0x20000000;
-            pub static FILE_FLAG_OPEN_NO_RECALL: DWORD = 0x00100000;
-            pub static FILE_FLAG_OPEN_REPARSE_POINT: DWORD = 0x00200000;
-            pub static FILE_FLAG_OVERLAPPED: DWORD = 0x40000000;
-            pub static FILE_FLAG_POSIX_SEMANTICS: DWORD = 0x0100000;
-            pub static FILE_FLAG_RANDOM_ACCESS: DWORD = 0x10000000;
-            pub static FILE_FLAG_SESSION_AWARE: DWORD = 0x00800000;
-            pub static FILE_FLAG_SEQUENTIAL_SCAN: DWORD = 0x08000000;
-            pub static FILE_FLAG_WRITE_THROUGH: DWORD = 0x80000000;
-            pub static FILE_FLAG_FIRST_PIPE_INSTANCE: DWORD = 0x00080000;
-
-            pub static FILE_NAME_NORMALIZED: DWORD = 0x0;
-            pub static FILE_NAME_OPENED: DWORD = 0x8;
-
-            pub static VOLUME_NAME_DOS: DWORD = 0x0;
-            pub static VOLUME_NAME_GUID: DWORD = 0x1;
-            pub static VOLUME_NAME_NONE: DWORD = 0x4;
-            pub static VOLUME_NAME_NT: DWORD = 0x2;
-
-            pub static GENERIC_READ: DWORD = 0x80000000;
-            pub static GENERIC_WRITE: DWORD = 0x40000000;
-            pub static GENERIC_EXECUTE: DWORD = 0x20000000;
-            pub static GENERIC_ALL: DWORD = 0x10000000;
-            pub static FILE_WRITE_ATTRIBUTES: DWORD = 0x00000100;
-            pub static FILE_READ_ATTRIBUTES: DWORD = 0x00000080;
-
-            pub static STANDARD_RIGHTS_READ: DWORD = 0x20000;
-            pub static STANDARD_RIGHTS_WRITE: DWORD = 0x20000;
-            pub static FILE_WRITE_EA: DWORD = 0x00000010;
-            pub static FILE_READ_EA: DWORD = 0x00000008;
-            pub static FILE_GENERIC_READ: DWORD =
+            pub const TRUE : BOOL = 1;
+            pub const FALSE : BOOL = 0;
+
+            pub const O_TEXT : c_int = 16384;
+            pub const O_BINARY : c_int = 32768;
+            pub const O_NOINHERIT: c_int = 128;
+
+            pub const ERROR_SUCCESS : c_int = 0;
+            pub const ERROR_INVALID_FUNCTION: c_int = 1;
+            pub const ERROR_FILE_NOT_FOUND: c_int = 2;
+            pub const ERROR_ACCESS_DENIED: c_int = 5;
+            pub const ERROR_INVALID_HANDLE : c_int = 6;
+            pub const ERROR_BROKEN_PIPE: c_int = 109;
+            pub const ERROR_DISK_FULL : c_int = 112;
+            pub const ERROR_CALL_NOT_IMPLEMENTED : c_int = 120;
+            pub const ERROR_INSUFFICIENT_BUFFER : c_int = 122;
+            pub const ERROR_INVALID_NAME : c_int = 123;
+            pub const ERROR_ALREADY_EXISTS : c_int = 183;
+            pub const ERROR_PIPE_BUSY: c_int = 231;
+            pub const ERROR_NO_DATA: c_int = 232;
+            pub const ERROR_INVALID_ADDRESS : c_int = 487;
+            pub const ERROR_PIPE_CONNECTED: c_int = 535;
+            pub const ERROR_NOTHING_TO_TERMINATE: c_int = 758;
+            pub const ERROR_OPERATION_ABORTED: c_int = 995;
+            pub const ERROR_IO_PENDING: c_int = 997;
+            pub const ERROR_FILE_INVALID : c_int = 1006;
+            pub const ERROR_NOT_FOUND: c_int = 1168;
+            pub const INVALID_HANDLE_VALUE: HANDLE = -1 as HANDLE;
+
+            pub const DELETE : DWORD = 0x00010000;
+            pub const READ_CONTROL : DWORD = 0x00020000;
+            pub const SYNCHRONIZE : DWORD = 0x00100000;
+            pub const WRITE_DAC : DWORD = 0x00040000;
+            pub const WRITE_OWNER : DWORD = 0x00080000;
+
+            pub const PROCESS_CREATE_PROCESS : DWORD = 0x0080;
+            pub const PROCESS_CREATE_THREAD : DWORD = 0x0002;
+            pub const PROCESS_DUP_HANDLE : DWORD = 0x0040;
+            pub const PROCESS_QUERY_INFORMATION : DWORD = 0x0400;
+            pub const PROCESS_QUERY_LIMITED_INFORMATION : DWORD = 0x1000;
+            pub const PROCESS_SET_INFORMATION : DWORD = 0x0200;
+            pub const PROCESS_SET_QUOTA : DWORD = 0x0100;
+            pub const PROCESS_SUSPEND_RESUME : DWORD = 0x0800;
+            pub const PROCESS_TERMINATE : DWORD = 0x0001;
+            pub const PROCESS_VM_OPERATION : DWORD = 0x0008;
+            pub const PROCESS_VM_READ : DWORD = 0x0010;
+            pub const PROCESS_VM_WRITE : DWORD = 0x0020;
+
+            pub const STARTF_FORCEONFEEDBACK : DWORD = 0x00000040;
+            pub const STARTF_FORCEOFFFEEDBACK : DWORD = 0x00000080;
+            pub const STARTF_PREVENTPINNING : DWORD = 0x00002000;
+            pub const STARTF_RUNFULLSCREEN : DWORD = 0x00000020;
+            pub const STARTF_TITLEISAPPID : DWORD = 0x00001000;
+            pub const STARTF_TITLEISLINKNAME : DWORD = 0x00000800;
+            pub const STARTF_USECOUNTCHARS : DWORD = 0x00000008;
+            pub const STARTF_USEFILLATTRIBUTE : DWORD = 0x00000010;
+            pub const STARTF_USEHOTKEY : DWORD = 0x00000200;
+            pub const STARTF_USEPOSITION : DWORD = 0x00000004;
+            pub const STARTF_USESHOWWINDOW : DWORD = 0x00000001;
+            pub const STARTF_USESIZE : DWORD = 0x00000002;
+            pub const STARTF_USESTDHANDLES : DWORD = 0x00000100;
+
+            pub const WAIT_ABANDONED : DWORD = 0x00000080;
+            pub const WAIT_OBJECT_0 : DWORD = 0x00000000;
+            pub const WAIT_TIMEOUT : DWORD = 0x00000102;
+            pub const WAIT_FAILED : DWORD = -1;
+
+            pub const DUPLICATE_CLOSE_SOURCE : DWORD = 0x00000001;
+            pub const DUPLICATE_SAME_ACCESS : DWORD = 0x00000002;
+
+            pub const INFINITE : DWORD = -1;
+            pub const STILL_ACTIVE : DWORD = 259;
+
+            pub const MEM_COMMIT : DWORD = 0x00001000;
+            pub const MEM_RESERVE : DWORD = 0x00002000;
+            pub const MEM_DECOMMIT : DWORD = 0x00004000;
+            pub const MEM_RELEASE : DWORD = 0x00008000;
+            pub const MEM_RESET : DWORD = 0x00080000;
+            pub const MEM_RESET_UNDO : DWORD = 0x1000000;
+            pub const MEM_LARGE_PAGES : DWORD = 0x20000000;
+            pub const MEM_PHYSICAL : DWORD = 0x00400000;
+            pub const MEM_TOP_DOWN : DWORD = 0x00100000;
+            pub const MEM_WRITE_WATCH : DWORD = 0x00200000;
+
+            pub const PAGE_EXECUTE : DWORD = 0x10;
+            pub const PAGE_EXECUTE_READ : DWORD = 0x20;
+            pub const PAGE_EXECUTE_READWRITE : DWORD = 0x40;
+            pub const PAGE_EXECUTE_WRITECOPY : DWORD = 0x80;
+            pub const PAGE_NOACCESS : DWORD = 0x01;
+            pub const PAGE_READONLY : DWORD = 0x02;
+            pub const PAGE_READWRITE : DWORD = 0x04;
+            pub const PAGE_WRITECOPY : DWORD = 0x08;
+            pub const PAGE_GUARD : DWORD = 0x100;
+            pub const PAGE_NOCACHE : DWORD = 0x200;
+            pub const PAGE_WRITECOMBINE : DWORD = 0x400;
+
+            pub const SEC_COMMIT : DWORD = 0x8000000;
+            pub const SEC_IMAGE : DWORD = 0x1000000;
+            pub const SEC_IMAGE_NO_EXECUTE : DWORD = 0x11000000;
+            pub const SEC_LARGE_PAGES : DWORD = 0x80000000;
+            pub const SEC_NOCACHE : DWORD = 0x10000000;
+            pub const SEC_RESERVE : DWORD = 0x4000000;
+            pub const SEC_WRITECOMBINE : DWORD = 0x40000000;
+
+            pub const FILE_MAP_ALL_ACCESS : DWORD = 0xf001f;
+            pub const FILE_MAP_READ : DWORD = 0x4;
+            pub const FILE_MAP_WRITE : DWORD = 0x2;
+            pub const FILE_MAP_COPY : DWORD = 0x1;
+            pub const FILE_MAP_EXECUTE : DWORD = 0x20;
+
+            pub const PROCESSOR_ARCHITECTURE_INTEL : WORD = 0;
+            pub const PROCESSOR_ARCHITECTURE_ARM : WORD = 5;
+            pub const PROCESSOR_ARCHITECTURE_IA64 : WORD = 6;
+            pub const PROCESSOR_ARCHITECTURE_AMD64 : WORD = 9;
+            pub const PROCESSOR_ARCHITECTURE_UNKNOWN : WORD = 0xffff;
+
+            pub const MOVEFILE_COPY_ALLOWED: DWORD = 2;
+            pub const MOVEFILE_CREATE_HARDLINK: DWORD = 16;
+            pub const MOVEFILE_DELAY_UNTIL_REBOOT: DWORD = 4;
+            pub const MOVEFILE_FAIL_IF_NOT_TRACKABLE: DWORD = 32;
+            pub const MOVEFILE_REPLACE_EXISTING: DWORD = 1;
+            pub const MOVEFILE_WRITE_THROUGH: DWORD = 8;
+
+            pub const SYMBOLIC_LINK_FLAG_DIRECTORY: DWORD = 1;
+
+            pub const FILE_SHARE_DELETE: DWORD = 0x4;
+            pub const FILE_SHARE_READ: DWORD = 0x1;
+            pub const FILE_SHARE_WRITE: DWORD = 0x2;
+
+            pub const CREATE_ALWAYS: DWORD = 2;
+            pub const CREATE_NEW: DWORD = 1;
+            pub const OPEN_ALWAYS: DWORD = 4;
+            pub const OPEN_EXISTING: DWORD = 3;
+            pub const TRUNCATE_EXISTING: DWORD = 5;
+
+            pub const FILE_APPEND_DATA: DWORD = 0x00000004;
+            pub const FILE_READ_DATA: DWORD = 0x00000001;
+            pub const FILE_WRITE_DATA: DWORD = 0x00000002;
+
+            pub const FILE_ATTRIBUTE_ARCHIVE: DWORD = 0x20;
+            pub const FILE_ATTRIBUTE_COMPRESSED: DWORD = 0x800;
+            pub const FILE_ATTRIBUTE_DEVICE: DWORD = 0x40;
+            pub const FILE_ATTRIBUTE_DIRECTORY: DWORD = 0x10;
+            pub const FILE_ATTRIBUTE_ENCRYPTED: DWORD = 0x4000;
+            pub const FILE_ATTRIBUTE_HIDDEN: DWORD = 0x2;
+            pub const FILE_ATTRIBUTE_INTEGRITY_STREAM: DWORD = 0x8000;
+            pub const FILE_ATTRIBUTE_NORMAL: DWORD = 0x80;
+            pub const FILE_ATTRIBUTE_NOT_CONTENT_INDEXED: DWORD = 0x2000;
+            pub const FILE_ATTRIBUTE_NO_SCRUB_DATA: DWORD = 0x20000;
+            pub const FILE_ATTRIBUTE_OFFLINE: DWORD = 0x1000;
+            pub const FILE_ATTRIBUTE_READONLY: DWORD = 0x1;
+            pub const FILE_ATTRIBUTE_REPARSE_POINT: DWORD = 0x400;
+            pub const FILE_ATTRIBUTE_SPARSE_FILE: DWORD = 0x200;
+            pub const FILE_ATTRIBUTE_SYSTEM: DWORD = 0x4;
+            pub const FILE_ATTRIBUTE_TEMPORARY: DWORD = 0x100;
+            pub const FILE_ATTRIBUTE_VIRTUAL: DWORD = 0x10000;
+
+            pub const FILE_FLAG_BACKUP_SEMANTICS: DWORD = 0x02000000;
+            pub const FILE_FLAG_DELETE_ON_CLOSE: DWORD = 0x04000000;
+            pub const FILE_FLAG_NO_BUFFERING: DWORD = 0x20000000;
+            pub const FILE_FLAG_OPEN_NO_RECALL: DWORD = 0x00100000;
+            pub const FILE_FLAG_OPEN_REPARSE_POINT: DWORD = 0x00200000;
+            pub const FILE_FLAG_OVERLAPPED: DWORD = 0x40000000;
+            pub const FILE_FLAG_POSIX_SEMANTICS: DWORD = 0x0100000;
+            pub const FILE_FLAG_RANDOM_ACCESS: DWORD = 0x10000000;
+            pub const FILE_FLAG_SESSION_AWARE: DWORD = 0x00800000;
+            pub const FILE_FLAG_SEQUENTIAL_SCAN: DWORD = 0x08000000;
+            pub const FILE_FLAG_WRITE_THROUGH: DWORD = 0x80000000;
+            pub const FILE_FLAG_FIRST_PIPE_INSTANCE: DWORD = 0x00080000;
+
+            pub const FILE_NAME_NORMALIZED: DWORD = 0x0;
+            pub const FILE_NAME_OPENED: DWORD = 0x8;
+
+            pub const VOLUME_NAME_DOS: DWORD = 0x0;
+            pub const VOLUME_NAME_GUID: DWORD = 0x1;
+            pub const VOLUME_NAME_NONE: DWORD = 0x4;
+            pub const VOLUME_NAME_NT: DWORD = 0x2;
+
+            pub const GENERIC_READ: DWORD = 0x80000000;
+            pub const GENERIC_WRITE: DWORD = 0x40000000;
+            pub const GENERIC_EXECUTE: DWORD = 0x20000000;
+            pub const GENERIC_ALL: DWORD = 0x10000000;
+            pub const FILE_WRITE_ATTRIBUTES: DWORD = 0x00000100;
+            pub const FILE_READ_ATTRIBUTES: DWORD = 0x00000080;
+
+            pub const STANDARD_RIGHTS_READ: DWORD = 0x20000;
+            pub const STANDARD_RIGHTS_WRITE: DWORD = 0x20000;
+            pub const FILE_WRITE_EA: DWORD = 0x00000010;
+            pub const FILE_READ_EA: DWORD = 0x00000008;
+            pub const FILE_GENERIC_READ: DWORD =
                 STANDARD_RIGHTS_READ | FILE_READ_DATA |
                 FILE_READ_ATTRIBUTES | FILE_READ_EA | SYNCHRONIZE;
-            pub static FILE_GENERIC_WRITE: DWORD =
+            pub const FILE_GENERIC_WRITE: DWORD =
                 STANDARD_RIGHTS_WRITE | FILE_WRITE_DATA |
                 FILE_WRITE_ATTRIBUTES | FILE_WRITE_EA | FILE_APPEND_DATA |
                 SYNCHRONIZE;
 
-            pub static FILE_BEGIN: DWORD = 0;
-            pub static FILE_CURRENT: DWORD = 1;
-            pub static FILE_END: DWORD = 2;
-
-            pub static MAX_PROTOCOL_CHAIN: DWORD = 7;
-            pub static WSAPROTOCOL_LEN: DWORD = 255;
-            pub static INVALID_SOCKET: DWORD = !0;
-
-            pub static DETACHED_PROCESS: DWORD = 0x00000008;
-            pub static CREATE_NEW_PROCESS_GROUP: DWORD = 0x00000200;
-            pub static CREATE_UNICODE_ENVIRONMENT: DWORD = 0x00000400;
-
-            pub static PIPE_ACCESS_DUPLEX: DWORD = 0x00000003;
-            pub static PIPE_ACCESS_INBOUND: DWORD = 0x00000001;
-            pub static PIPE_ACCESS_OUTBOUND: DWORD = 0x00000002;
-            pub static PIPE_TYPE_BYTE: DWORD = 0x00000000;
-            pub static PIPE_TYPE_MESSAGE: DWORD = 0x00000004;
-            pub static PIPE_READMODE_BYTE: DWORD = 0x00000000;
-            pub static PIPE_READMODE_MESSAGE: DWORD = 0x00000002;
-            pub static PIPE_WAIT: DWORD = 0x00000000;
-            pub static PIPE_NOWAIT: DWORD = 0x00000001;
-            pub static PIPE_ACCEPT_REMOTE_CLIENTS: DWORD = 0x00000000;
-            pub static PIPE_REJECT_REMOTE_CLIENTS: DWORD = 0x00000008;
-            pub static PIPE_UNLIMITED_INSTANCES: DWORD = 255;
-
-            pub static IPPROTO_RAW: c_int = 255;
-
-            pub static FIONBIO: c_long = -0x7FFB9982;
+            pub const FILE_BEGIN: DWORD = 0;
+            pub const FILE_CURRENT: DWORD = 1;
+            pub const FILE_END: DWORD = 2;
+
+            pub const MAX_PROTOCOL_CHAIN: DWORD = 7;
+            pub const WSAPROTOCOL_LEN: DWORD = 255;
+            pub const INVALID_SOCKET: DWORD = !0;
+
+            pub const DETACHED_PROCESS: DWORD = 0x00000008;
+            pub const CREATE_NEW_PROCESS_GROUP: DWORD = 0x00000200;
+            pub const CREATE_UNICODE_ENVIRONMENT: DWORD = 0x00000400;
+
+            pub const PIPE_ACCESS_DUPLEX: DWORD = 0x00000003;
+            pub const PIPE_ACCESS_INBOUND: DWORD = 0x00000001;
+            pub const PIPE_ACCESS_OUTBOUND: DWORD = 0x00000002;
+            pub const PIPE_TYPE_BYTE: DWORD = 0x00000000;
+            pub const PIPE_TYPE_MESSAGE: DWORD = 0x00000004;
+            pub const PIPE_READMODE_BYTE: DWORD = 0x00000000;
+            pub const PIPE_READMODE_MESSAGE: DWORD = 0x00000002;
+            pub const PIPE_WAIT: DWORD = 0x00000000;
+            pub const PIPE_NOWAIT: DWORD = 0x00000001;
+            pub const PIPE_ACCEPT_REMOTE_CLIENTS: DWORD = 0x00000000;
+            pub const PIPE_REJECT_REMOTE_CLIENTS: DWORD = 0x00000008;
+            pub const PIPE_UNLIMITED_INSTANCES: DWORD = 255;
+
+            pub const IPPROTO_RAW: c_int = 255;
+
+            pub const FIONBIO: c_long = -0x7FFB9982;
         }
         pub mod sysconf {
         }
@@ -2383,21 +2383,21 @@ pub mod consts {
         pub mod c95 {
             use types::os::arch::c95::{c_int, c_uint};
 
-            pub static EXIT_FAILURE : c_int = 1;
-            pub static EXIT_SUCCESS : c_int = 0;
-            pub static RAND_MAX : c_int = 2147483647;
-            pub static EOF : c_int = -1;
-            pub static SEEK_SET : c_int = 0;
-            pub static SEEK_CUR : c_int = 1;
-            pub static SEEK_END : c_int = 2;
-            pub static _IOFBF : c_int = 0;
-            pub static _IONBF : c_int = 2;
-            pub static _IOLBF : c_int = 1;
-            pub static BUFSIZ : c_uint = 8192_u32;
-            pub static FOPEN_MAX : c_uint = 16_u32;
-            pub static FILENAME_MAX : c_uint = 4096_u32;
-            pub static L_tmpnam : c_uint = 20_u32;
-            pub static TMP_MAX : c_uint = 238328_u32;
+            pub const EXIT_FAILURE : c_int = 1;
+            pub const EXIT_SUCCESS : c_int = 0;
+            pub const RAND_MAX : c_int = 2147483647;
+            pub const EOF : c_int = -1;
+            pub const SEEK_SET : c_int = 0;
+            pub const SEEK_CUR : c_int = 1;
+            pub const SEEK_END : c_int = 2;
+            pub const _IOFBF : c_int = 0;
+            pub const _IONBF : c_int = 2;
+            pub const _IOLBF : c_int = 1;
+            pub const BUFSIZ : c_uint = 8192_u32;
+            pub const FOPEN_MAX : c_uint = 16_u32;
+            pub const FILENAME_MAX : c_uint = 4096_u32;
+            pub const L_tmpnam : c_uint = 20_u32;
+            pub const TMP_MAX : c_uint = 238328_u32;
         }
         pub mod c99 {
         }
@@ -2409,210 +2409,210 @@ pub mod consts {
             use types::common::c95::c_void;
             use types::os::arch::posix88::mode_t;
 
-            pub static O_RDONLY : c_int = 0;
-            pub static O_WRONLY : c_int = 1;
-            pub static O_RDWR : c_int = 2;
-            pub static O_APPEND : c_int = 1024;
-            pub static O_CREAT : c_int = 64;
-            pub static O_EXCL : c_int = 128;
-            pub static O_TRUNC : c_int = 512;
-            pub static S_IFIFO : mode_t = 4096;
-            pub static S_IFCHR : mode_t = 8192;
-            pub static S_IFBLK : mode_t = 24576;
-            pub static S_IFDIR : mode_t = 16384;
-            pub static S_IFREG : mode_t = 32768;
-            pub static S_IFLNK : mode_t = 40960;
-            pub static S_IFMT : mode_t = 61440;
-            pub static S_IEXEC : mode_t = 64;
-            pub static S_IWRITE : mode_t = 128;
-            pub static S_IREAD : mode_t = 256;
-            pub static S_IRWXU : mode_t = 448;
-            pub static S_IXUSR : mode_t = 64;
-            pub static S_IWUSR : mode_t = 128;
-            pub static S_IRUSR : mode_t = 256;
-            pub static F_OK : c_int = 0;
-            pub static R_OK : c_int = 4;
-            pub static W_OK : c_int = 2;
-            pub static X_OK : c_int = 1;
-            pub static STDIN_FILENO : c_int = 0;
-            pub static STDOUT_FILENO : c_int = 1;
-            pub static STDERR_FILENO : c_int = 2;
-            pub static F_LOCK : c_int = 1;
-            pub static F_TEST : c_int = 3;
-            pub static F_TLOCK : c_int = 2;
-            pub static F_ULOCK : c_int = 0;
-            pub static SIGHUP : c_int = 1;
-            pub static SIGINT : c_int = 2;
-            pub static SIGQUIT : c_int = 3;
-            pub static SIGILL : c_int = 4;
-            pub static SIGABRT : c_int = 6;
-            pub static SIGFPE : c_int = 8;
-            pub static SIGKILL : c_int = 9;
-            pub static SIGSEGV : c_int = 11;
-            pub static SIGPIPE : c_int = 13;
-            pub static SIGALRM : c_int = 14;
-            pub static SIGTERM : c_int = 15;
-
-            pub static PROT_NONE : c_int = 0;
-            pub static PROT_READ : c_int = 1;
-            pub static PROT_WRITE : c_int = 2;
-            pub static PROT_EXEC : c_int = 4;
-
-            pub static MAP_FILE : c_int = 0x0000;
-            pub static MAP_SHARED : c_int = 0x0001;
-            pub static MAP_PRIVATE : c_int = 0x0002;
-            pub static MAP_FIXED : c_int = 0x0010;
-            pub static MAP_ANON : c_int = 0x0020;
-
-            pub static MAP_FAILED : *mut c_void = -1 as *mut c_void;
-
-            pub static MCL_CURRENT : c_int = 0x0001;
-            pub static MCL_FUTURE : c_int = 0x0002;
-
-            pub static MS_ASYNC : c_int = 0x0001;
-            pub static MS_INVALIDATE : c_int = 0x0002;
-            pub static MS_SYNC : c_int = 0x0004;
-
-            pub static EPERM : c_int = 1;
-            pub static ENOENT : c_int = 2;
-            pub static ESRCH : c_int = 3;
-            pub static EINTR : c_int = 4;
-            pub static EIO : c_int = 5;
-            pub static ENXIO : c_int = 6;
-            pub static E2BIG : c_int = 7;
-            pub static ENOEXEC : c_int = 8;
-            pub static EBADF : c_int = 9;
-            pub static ECHILD : c_int = 10;
-            pub static EAGAIN : c_int = 11;
-            pub static ENOMEM : c_int = 12;
-            pub static EACCES : c_int = 13;
-            pub static EFAULT : c_int = 14;
-            pub static ENOTBLK : c_int = 15;
-            pub static EBUSY : c_int = 16;
-            pub static EEXIST : c_int = 17;
-            pub static EXDEV : c_int = 18;
-            pub static ENODEV : c_int = 19;
-            pub static ENOTDIR : c_int = 20;
-            pub static EISDIR : c_int = 21;
-            pub static EINVAL : c_int = 22;
-            pub static ENFILE : c_int = 23;
-            pub static EMFILE : c_int = 24;
-            pub static ENOTTY : c_int = 25;
-            pub static ETXTBSY : c_int = 26;
-            pub static EFBIG : c_int = 27;
-            pub static ENOSPC : c_int = 28;
-            pub static ESPIPE : c_int = 29;
-            pub static EROFS : c_int = 30;
-            pub static EMLINK : c_int = 31;
-            pub static EPIPE : c_int = 32;
-            pub static EDOM : c_int = 33;
-            pub static ERANGE : c_int = 34;
-
-            pub static EDEADLK: c_int = 35;
-            pub static ENAMETOOLONG: c_int = 36;
-            pub static ENOLCK: c_int = 37;
-            pub static ENOSYS: c_int = 38;
-            pub static ENOTEMPTY: c_int = 39;
-            pub static ELOOP: c_int = 40;
-            pub static EWOULDBLOCK: c_int = EAGAIN;
-            pub static ENOMSG: c_int = 42;
-            pub static EIDRM: c_int = 43;
-            pub static ECHRNG: c_int = 44;
-            pub static EL2NSYNC: c_int = 45;
-            pub static EL3HLT: c_int = 46;
-            pub static EL3RST: c_int = 47;
-            pub static ELNRNG: c_int = 48;
-            pub static EUNATCH: c_int = 49;
-            pub static ENOCSI: c_int = 50;
-            pub static EL2HLT: c_int = 51;
-            pub static EBADE: c_int = 52;
-            pub static EBADR: c_int = 53;
-            pub static EXFULL: c_int = 54;
-            pub static ENOANO: c_int = 55;
-            pub static EBADRQC: c_int = 56;
-            pub static EBADSLT: c_int = 57;
-
-            pub static EDEADLOCK: c_int = EDEADLK;
-
-            pub static EBFONT: c_int = 59;
-            pub static ENOSTR: c_int = 60;
-            pub static ENODATA: c_int = 61;
-            pub static ETIME: c_int = 62;
-            pub static ENOSR: c_int = 63;
-            pub static ENONET: c_int = 64;
-            pub static ENOPKG: c_int = 65;
-            pub static EREMOTE: c_int = 66;
-            pub static ENOLINK: c_int = 67;
-            pub static EADV: c_int = 68;
-            pub static ESRMNT: c_int = 69;
-            pub static ECOMM: c_int = 70;
-            pub static EPROTO: c_int = 71;
-            pub static EMULTIHOP: c_int = 72;
-            pub static EDOTDOT: c_int = 73;
-            pub static EBADMSG: c_int = 74;
-            pub static EOVERFLOW: c_int = 75;
-            pub static ENOTUNIQ: c_int = 76;
-            pub static EBADFD: c_int = 77;
-            pub static EREMCHG: c_int = 78;
-            pub static ELIBACC: c_int = 79;
-            pub static ELIBBAD: c_int = 80;
-            pub static ELIBSCN: c_int = 81;
-            pub static ELIBMAX: c_int = 82;
-            pub static ELIBEXEC: c_int = 83;
-            pub static EILSEQ: c_int = 84;
-            pub static ERESTART: c_int = 85;
-            pub static ESTRPIPE: c_int = 86;
-            pub static EUSERS: c_int = 87;
-            pub static ENOTSOCK: c_int = 88;
-            pub static EDESTADDRREQ: c_int = 89;
-            pub static EMSGSIZE: c_int = 90;
-            pub static EPROTOTYPE: c_int = 91;
-            pub static ENOPROTOOPT: c_int = 92;
-            pub static EPROTONOSUPPORT: c_int = 93;
-            pub static ESOCKTNOSUPPORT: c_int = 94;
-            pub static EOPNOTSUPP: c_int = 95;
-            pub static EPFNOSUPPORT: c_int = 96;
-            pub static EAFNOSUPPORT: c_int = 97;
-            pub static EADDRINUSE: c_int = 98;
-            pub static EADDRNOTAVAIL: c_int = 99;
-            pub static ENETDOWN: c_int = 100;
-            pub static ENETUNREACH: c_int = 101;
-            pub static ENETRESET: c_int = 102;
-            pub static ECONNABORTED: c_int = 103;
-            pub static ECONNRESET: c_int = 104;
-            pub static ENOBUFS: c_int = 105;
-            pub static EISCONN: c_int = 106;
-            pub static ENOTCONN: c_int = 107;
-            pub static ESHUTDOWN: c_int = 108;
-            pub static ETOOMANYREFS: c_int = 109;
-            pub static ETIMEDOUT: c_int = 110;
-            pub static ECONNREFUSED: c_int = 111;
-            pub static EHOSTDOWN: c_int = 112;
-            pub static EHOSTUNREACH: c_int = 113;
-            pub static EALREADY: c_int = 114;
-            pub static EINPROGRESS: c_int = 115;
-            pub static ESTALE: c_int = 116;
-            pub static EUCLEAN: c_int = 117;
-            pub static ENOTNAM: c_int = 118;
-            pub static ENAVAIL: c_int = 119;
-            pub static EISNAM: c_int = 120;
-            pub static EREMOTEIO: c_int = 121;
-            pub static EDQUOT: c_int = 122;
-
-            pub static ENOMEDIUM: c_int = 123;
-            pub static EMEDIUMTYPE: c_int = 124;
-            pub static ECANCELED: c_int = 125;
-            pub static ENOKEY: c_int = 126;
-            pub static EKEYEXPIRED: c_int = 127;
-            pub static EKEYREVOKED: c_int = 128;
-            pub static EKEYREJECTED: c_int = 129;
-
-            pub static EOWNERDEAD: c_int = 130;
-            pub static ENOTRECOVERABLE: c_int = 131;
-
-            pub static ERFKILL: c_int = 132;
-
-            pub static EHWPOISON: c_int = 133;
+            pub const O_RDONLY : c_int = 0;
+            pub const O_WRONLY : c_int = 1;
+            pub const O_RDWR : c_int = 2;
+            pub const O_APPEND : c_int = 1024;
+            pub const O_CREAT : c_int = 64;
+            pub const O_EXCL : c_int = 128;
+            pub const O_TRUNC : c_int = 512;
+            pub const S_IFIFO : mode_t = 4096;
+            pub const S_IFCHR : mode_t = 8192;
+            pub const S_IFBLK : mode_t = 24576;
+            pub const S_IFDIR : mode_t = 16384;
+            pub const S_IFREG : mode_t = 32768;
+            pub const S_IFLNK : mode_t = 40960;
+            pub const S_IFMT : mode_t = 61440;
+            pub const S_IEXEC : mode_t = 64;
+            pub const S_IWRITE : mode_t = 128;
+            pub const S_IREAD : mode_t = 256;
+            pub const S_IRWXU : mode_t = 448;
+            pub const S_IXUSR : mode_t = 64;
+            pub const S_IWUSR : mode_t = 128;
+            pub const S_IRUSR : mode_t = 256;
+            pub const F_OK : c_int = 0;
+            pub const R_OK : c_int = 4;
+            pub const W_OK : c_int = 2;
+            pub const X_OK : c_int = 1;
+            pub const STDIN_FILENO : c_int = 0;
+            pub const STDOUT_FILENO : c_int = 1;
+            pub const STDERR_FILENO : c_int = 2;
+            pub const F_LOCK : c_int = 1;
+            pub const F_TEST : c_int = 3;
+            pub const F_TLOCK : c_int = 2;
+            pub const F_ULOCK : c_int = 0;
+            pub const SIGHUP : c_int = 1;
+            pub const SIGINT : c_int = 2;
+            pub const SIGQUIT : c_int = 3;
+            pub const SIGILL : c_int = 4;
+            pub const SIGABRT : c_int = 6;
+            pub const SIGFPE : c_int = 8;
+            pub const SIGKILL : c_int = 9;
+            pub const SIGSEGV : c_int = 11;
+            pub const SIGPIPE : c_int = 13;
+            pub const SIGALRM : c_int = 14;
+            pub const SIGTERM : c_int = 15;
+
+            pub const PROT_NONE : c_int = 0;
+            pub const PROT_READ : c_int = 1;
+            pub const PROT_WRITE : c_int = 2;
+            pub const PROT_EXEC : c_int = 4;
+
+            pub const MAP_FILE : c_int = 0x0000;
+            pub const MAP_SHARED : c_int = 0x0001;
+            pub const MAP_PRIVATE : c_int = 0x0002;
+            pub const MAP_FIXED : c_int = 0x0010;
+            pub const MAP_ANON : c_int = 0x0020;
+
+            pub const MAP_FAILED : *mut c_void = -1 as *mut c_void;
+
+            pub const MCL_CURRENT : c_int = 0x0001;
+            pub const MCL_FUTURE : c_int = 0x0002;
+
+            pub const MS_ASYNC : c_int = 0x0001;
+            pub const MS_INVALIDATE : c_int = 0x0002;
+            pub const MS_SYNC : c_int = 0x0004;
+
+            pub const EPERM : c_int = 1;
+            pub const ENOENT : c_int = 2;
+            pub const ESRCH : c_int = 3;
+            pub const EINTR : c_int = 4;
+            pub const EIO : c_int = 5;
+            pub const ENXIO : c_int = 6;
+            pub const E2BIG : c_int = 7;
+            pub const ENOEXEC : c_int = 8;
+            pub const EBADF : c_int = 9;
+            pub const ECHILD : c_int = 10;
+            pub const EAGAIN : c_int = 11;
+            pub const ENOMEM : c_int = 12;
+            pub const EACCES : c_int = 13;
+            pub const EFAULT : c_int = 14;
+            pub const ENOTBLK : c_int = 15;
+            pub const EBUSY : c_int = 16;
+            pub const EEXIST : c_int = 17;
+            pub const EXDEV : c_int = 18;
+            pub const ENODEV : c_int = 19;
+            pub const ENOTDIR : c_int = 20;
+            pub const EISDIR : c_int = 21;
+            pub const EINVAL : c_int = 22;
+            pub const ENFILE : c_int = 23;
+            pub const EMFILE : c_int = 24;
+            pub const ENOTTY : c_int = 25;
+            pub const ETXTBSY : c_int = 26;
+            pub const EFBIG : c_int = 27;
+            pub const ENOSPC : c_int = 28;
+            pub const ESPIPE : c_int = 29;
+            pub const EROFS : c_int = 30;
+            pub const EMLINK : c_int = 31;
+            pub const EPIPE : c_int = 32;
+            pub const EDOM : c_int = 33;
+            pub const ERANGE : c_int = 34;
+
+            pub const EDEADLK: c_int = 35;
+            pub const ENAMETOOLONG: c_int = 36;
+            pub const ENOLCK: c_int = 37;
+            pub const ENOSYS: c_int = 38;
+            pub const ENOTEMPTY: c_int = 39;
+            pub const ELOOP: c_int = 40;
+            pub const EWOULDBLOCK: c_int = EAGAIN;
+            pub const ENOMSG: c_int = 42;
+            pub const EIDRM: c_int = 43;
+            pub const ECHRNG: c_int = 44;
+            pub const EL2NSYNC: c_int = 45;
+            pub const EL3HLT: c_int = 46;
+            pub const EL3RST: c_int = 47;
+            pub const ELNRNG: c_int = 48;
+            pub const EUNATCH: c_int = 49;
+            pub const ENOCSI: c_int = 50;
+            pub const EL2HLT: c_int = 51;
+            pub const EBADE: c_int = 52;
+            pub const EBADR: c_int = 53;
+            pub const EXFULL: c_int = 54;
+            pub const ENOANO: c_int = 55;
+            pub const EBADRQC: c_int = 56;
+            pub const EBADSLT: c_int = 57;
+
+            pub const EDEADLOCK: c_int = EDEADLK;
+
+            pub const EBFONT: c_int = 59;
+            pub const ENOSTR: c_int = 60;
+            pub const ENODATA: c_int = 61;
+            pub const ETIME: c_int = 62;
+            pub const ENOSR: c_int = 63;
+            pub const ENONET: c_int = 64;
+            pub const ENOPKG: c_int = 65;
+            pub const EREMOTE: c_int = 66;
+            pub const ENOLINK: c_int = 67;
+            pub const EADV: c_int = 68;
+            pub const ESRMNT: c_int = 69;
+            pub const ECOMM: c_int = 70;
+            pub const EPROTO: c_int = 71;
+            pub const EMULTIHOP: c_int = 72;
+            pub const EDOTDOT: c_int = 73;
+            pub const EBADMSG: c_int = 74;
+            pub const EOVERFLOW: c_int = 75;
+            pub const ENOTUNIQ: c_int = 76;
+            pub const EBADFD: c_int = 77;
+            pub const EREMCHG: c_int = 78;
+            pub const ELIBACC: c_int = 79;
+            pub const ELIBBAD: c_int = 80;
+            pub const ELIBSCN: c_int = 81;
+            pub const ELIBMAX: c_int = 82;
+            pub const ELIBEXEC: c_int = 83;
+            pub const EILSEQ: c_int = 84;
+            pub const ERESTART: c_int = 85;
+            pub const ESTRPIPE: c_int = 86;
+            pub const EUSERS: c_int = 87;
+            pub const ENOTSOCK: c_int = 88;
+            pub const EDESTADDRREQ: c_int = 89;
+            pub const EMSGSIZE: c_int = 90;
+            pub const EPROTOTYPE: c_int = 91;
+            pub const ENOPROTOOPT: c_int = 92;
+            pub const EPROTONOSUPPORT: c_int = 93;
+            pub const ESOCKTNOSUPPORT: c_int = 94;
+            pub const EOPNOTSUPP: c_int = 95;
+            pub const EPFNOSUPPORT: c_int = 96;
+            pub const EAFNOSUPPORT: c_int = 97;
+            pub const EADDRINUSE: c_int = 98;
+            pub const EADDRNOTAVAIL: c_int = 99;
+            pub const ENETDOWN: c_int = 100;
+            pub const ENETUNREACH: c_int = 101;
+            pub const ENETRESET: c_int = 102;
+            pub const ECONNABORTED: c_int = 103;
+            pub const ECONNRESET: c_int = 104;
+            pub const ENOBUFS: c_int = 105;
+            pub const EISCONN: c_int = 106;
+            pub const ENOTCONN: c_int = 107;
+            pub const ESHUTDOWN: c_int = 108;
+            pub const ETOOMANYREFS: c_int = 109;
+            pub const ETIMEDOUT: c_int = 110;
+            pub const ECONNREFUSED: c_int = 111;
+            pub const EHOSTDOWN: c_int = 112;
+            pub const EHOSTUNREACH: c_int = 113;
+            pub const EALREADY: c_int = 114;
+            pub const EINPROGRESS: c_int = 115;
+            pub const ESTALE: c_int = 116;
+            pub const EUCLEAN: c_int = 117;
+            pub const ENOTNAM: c_int = 118;
+            pub const ENAVAIL: c_int = 119;
+            pub const EISNAM: c_int = 120;
+            pub const EREMOTEIO: c_int = 121;
+            pub const EDQUOT: c_int = 122;
+
+            pub const ENOMEDIUM: c_int = 123;
+            pub const EMEDIUMTYPE: c_int = 124;
+            pub const ECANCELED: c_int = 125;
+            pub const ENOKEY: c_int = 126;
+            pub const EKEYEXPIRED: c_int = 127;
+            pub const EKEYREVOKED: c_int = 128;
+            pub const EKEYREJECTED: c_int = 129;
+
+            pub const EOWNERDEAD: c_int = 130;
+            pub const ENOTRECOVERABLE: c_int = 131;
+
+            pub const ERFKILL: c_int = 132;
+
+            pub const EHWPOISON: c_int = 133;
         }
 
         #[cfg(any(target_arch = "mips", target_arch = "mipsel"))]
@@ -2621,288 +2621,288 @@ pub mod consts {
             use types::common::c95::c_void;
             use types::os::arch::posix88::mode_t;
 
-            pub static O_RDONLY : c_int = 0;
-            pub static O_WRONLY : c_int = 1;
-            pub static O_RDWR : c_int = 2;
-            pub static O_APPEND : c_int = 8;
-            pub static O_CREAT : c_int = 256;
-            pub static O_EXCL : c_int = 1024;
-            pub static O_TRUNC : c_int = 512;
-            pub static S_IFIFO : mode_t = 4096;
-            pub static S_IFCHR : mode_t = 8192;
-            pub static S_IFBLK : mode_t = 24576;
-            pub static S_IFDIR : mode_t = 16384;
-            pub static S_IFREG : mode_t = 32768;
-            pub static S_IFLNK : mode_t = 40960;
-            pub static S_IFMT : mode_t = 61440;
-            pub static S_IEXEC : mode_t = 64;
-            pub static S_IWRITE : mode_t = 128;
-            pub static S_IREAD : mode_t = 256;
-            pub static S_IRWXU : mode_t = 448;
-            pub static S_IXUSR : mode_t = 64;
-            pub static S_IWUSR : mode_t = 128;
-            pub static S_IRUSR : mode_t = 256;
-            pub static F_OK : c_int = 0;
-            pub static R_OK : c_int = 4;
-            pub static W_OK : c_int = 2;
-            pub static X_OK : c_int = 1;
-            pub static STDIN_FILENO : c_int = 0;
-            pub static STDOUT_FILENO : c_int = 1;
-            pub static STDERR_FILENO : c_int = 2;
-            pub static F_LOCK : c_int = 1;
-            pub static F_TEST : c_int = 3;
-            pub static F_TLOCK : c_int = 2;
-            pub static F_ULOCK : c_int = 0;
-            pub static SIGHUP : c_int = 1;
-            pub static SIGINT : c_int = 2;
-            pub static SIGQUIT : c_int = 3;
-            pub static SIGILL : c_int = 4;
-            pub static SIGABRT : c_int = 6;
-            pub static SIGFPE : c_int = 8;
-            pub static SIGKILL : c_int = 9;
-            pub static SIGSEGV : c_int = 11;
-            pub static SIGPIPE : c_int = 13;
-            pub static SIGALRM : c_int = 14;
-            pub static SIGTERM : c_int = 15;
-
-            pub static PROT_NONE : c_int = 0;
-            pub static PROT_READ : c_int = 1;
-            pub static PROT_WRITE : c_int = 2;
-            pub static PROT_EXEC : c_int = 4;
-
-            pub static MAP_FILE : c_int = 0x0000;
-            pub static MAP_SHARED : c_int = 0x0001;
-            pub static MAP_PRIVATE : c_int = 0x0002;
-            pub static MAP_FIXED : c_int = 0x0010;
-            pub static MAP_ANON : c_int = 0x0800;
-
-            pub static MAP_FAILED : *mut c_void = -1 as *mut c_void;
-
-            pub static MCL_CURRENT : c_int = 0x0001;
-            pub static MCL_FUTURE : c_int = 0x0002;
-
-            pub static MS_ASYNC : c_int = 0x0001;
-            pub static MS_INVALIDATE : c_int = 0x0002;
-            pub static MS_SYNC : c_int = 0x0004;
-
-            pub static EPERM : c_int = 1;
-            pub static ENOENT : c_int = 2;
-            pub static ESRCH : c_int = 3;
-            pub static EINTR : c_int = 4;
-            pub static EIO : c_int = 5;
-            pub static ENXIO : c_int = 6;
-            pub static E2BIG : c_int = 7;
-            pub static ENOEXEC : c_int = 8;
-            pub static EBADF : c_int = 9;
-            pub static ECHILD : c_int = 10;
-            pub static EAGAIN : c_int = 11;
-            pub static ENOMEM : c_int = 12;
-            pub static EACCES : c_int = 13;
-            pub static EFAULT : c_int = 14;
-            pub static ENOTBLK : c_int = 15;
-            pub static EBUSY : c_int = 16;
-            pub static EEXIST : c_int = 17;
-            pub static EXDEV : c_int = 18;
-            pub static ENODEV : c_int = 19;
-            pub static ENOTDIR : c_int = 20;
-            pub static EISDIR : c_int = 21;
-            pub static EINVAL : c_int = 22;
-            pub static ENFILE : c_int = 23;
-            pub static EMFILE : c_int = 24;
-            pub static ENOTTY : c_int = 25;
-            pub static ETXTBSY : c_int = 26;
-            pub static EFBIG : c_int = 27;
-            pub static ENOSPC : c_int = 28;
-            pub static ESPIPE : c_int = 29;
-            pub static EROFS : c_int = 30;
-            pub static EMLINK : c_int = 31;
-            pub static EPIPE : c_int = 32;
-            pub static EDOM : c_int = 33;
-            pub static ERANGE : c_int = 34;
-
-            pub static ENOMSG: c_int = 35;
-            pub static EIDRM: c_int = 36;
-            pub static ECHRNG: c_int = 37;
-            pub static EL2NSYNC: c_int = 38;
-            pub static EL3HLT: c_int = 39;
-            pub static EL3RST: c_int = 40;
-            pub static ELNRNG: c_int = 41;
-            pub static EUNATCH: c_int = 42;
-            pub static ENOCSI: c_int = 43;
-            pub static EL2HLT: c_int = 44;
-            pub static EDEADLK: c_int = 45;
-            pub static ENOLCK: c_int = 46;
-            pub static EBADE: c_int = 50;
-            pub static EBADR: c_int = 51;
-            pub static EXFULL: c_int = 52;
-            pub static ENOANO: c_int = 53;
-            pub static EBADRQC: c_int = 54;
-            pub static EBADSLT: c_int = 55;
-            pub static EDEADLOCK: c_int = 56;
-            pub static EBFONT: c_int = 59;
-            pub static ENOSTR: c_int = 60;
-            pub static ENODATA: c_int = 61;
-            pub static ETIME: c_int = 62;
-            pub static ENOSR: c_int = 63;
-            pub static ENONET: c_int = 64;
-            pub static ENOPKG: c_int = 65;
-            pub static EREMOTE: c_int = 66;
-            pub static ENOLINK: c_int = 67;
-            pub static EADV: c_int = 68;
-            pub static ESRMNT: c_int = 69;
-            pub static ECOMM: c_int = 70;
-            pub static EPROTO: c_int = 71;
-            pub static EDOTDOT: c_int = 73;
-            pub static EMULTIHOP: c_int = 74;
-            pub static EBADMSG: c_int = 77;
-            pub static ENAMETOOLONG: c_int = 78;
-            pub static EOVERFLOW: c_int = 79;
-            pub static ENOTUNIQ: c_int = 80;
-            pub static EBADFD: c_int = 81;
-            pub static EREMCHG: c_int = 82;
-            pub static ELIBACC: c_int = 83;
-            pub static ELIBBAD: c_int = 84;
-            pub static ELIBSCN: c_int = 95;
-            pub static ELIBMAX: c_int = 86;
-            pub static ELIBEXEC: c_int = 87;
-            pub static EILSEQ: c_int = 88;
-            pub static ENOSYS: c_int = 89;
-            pub static ELOOP: c_int = 90;
-            pub static ERESTART: c_int = 91;
-            pub static ESTRPIPE: c_int = 92;
-            pub static ENOTEMPTY: c_int = 93;
-            pub static EUSERS: c_int = 94;
-            pub static ENOTSOCK: c_int = 95;
-            pub static EDESTADDRREQ: c_int = 96;
-            pub static EMSGSIZE: c_int = 97;
-            pub static EPROTOTYPE: c_int = 98;
-            pub static ENOPROTOOPT: c_int = 99;
-            pub static EPROTONOSUPPORT: c_int = 120;
-            pub static ESOCKTNOSUPPORT: c_int = 121;
-            pub static EOPNOTSUPP: c_int = 122;
-            pub static EPFNOSUPPORT: c_int = 123;
-            pub static EAFNOSUPPORT: c_int = 124;
-            pub static EADDRINUSE: c_int = 125;
-            pub static EADDRNOTAVAIL: c_int = 126;
-            pub static ENETDOWN: c_int = 127;
-            pub static ENETUNREACH: c_int = 128;
-            pub static ENETRESET: c_int = 129;
-            pub static ECONNABORTED: c_int = 130;
-            pub static ECONNRESET: c_int = 131;
-            pub static ENOBUFS: c_int = 132;
-            pub static EISCONN: c_int = 133;
-            pub static ENOTCONN: c_int = 134;
-            pub static EUCLEAN: c_int = 135;
-            pub static ENOTNAM: c_int = 137;
-            pub static ENAVAIL: c_int = 138;
-            pub static EISNAM: c_int = 139;
-            pub static EREMOTEIO: c_int = 140;
-            pub static ESHUTDOWN: c_int = 143;
-            pub static ETOOMANYREFS: c_int = 144;
-            pub static ETIMEDOUT: c_int = 145;
-            pub static ECONNREFUSED: c_int = 146;
-            pub static EHOSTDOWN: c_int = 147;
-            pub static EHOSTUNREACH: c_int = 148;
-            pub static EWOULDBLOCK: c_int = EAGAIN;
-            pub static EALREADY: c_int = 149;
-            pub static EINPROGRESS: c_int = 150;
-            pub static ESTALE: c_int = 151;
-            pub static ECANCELED: c_int = 158;
-
-            pub static ENOMEDIUM: c_int = 159;
-            pub static EMEDIUMTYPE: c_int = 160;
-            pub static ENOKEY: c_int = 161;
-            pub static EKEYEXPIRED: c_int = 162;
-            pub static EKEYREVOKED: c_int = 163;
-            pub static EKEYREJECTED: c_int = 164;
-
-            pub static EOWNERDEAD: c_int = 165;
-            pub static ENOTRECOVERABLE: c_int = 166;
-
-            pub static ERFKILL: c_int = 167;
-
-            pub static EHWPOISON: c_int = 168;
-
-            pub static EDQUOT: c_int = 1133;
+            pub const O_RDONLY : c_int = 0;
+            pub const O_WRONLY : c_int = 1;
+            pub const O_RDWR : c_int = 2;
+            pub const O_APPEND : c_int = 8;
+            pub const O_CREAT : c_int = 256;
+            pub const O_EXCL : c_int = 1024;
+            pub const O_TRUNC : c_int = 512;
+            pub const S_IFIFO : mode_t = 4096;
+            pub const S_IFCHR : mode_t = 8192;
+            pub const S_IFBLK : mode_t = 24576;
+            pub const S_IFDIR : mode_t = 16384;
+            pub const S_IFREG : mode_t = 32768;
+            pub const S_IFLNK : mode_t = 40960;
+            pub const S_IFMT : mode_t = 61440;
+            pub const S_IEXEC : mode_t = 64;
+            pub const S_IWRITE : mode_t = 128;
+            pub const S_IREAD : mode_t = 256;
+            pub const S_IRWXU : mode_t = 448;
+            pub const S_IXUSR : mode_t = 64;
+            pub const S_IWUSR : mode_t = 128;
+            pub const S_IRUSR : mode_t = 256;
+            pub const F_OK : c_int = 0;
+            pub const R_OK : c_int = 4;
+            pub const W_OK : c_int = 2;
+            pub const X_OK : c_int = 1;
+            pub const STDIN_FILENO : c_int = 0;
+            pub const STDOUT_FILENO : c_int = 1;
+            pub const STDERR_FILENO : c_int = 2;
+            pub const F_LOCK : c_int = 1;
+            pub const F_TEST : c_int = 3;
+            pub const F_TLOCK : c_int = 2;
+            pub const F_ULOCK : c_int = 0;
+            pub const SIGHUP : c_int = 1;
+            pub const SIGINT : c_int = 2;
+            pub const SIGQUIT : c_int = 3;
+            pub const SIGILL : c_int = 4;
+            pub const SIGABRT : c_int = 6;
+            pub const SIGFPE : c_int = 8;
+            pub const SIGKILL : c_int = 9;
+            pub const SIGSEGV : c_int = 11;
+            pub const SIGPIPE : c_int = 13;
+            pub const SIGALRM : c_int = 14;
+            pub const SIGTERM : c_int = 15;
+
+            pub const PROT_NONE : c_int = 0;
+            pub const PROT_READ : c_int = 1;
+            pub const PROT_WRITE : c_int = 2;
+            pub const PROT_EXEC : c_int = 4;
+
+            pub const MAP_FILE : c_int = 0x0000;
+            pub const MAP_SHARED : c_int = 0x0001;
+            pub const MAP_PRIVATE : c_int = 0x0002;
+            pub const MAP_FIXED : c_int = 0x0010;
+            pub const MAP_ANON : c_int = 0x0800;
+
+            pub const MAP_FAILED : *mut c_void = -1 as *mut c_void;
+
+            pub const MCL_CURRENT : c_int = 0x0001;
+            pub const MCL_FUTURE : c_int = 0x0002;
+
+            pub const MS_ASYNC : c_int = 0x0001;
+            pub const MS_INVALIDATE : c_int = 0x0002;
+            pub const MS_SYNC : c_int = 0x0004;
+
+            pub const EPERM : c_int = 1;
+            pub const ENOENT : c_int = 2;
+            pub const ESRCH : c_int = 3;
+            pub const EINTR : c_int = 4;
+            pub const EIO : c_int = 5;
+            pub const ENXIO : c_int = 6;
+            pub const E2BIG : c_int = 7;
+            pub const ENOEXEC : c_int = 8;
+            pub const EBADF : c_int = 9;
+            pub const ECHILD : c_int = 10;
+            pub const EAGAIN : c_int = 11;
+            pub const ENOMEM : c_int = 12;
+            pub const EACCES : c_int = 13;
+            pub const EFAULT : c_int = 14;
+            pub const ENOTBLK : c_int = 15;
+            pub const EBUSY : c_int = 16;
+            pub const EEXIST : c_int = 17;
+            pub const EXDEV : c_int = 18;
+            pub const ENODEV : c_int = 19;
+            pub const ENOTDIR : c_int = 20;
+            pub const EISDIR : c_int = 21;
+            pub const EINVAL : c_int = 22;
+            pub const ENFILE : c_int = 23;
+            pub const EMFILE : c_int = 24;
+            pub const ENOTTY : c_int = 25;
+            pub const ETXTBSY : c_int = 26;
+            pub const EFBIG : c_int = 27;
+            pub const ENOSPC : c_int = 28;
+            pub const ESPIPE : c_int = 29;
+            pub const EROFS : c_int = 30;
+            pub const EMLINK : c_int = 31;
+            pub const EPIPE : c_int = 32;
+            pub const EDOM : c_int = 33;
+            pub const ERANGE : c_int = 34;
+
+            pub const ENOMSG: c_int = 35;
+            pub const EIDRM: c_int = 36;
+            pub const ECHRNG: c_int = 37;
+            pub const EL2NSYNC: c_int = 38;
+            pub const EL3HLT: c_int = 39;
+            pub const EL3RST: c_int = 40;
+            pub const ELNRNG: c_int = 41;
+            pub const EUNATCH: c_int = 42;
+            pub const ENOCSI: c_int = 43;
+            pub const EL2HLT: c_int = 44;
+            pub const EDEADLK: c_int = 45;
+            pub const ENOLCK: c_int = 46;
+            pub const EBADE: c_int = 50;
+            pub const EBADR: c_int = 51;
+            pub const EXFULL: c_int = 52;
+            pub const ENOANO: c_int = 53;
+            pub const EBADRQC: c_int = 54;
+            pub const EBADSLT: c_int = 55;
+            pub const EDEADLOCK: c_int = 56;
+            pub const EBFONT: c_int = 59;
+            pub const ENOSTR: c_int = 60;
+            pub const ENODATA: c_int = 61;
+            pub const ETIME: c_int = 62;
+            pub const ENOSR: c_int = 63;
+            pub const ENONET: c_int = 64;
+            pub const ENOPKG: c_int = 65;
+            pub const EREMOTE: c_int = 66;
+            pub const ENOLINK: c_int = 67;
+            pub const EADV: c_int = 68;
+            pub const ESRMNT: c_int = 69;
+            pub const ECOMM: c_int = 70;
+            pub const EPROTO: c_int = 71;
+            pub const EDOTDOT: c_int = 73;
+            pub const EMULTIHOP: c_int = 74;
+            pub const EBADMSG: c_int = 77;
+            pub const ENAMETOOLONG: c_int = 78;
+            pub const EOVERFLOW: c_int = 79;
+            pub const ENOTUNIQ: c_int = 80;
+            pub const EBADFD: c_int = 81;
+            pub const EREMCHG: c_int = 82;
+            pub const ELIBACC: c_int = 83;
+            pub const ELIBBAD: c_int = 84;
+            pub const ELIBSCN: c_int = 95;
+            pub const ELIBMAX: c_int = 86;
+            pub const ELIBEXEC: c_int = 87;
+            pub const EILSEQ: c_int = 88;
+            pub const ENOSYS: c_int = 89;
+            pub const ELOOP: c_int = 90;
+            pub const ERESTART: c_int = 91;
+            pub const ESTRPIPE: c_int = 92;
+            pub const ENOTEMPTY: c_int = 93;
+            pub const EUSERS: c_int = 94;
+            pub const ENOTSOCK: c_int = 95;
+            pub const EDESTADDRREQ: c_int = 96;
+            pub const EMSGSIZE: c_int = 97;
+            pub const EPROTOTYPE: c_int = 98;
+            pub const ENOPROTOOPT: c_int = 99;
+            pub const EPROTONOSUPPORT: c_int = 120;
+            pub const ESOCKTNOSUPPORT: c_int = 121;
+            pub const EOPNOTSUPP: c_int = 122;
+            pub const EPFNOSUPPORT: c_int = 123;
+            pub const EAFNOSUPPORT: c_int = 124;
+            pub const EADDRINUSE: c_int = 125;
+            pub const EADDRNOTAVAIL: c_int = 126;
+            pub const ENETDOWN: c_int = 127;
+            pub const ENETUNREACH: c_int = 128;
+            pub const ENETRESET: c_int = 129;
+            pub const ECONNABORTED: c_int = 130;
+            pub const ECONNRESET: c_int = 131;
+            pub const ENOBUFS: c_int = 132;
+            pub const EISCONN: c_int = 133;
+            pub const ENOTCONN: c_int = 134;
+            pub const EUCLEAN: c_int = 135;
+            pub const ENOTNAM: c_int = 137;
+            pub const ENAVAIL: c_int = 138;
+            pub const EISNAM: c_int = 139;
+            pub const EREMOTEIO: c_int = 140;
+            pub const ESHUTDOWN: c_int = 143;
+            pub const ETOOMANYREFS: c_int = 144;
+            pub const ETIMEDOUT: c_int = 145;
+            pub const ECONNREFUSED: c_int = 146;
+            pub const EHOSTDOWN: c_int = 147;
+            pub const EHOSTUNREACH: c_int = 148;
+            pub const EWOULDBLOCK: c_int = EAGAIN;
+            pub const EALREADY: c_int = 149;
+            pub const EINPROGRESS: c_int = 150;
+            pub const ESTALE: c_int = 151;
+            pub const ECANCELED: c_int = 158;
+
+            pub const ENOMEDIUM: c_int = 159;
+            pub const EMEDIUMTYPE: c_int = 160;
+            pub const ENOKEY: c_int = 161;
+            pub const EKEYEXPIRED: c_int = 162;
+            pub const EKEYREVOKED: c_int = 163;
+            pub const EKEYREJECTED: c_int = 164;
+
+            pub const EOWNERDEAD: c_int = 165;
+            pub const ENOTRECOVERABLE: c_int = 166;
+
+            pub const ERFKILL: c_int = 167;
+
+            pub const EHWPOISON: c_int = 168;
+
+            pub const EDQUOT: c_int = 1133;
         }
         pub mod posix01 {
             use types::os::arch::c95::{c_int, size_t};
 
-            pub static F_DUPFD : c_int = 0;
-            pub static F_GETFD : c_int = 1;
-            pub static F_SETFD : c_int = 2;
-            pub static F_GETFL : c_int = 3;
-            pub static F_SETFL : c_int = 4;
-
-            pub static SIGTRAP : c_int = 5;
-            pub static SIGPIPE: c_int = 13;
-            pub static SIG_IGN: size_t = 1;
-
-            pub static GLOB_ERR      : c_int = 1 << 0;
-            pub static GLOB_MARK     : c_int = 1 << 1;
-            pub static GLOB_NOSORT   : c_int = 1 << 2;
-            pub static GLOB_DOOFFS   : c_int = 1 << 3;
-            pub static GLOB_NOCHECK  : c_int = 1 << 4;
-            pub static GLOB_APPEND   : c_int = 1 << 5;
-            pub static GLOB_NOESCAPE : c_int = 1 << 6;
-
-            pub static GLOB_NOSPACE  : c_int = 1;
-            pub static GLOB_ABORTED  : c_int = 2;
-            pub static GLOB_NOMATCH  : c_int = 3;
-
-            pub static POSIX_MADV_NORMAL : c_int = 0;
-            pub static POSIX_MADV_RANDOM : c_int = 1;
-            pub static POSIX_MADV_SEQUENTIAL : c_int = 2;
-            pub static POSIX_MADV_WILLNEED : c_int = 3;
-            pub static POSIX_MADV_DONTNEED : c_int = 4;
-
-            pub static _SC_MQ_PRIO_MAX : c_int = 28;
-            pub static _SC_IOV_MAX : c_int = 60;
-            pub static _SC_GETGR_R_SIZE_MAX : c_int = 69;
-            pub static _SC_GETPW_R_SIZE_MAX : c_int = 70;
-            pub static _SC_LOGIN_NAME_MAX : c_int = 71;
-            pub static _SC_TTY_NAME_MAX : c_int = 72;
-            pub static _SC_THREADS : c_int = 67;
-            pub static _SC_THREAD_SAFE_FUNCTIONS : c_int = 68;
-            pub static _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 73;
-            pub static _SC_THREAD_KEYS_MAX : c_int = 74;
-            pub static _SC_THREAD_STACK_MIN : c_int = 75;
-            pub static _SC_THREAD_THREADS_MAX : c_int = 76;
-            pub static _SC_THREAD_ATTR_STACKADDR : c_int = 77;
-            pub static _SC_THREAD_ATTR_STACKSIZE : c_int = 78;
-            pub static _SC_THREAD_PRIORITY_SCHEDULING : c_int = 79;
-            pub static _SC_THREAD_PRIO_INHERIT : c_int = 80;
-            pub static _SC_THREAD_PRIO_PROTECT : c_int = 81;
-            pub static _SC_THREAD_PROCESS_SHARED : c_int = 82;
-            pub static _SC_ATEXIT_MAX : c_int = 87;
-            pub static _SC_XOPEN_VERSION : c_int = 89;
-            pub static _SC_XOPEN_XCU_VERSION : c_int = 90;
-            pub static _SC_XOPEN_UNIX : c_int = 91;
-            pub static _SC_XOPEN_CRYPT : c_int = 92;
-            pub static _SC_XOPEN_ENH_I18N : c_int = 93;
-            pub static _SC_XOPEN_SHM : c_int = 94;
-            pub static _SC_XOPEN_LEGACY : c_int = 129;
-            pub static _SC_XOPEN_REALTIME : c_int = 130;
-            pub static _SC_XOPEN_REALTIME_THREADS : c_int = 131;
-
-            pub static PTHREAD_CREATE_JOINABLE: c_int = 0;
-            pub static PTHREAD_CREATE_DETACHED: c_int = 1;
+            pub const F_DUPFD : c_int = 0;
+            pub const F_GETFD : c_int = 1;
+            pub const F_SETFD : c_int = 2;
+            pub const F_GETFL : c_int = 3;
+            pub const F_SETFL : c_int = 4;
+
+            pub const SIGTRAP : c_int = 5;
+            pub const SIGPIPE: c_int = 13;
+            pub const SIG_IGN: size_t = 1;
+
+            pub const GLOB_ERR      : c_int = 1 << 0;
+            pub const GLOB_MARK     : c_int = 1 << 1;
+            pub const GLOB_NOSORT   : c_int = 1 << 2;
+            pub const GLOB_DOOFFS   : c_int = 1 << 3;
+            pub const GLOB_NOCHECK  : c_int = 1 << 4;
+            pub const GLOB_APPEND   : c_int = 1 << 5;
+            pub const GLOB_NOESCAPE : c_int = 1 << 6;
+
+            pub const GLOB_NOSPACE  : c_int = 1;
+            pub const GLOB_ABORTED  : c_int = 2;
+            pub const GLOB_NOMATCH  : c_int = 3;
+
+            pub const POSIX_MADV_NORMAL : c_int = 0;
+            pub const POSIX_MADV_RANDOM : c_int = 1;
+            pub const POSIX_MADV_SEQUENTIAL : c_int = 2;
+            pub const POSIX_MADV_WILLNEED : c_int = 3;
+            pub const POSIX_MADV_DONTNEED : c_int = 4;
+
+            pub const _SC_MQ_PRIO_MAX : c_int = 28;
+            pub const _SC_IOV_MAX : c_int = 60;
+            pub const _SC_GETGR_R_SIZE_MAX : c_int = 69;
+            pub const _SC_GETPW_R_SIZE_MAX : c_int = 70;
+            pub const _SC_LOGIN_NAME_MAX : c_int = 71;
+            pub const _SC_TTY_NAME_MAX : c_int = 72;
+            pub const _SC_THREADS : c_int = 67;
+            pub const _SC_THREAD_SAFE_FUNCTIONS : c_int = 68;
+            pub const _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 73;
+            pub const _SC_THREAD_KEYS_MAX : c_int = 74;
+            pub const _SC_THREAD_STACK_MIN : c_int = 75;
+            pub const _SC_THREAD_THREADS_MAX : c_int = 76;
+            pub const _SC_THREAD_ATTR_STACKADDR : c_int = 77;
+            pub const _SC_THREAD_ATTR_STACKSIZE : c_int = 78;
+            pub const _SC_THREAD_PRIORITY_SCHEDULING : c_int = 79;
+            pub const _SC_THREAD_PRIO_INHERIT : c_int = 80;
+            pub const _SC_THREAD_PRIO_PROTECT : c_int = 81;
+            pub const _SC_THREAD_PROCESS_SHARED : c_int = 82;
+            pub const _SC_ATEXIT_MAX : c_int = 87;
+            pub const _SC_XOPEN_VERSION : c_int = 89;
+            pub const _SC_XOPEN_XCU_VERSION : c_int = 90;
+            pub const _SC_XOPEN_UNIX : c_int = 91;
+            pub const _SC_XOPEN_CRYPT : c_int = 92;
+            pub const _SC_XOPEN_ENH_I18N : c_int = 93;
+            pub const _SC_XOPEN_SHM : c_int = 94;
+            pub const _SC_XOPEN_LEGACY : c_int = 129;
+            pub const _SC_XOPEN_REALTIME : c_int = 130;
+            pub const _SC_XOPEN_REALTIME_THREADS : c_int = 131;
+
+            pub const PTHREAD_CREATE_JOINABLE: c_int = 0;
+            pub const PTHREAD_CREATE_DETACHED: c_int = 1;
 
             #[cfg(target_os = "android")]
-            pub static PTHREAD_STACK_MIN: size_t = 8192;
+            pub const PTHREAD_STACK_MIN: size_t = 8192;
 
             #[cfg(all(target_os = "linux",
                       any(target_arch = "arm",
                           target_arch = "x86",
                           target_arch = "x86_64")))]
-            pub static PTHREAD_STACK_MIN: size_t = 16384;
+            pub const PTHREAD_STACK_MIN: size_t = 16384;
 
             #[cfg(all(target_os = "linux",
                       any(target_arch = "mips", target_arch = "mipsel")))]
-            pub static PTHREAD_STACK_MIN: size_t = 131072;
+            pub const PTHREAD_STACK_MIN: size_t = 131072;
 
-            pub static CLOCK_REALTIME: c_int = 0;
-            pub static CLOCK_MONOTONIC: c_int = 1;
+            pub const CLOCK_REALTIME: c_int = 0;
+            pub const CLOCK_MONOTONIC: c_int = 1;
         }
         pub mod posix08 {
         }
@@ -2912,93 +2912,93 @@ pub mod consts {
         pub mod bsd44 {
             use types::os::arch::c95::c_int;
 
-            pub static MADV_NORMAL : c_int = 0;
-            pub static MADV_RANDOM : c_int = 1;
-            pub static MADV_SEQUENTIAL : c_int = 2;
-            pub static MADV_WILLNEED : c_int = 3;
-            pub static MADV_DONTNEED : c_int = 4;
-            pub static MADV_REMOVE : c_int = 9;
-            pub static MADV_DONTFORK : c_int = 10;
-            pub static MADV_DOFORK : c_int = 11;
-            pub static MADV_MERGEABLE : c_int = 12;
-            pub static MADV_UNMERGEABLE : c_int = 13;
-            pub static MADV_HWPOISON : c_int = 100;
-
-            pub static IFF_LOOPBACK: c_int = 0x8;
-
-            pub static AF_UNIX: c_int = 1;
-            pub static AF_INET: c_int = 2;
-            pub static AF_INET6: c_int = 10;
-            pub static SOCK_STREAM: c_int = 1;
-            pub static SOCK_DGRAM: c_int = 2;
-            pub static SOCK_RAW: c_int = 3;
-            pub static IPPROTO_TCP: c_int = 6;
-            pub static IPPROTO_IP: c_int = 0;
-            pub static IPPROTO_IPV6: c_int = 41;
-            pub static IP_MULTICAST_TTL: c_int = 33;
-            pub static IP_MULTICAST_LOOP: c_int = 34;
-            pub static IP_TTL: c_int = 2;
-            pub static IP_HDRINCL: c_int = 3;
-            pub static IP_ADD_MEMBERSHIP: c_int = 35;
-            pub static IP_DROP_MEMBERSHIP: c_int = 36;
-            pub static IPV6_ADD_MEMBERSHIP: c_int = 20;
-            pub static IPV6_DROP_MEMBERSHIP: c_int = 21;
-
-            pub static TCP_NODELAY: c_int = 1;
-            pub static SOL_SOCKET: c_int = 1;
-            pub static SO_KEEPALIVE: c_int = 9;
-            pub static SO_BROADCAST: c_int = 6;
-            pub static SO_REUSEADDR: c_int = 2;
-            pub static SO_ERROR: c_int = 4;
-
-            pub static SHUT_RD: c_int = 0;
-            pub static SHUT_WR: c_int = 1;
-            pub static SHUT_RDWR: c_int = 2;
+            pub const MADV_NORMAL : c_int = 0;
+            pub const MADV_RANDOM : c_int = 1;
+            pub const MADV_SEQUENTIAL : c_int = 2;
+            pub const MADV_WILLNEED : c_int = 3;
+            pub const MADV_DONTNEED : c_int = 4;
+            pub const MADV_REMOVE : c_int = 9;
+            pub const MADV_DONTFORK : c_int = 10;
+            pub const MADV_DOFORK : c_int = 11;
+            pub const MADV_MERGEABLE : c_int = 12;
+            pub const MADV_UNMERGEABLE : c_int = 13;
+            pub const MADV_HWPOISON : c_int = 100;
+
+            pub const IFF_LOOPBACK: c_int = 0x8;
+
+            pub const AF_UNIX: c_int = 1;
+            pub const AF_INET: c_int = 2;
+            pub const AF_INET6: c_int = 10;
+            pub const SOCK_STREAM: c_int = 1;
+            pub const SOCK_DGRAM: c_int = 2;
+            pub const SOCK_RAW: c_int = 3;
+            pub const IPPROTO_TCP: c_int = 6;
+            pub const IPPROTO_IP: c_int = 0;
+            pub const IPPROTO_IPV6: c_int = 41;
+            pub const IP_MULTICAST_TTL: c_int = 33;
+            pub const IP_MULTICAST_LOOP: c_int = 34;
+            pub const IP_TTL: c_int = 2;
+            pub const IP_HDRINCL: c_int = 3;
+            pub const IP_ADD_MEMBERSHIP: c_int = 35;
+            pub const IP_DROP_MEMBERSHIP: c_int = 36;
+            pub const IPV6_ADD_MEMBERSHIP: c_int = 20;
+            pub const IPV6_DROP_MEMBERSHIP: c_int = 21;
+
+            pub const TCP_NODELAY: c_int = 1;
+            pub const SOL_SOCKET: c_int = 1;
+            pub const SO_KEEPALIVE: c_int = 9;
+            pub const SO_BROADCAST: c_int = 6;
+            pub const SO_REUSEADDR: c_int = 2;
+            pub const SO_ERROR: c_int = 4;
+
+            pub const SHUT_RD: c_int = 0;
+            pub const SHUT_WR: c_int = 1;
+            pub const SHUT_RDWR: c_int = 2;
         }
         #[cfg(any(target_arch = "mips", target_arch = "mipsel"))]
         pub mod bsd44 {
             use types::os::arch::c95::c_int;
 
-            pub static MADV_NORMAL : c_int = 0;
-            pub static MADV_RANDOM : c_int = 1;
-            pub static MADV_SEQUENTIAL : c_int = 2;
-            pub static MADV_WILLNEED : c_int = 3;
-            pub static MADV_DONTNEED : c_int = 4;
-            pub static MADV_REMOVE : c_int = 9;
-            pub static MADV_DONTFORK : c_int = 10;
-            pub static MADV_DOFORK : c_int = 11;
-            pub static MADV_MERGEABLE : c_int = 12;
-            pub static MADV_UNMERGEABLE : c_int = 13;
-            pub static MADV_HWPOISON : c_int = 100;
-
-            pub static AF_UNIX: c_int = 1;
-            pub static AF_INET: c_int = 2;
-            pub static AF_INET6: c_int = 10;
-            pub static SOCK_STREAM: c_int = 2;
-            pub static SOCK_DGRAM: c_int = 1;
-            pub static SOCK_RAW: c_int = 3;
-            pub static IPPROTO_TCP: c_int = 6;
-            pub static IPPROTO_IP: c_int = 0;
-            pub static IPPROTO_IPV6: c_int = 41;
-            pub static IP_MULTICAST_TTL: c_int = 33;
-            pub static IP_MULTICAST_LOOP: c_int = 34;
-            pub static IP_TTL: c_int = 2;
-            pub static IP_HDRINCL: c_int = 3;
-            pub static IP_ADD_MEMBERSHIP: c_int = 35;
-            pub static IP_DROP_MEMBERSHIP: c_int = 36;
-            pub static IPV6_ADD_MEMBERSHIP: c_int = 20;
-            pub static IPV6_DROP_MEMBERSHIP: c_int = 21;
-
-            pub static TCP_NODELAY: c_int = 1;
-            pub static SOL_SOCKET: c_int = 65535;
-            pub static SO_KEEPALIVE: c_int = 8;
-            pub static SO_BROADCAST: c_int = 32;
-            pub static SO_REUSEADDR: c_int = 4;
-            pub static SO_ERROR: c_int = 4103;
-
-            pub static SHUT_RD: c_int = 0;
-            pub static SHUT_WR: c_int = 1;
-            pub static SHUT_RDWR: c_int = 2;
+            pub const MADV_NORMAL : c_int = 0;
+            pub const MADV_RANDOM : c_int = 1;
+            pub const MADV_SEQUENTIAL : c_int = 2;
+            pub const MADV_WILLNEED : c_int = 3;
+            pub const MADV_DONTNEED : c_int = 4;
+            pub const MADV_REMOVE : c_int = 9;
+            pub const MADV_DONTFORK : c_int = 10;
+            pub const MADV_DOFORK : c_int = 11;
+            pub const MADV_MERGEABLE : c_int = 12;
+            pub const MADV_UNMERGEABLE : c_int = 13;
+            pub const MADV_HWPOISON : c_int = 100;
+
+            pub const AF_UNIX: c_int = 1;
+            pub const AF_INET: c_int = 2;
+            pub const AF_INET6: c_int = 10;
+            pub const SOCK_STREAM: c_int = 2;
+            pub const SOCK_DGRAM: c_int = 1;
+            pub const SOCK_RAW: c_int = 3;
+            pub const IPPROTO_TCP: c_int = 6;
+            pub const IPPROTO_IP: c_int = 0;
+            pub const IPPROTO_IPV6: c_int = 41;
+            pub const IP_MULTICAST_TTL: c_int = 33;
+            pub const IP_MULTICAST_LOOP: c_int = 34;
+            pub const IP_TTL: c_int = 2;
+            pub const IP_HDRINCL: c_int = 3;
+            pub const IP_ADD_MEMBERSHIP: c_int = 35;
+            pub const IP_DROP_MEMBERSHIP: c_int = 36;
+            pub const IPV6_ADD_MEMBERSHIP: c_int = 20;
+            pub const IPV6_DROP_MEMBERSHIP: c_int = 21;
+
+            pub const TCP_NODELAY: c_int = 1;
+            pub const SOL_SOCKET: c_int = 65535;
+            pub const SO_KEEPALIVE: c_int = 8;
+            pub const SO_BROADCAST: c_int = 32;
+            pub const SO_REUSEADDR: c_int = 4;
+            pub const SO_ERROR: c_int = 4103;
+
+            pub const SHUT_RD: c_int = 0;
+            pub const SHUT_WR: c_int = 1;
+            pub const SHUT_RDWR: c_int = 2;
         }
         #[cfg(any(target_arch = "x86",
                   target_arch = "x86_64",
@@ -3006,149 +3006,149 @@ pub mod consts {
         pub mod extra {
             use types::os::arch::c95::c_int;
 
-            pub static AF_PACKET : c_int = 17;
-            pub static IPPROTO_RAW : c_int = 255;
-
-            pub static O_RSYNC : c_int = 1052672;
-            pub static O_DSYNC : c_int = 4096;
-            pub static O_NONBLOCK : c_int = 2048;
-            pub static O_SYNC : c_int = 1052672;
-
-            pub static PROT_GROWSDOWN : c_int = 0x010000000;
-            pub static PROT_GROWSUP : c_int = 0x020000000;
-
-            pub static MAP_TYPE : c_int = 0x000f;
-            pub static MAP_ANONYMOUS : c_int = 0x0020;
-            pub static MAP_32BIT : c_int = 0x0040;
-            pub static MAP_GROWSDOWN : c_int = 0x0100;
-            pub static MAP_DENYWRITE : c_int = 0x0800;
-            pub static MAP_EXECUTABLE : c_int = 0x01000;
-            pub static MAP_LOCKED : c_int = 0x02000;
-            pub static MAP_NONRESERVE : c_int = 0x04000;
-            pub static MAP_POPULATE : c_int = 0x08000;
-            pub static MAP_NONBLOCK : c_int = 0x010000;
-            pub static MAP_STACK : c_int = 0x020000;
+            pub const AF_PACKET : c_int = 17;
+            pub const IPPROTO_RAW : c_int = 255;
+
+            pub const O_RSYNC : c_int = 1052672;
+            pub const O_DSYNC : c_int = 4096;
+            pub const O_NONBLOCK : c_int = 2048;
+            pub const O_SYNC : c_int = 1052672;
+
+            pub const PROT_GROWSDOWN : c_int = 0x010000000;
+            pub const PROT_GROWSUP : c_int = 0x020000000;
+
+            pub const MAP_TYPE : c_int = 0x000f;
+            pub const MAP_ANONYMOUS : c_int = 0x0020;
+            pub const MAP_32BIT : c_int = 0x0040;
+            pub const MAP_GROWSDOWN : c_int = 0x0100;
+            pub const MAP_DENYWRITE : c_int = 0x0800;
+            pub const MAP_EXECUTABLE : c_int = 0x01000;
+            pub const MAP_LOCKED : c_int = 0x02000;
+            pub const MAP_NONRESERVE : c_int = 0x04000;
+            pub const MAP_POPULATE : c_int = 0x08000;
+            pub const MAP_NONBLOCK : c_int = 0x010000;
+            pub const MAP_STACK : c_int = 0x020000;
         }
         #[cfg(any(target_arch = "mips", target_arch = "mipsel"))]
         pub mod extra {
             use types::os::arch::c95::c_int;
 
-            pub static AF_PACKET : c_int = 17;
-            pub static IPPROTO_RAW : c_int = 255;
-
-            pub static O_RSYNC : c_int = 16400;
-            pub static O_DSYNC : c_int = 16;
-            pub static O_NONBLOCK : c_int = 128;
-            pub static O_SYNC : c_int = 16400;
-
-            pub static PROT_GROWSDOWN : c_int = 0x01000000;
-            pub static PROT_GROWSUP : c_int = 0x02000000;
-
-            pub static MAP_TYPE : c_int = 0x000f;
-            pub static MAP_ANONYMOUS : c_int = 0x0800;
-            pub static MAP_GROWSDOWN : c_int = 0x01000;
-            pub static MAP_DENYWRITE : c_int = 0x02000;
-            pub static MAP_EXECUTABLE : c_int = 0x04000;
-            pub static MAP_LOCKED : c_int = 0x08000;
-            pub static MAP_NONRESERVE : c_int = 0x0400;
-            pub static MAP_POPULATE : c_int = 0x010000;
-            pub static MAP_NONBLOCK : c_int = 0x020000;
-            pub static MAP_STACK : c_int = 0x040000;
+            pub const AF_PACKET : c_int = 17;
+            pub const IPPROTO_RAW : c_int = 255;
+
+            pub const O_RSYNC : c_int = 16400;
+            pub const O_DSYNC : c_int = 16;
+            pub const O_NONBLOCK : c_int = 128;
+            pub const O_SYNC : c_int = 16400;
+
+            pub const PROT_GROWSDOWN : c_int = 0x01000000;
+            pub const PROT_GROWSUP : c_int = 0x02000000;
+
+            pub const MAP_TYPE : c_int = 0x000f;
+            pub const MAP_ANONYMOUS : c_int = 0x0800;
+            pub const MAP_GROWSDOWN : c_int = 0x01000;
+            pub const MAP_DENYWRITE : c_int = 0x02000;
+            pub const MAP_EXECUTABLE : c_int = 0x04000;
+            pub const MAP_LOCKED : c_int = 0x08000;
+            pub const MAP_NONRESERVE : c_int = 0x0400;
+            pub const MAP_POPULATE : c_int = 0x010000;
+            pub const MAP_NONBLOCK : c_int = 0x020000;
+            pub const MAP_STACK : c_int = 0x040000;
         }
         #[cfg(target_os = "linux")]
         pub mod sysconf {
             use types::os::arch::c95::c_int;
 
-            pub static _SC_ARG_MAX : c_int = 0;
-            pub static _SC_CHILD_MAX : c_int = 1;
-            pub static _SC_CLK_TCK : c_int = 2;
-            pub static _SC_NGROUPS_MAX : c_int = 3;
-            pub static _SC_OPEN_MAX : c_int = 4;
-            pub static _SC_STREAM_MAX : c_int = 5;
-            pub static _SC_TZNAME_MAX : c_int = 6;
-            pub static _SC_JOB_CONTROL : c_int = 7;
-            pub static _SC_SAVED_IDS : c_int = 8;
-            pub static _SC_REALTIME_SIGNALS : c_int = 9;
-            pub static _SC_PRIORITY_SCHEDULING : c_int = 10;
-            pub static _SC_TIMERS : c_int = 11;
-            pub static _SC_ASYNCHRONOUS_IO : c_int = 12;
-            pub static _SC_PRIORITIZED_IO : c_int = 13;
-            pub static _SC_SYNCHRONIZED_IO : c_int = 14;
-            pub static _SC_FSYNC : c_int = 15;
-            pub static _SC_MAPPED_FILES : c_int = 16;
-            pub static _SC_MEMLOCK : c_int = 17;
-            pub static _SC_MEMLOCK_RANGE : c_int = 18;
-            pub static _SC_MEMORY_PROTECTION : c_int = 19;
-            pub static _SC_MESSAGE_PASSING : c_int = 20;
-            pub static _SC_SEMAPHORES : c_int = 21;
-            pub static _SC_SHARED_MEMORY_OBJECTS : c_int = 22;
-            pub static _SC_AIO_LISTIO_MAX : c_int = 23;
-            pub static _SC_AIO_MAX : c_int = 24;
-            pub static _SC_AIO_PRIO_DELTA_MAX : c_int = 25;
-            pub static _SC_DELAYTIMER_MAX : c_int = 26;
-            pub static _SC_MQ_OPEN_MAX : c_int = 27;
-            pub static _SC_VERSION : c_int = 29;
-            pub static _SC_PAGESIZE : c_int = 30;
-            pub static _SC_RTSIG_MAX : c_int = 31;
-            pub static _SC_SEM_NSEMS_MAX : c_int = 32;
-            pub static _SC_SEM_VALUE_MAX : c_int = 33;
-            pub static _SC_SIGQUEUE_MAX : c_int = 34;
-            pub static _SC_TIMER_MAX : c_int = 35;
-            pub static _SC_BC_BASE_MAX : c_int = 36;
-            pub static _SC_BC_DIM_MAX : c_int = 37;
-            pub static _SC_BC_SCALE_MAX : c_int = 38;
-            pub static _SC_BC_STRING_MAX : c_int = 39;
-            pub static _SC_COLL_WEIGHTS_MAX : c_int = 40;
-            pub static _SC_EXPR_NEST_MAX : c_int = 42;
-            pub static _SC_LINE_MAX : c_int = 43;
-            pub static _SC_RE_DUP_MAX : c_int = 44;
-            pub static _SC_2_VERSION : c_int = 46;
-            pub static _SC_2_C_BIND : c_int = 47;
-            pub static _SC_2_C_DEV : c_int = 48;
-            pub static _SC_2_FORT_DEV : c_int = 49;
-            pub static _SC_2_FORT_RUN : c_int = 50;
-            pub static _SC_2_SW_DEV : c_int = 51;
-            pub static _SC_2_LOCALEDEF : c_int = 52;
-            pub static _SC_2_CHAR_TERM : c_int = 95;
-            pub static _SC_2_C_VERSION : c_int = 96;
-            pub static _SC_2_UPE : c_int = 97;
-            pub static _SC_XBS5_ILP32_OFF32 : c_int = 125;
-            pub static _SC_XBS5_ILP32_OFFBIG : c_int = 126;
-            pub static _SC_XBS5_LPBIG_OFFBIG : c_int = 128;
+            pub const _SC_ARG_MAX : c_int = 0;
+            pub const _SC_CHILD_MAX : c_int = 1;
+            pub const _SC_CLK_TCK : c_int = 2;
+            pub const _SC_NGROUPS_MAX : c_int = 3;
+            pub const _SC_OPEN_MAX : c_int = 4;
+            pub const _SC_STREAM_MAX : c_int = 5;
+            pub const _SC_TZNAME_MAX : c_int = 6;
+            pub const _SC_JOB_CONTROL : c_int = 7;
+            pub const _SC_SAVED_IDS : c_int = 8;
+            pub const _SC_REALTIME_SIGNALS : c_int = 9;
+            pub const _SC_PRIORITY_SCHEDULING : c_int = 10;
+            pub const _SC_TIMERS : c_int = 11;
+            pub const _SC_ASYNCHRONOUS_IO : c_int = 12;
+            pub const _SC_PRIORITIZED_IO : c_int = 13;
+            pub const _SC_SYNCHRONIZED_IO : c_int = 14;
+            pub const _SC_FSYNC : c_int = 15;
+            pub const _SC_MAPPED_FILES : c_int = 16;
+            pub const _SC_MEMLOCK : c_int = 17;
+            pub const _SC_MEMLOCK_RANGE : c_int = 18;
+            pub const _SC_MEMORY_PROTECTION : c_int = 19;
+            pub const _SC_MESSAGE_PASSING : c_int = 20;
+            pub const _SC_SEMAPHORES : c_int = 21;
+            pub const _SC_SHARED_MEMORY_OBJECTS : c_int = 22;
+            pub const _SC_AIO_LISTIO_MAX : c_int = 23;
+            pub const _SC_AIO_MAX : c_int = 24;
+            pub const _SC_AIO_PRIO_DELTA_MAX : c_int = 25;
+            pub const _SC_DELAYTIMER_MAX : c_int = 26;
+            pub const _SC_MQ_OPEN_MAX : c_int = 27;
+            pub const _SC_VERSION : c_int = 29;
+            pub const _SC_PAGESIZE : c_int = 30;
+            pub const _SC_RTSIG_MAX : c_int = 31;
+            pub const _SC_SEM_NSEMS_MAX : c_int = 32;
+            pub const _SC_SEM_VALUE_MAX : c_int = 33;
+            pub const _SC_SIGQUEUE_MAX : c_int = 34;
+            pub const _SC_TIMER_MAX : c_int = 35;
+            pub const _SC_BC_BASE_MAX : c_int = 36;
+            pub const _SC_BC_DIM_MAX : c_int = 37;
+            pub const _SC_BC_SCALE_MAX : c_int = 38;
+            pub const _SC_BC_STRING_MAX : c_int = 39;
+            pub const _SC_COLL_WEIGHTS_MAX : c_int = 40;
+            pub const _SC_EXPR_NEST_MAX : c_int = 42;
+            pub const _SC_LINE_MAX : c_int = 43;
+            pub const _SC_RE_DUP_MAX : c_int = 44;
+            pub const _SC_2_VERSION : c_int = 46;
+            pub const _SC_2_C_BIND : c_int = 47;
+            pub const _SC_2_C_DEV : c_int = 48;
+            pub const _SC_2_FORT_DEV : c_int = 49;
+            pub const _SC_2_FORT_RUN : c_int = 50;
+            pub const _SC_2_SW_DEV : c_int = 51;
+            pub const _SC_2_LOCALEDEF : c_int = 52;
+            pub const _SC_2_CHAR_TERM : c_int = 95;
+            pub const _SC_2_C_VERSION : c_int = 96;
+            pub const _SC_2_UPE : c_int = 97;
+            pub const _SC_XBS5_ILP32_OFF32 : c_int = 125;
+            pub const _SC_XBS5_ILP32_OFFBIG : c_int = 126;
+            pub const _SC_XBS5_LPBIG_OFFBIG : c_int = 128;
         }
         #[cfg(target_os = "android")]
         pub mod sysconf {
             use types::os::arch::c95::c_int;
 
-            pub static _SC_ARG_MAX : c_int = 0;
-            pub static _SC_BC_BASE_MAX : c_int = 1;
-            pub static _SC_BC_DIM_MAX : c_int = 2;
-            pub static _SC_BC_SCALE_MAX : c_int = 3;
-            pub static _SC_BC_STRING_MAX : c_int = 4;
-            pub static _SC_CHILD_MAX : c_int = 5;
-            pub static _SC_CLK_TCK : c_int = 6;
-            pub static _SC_COLL_WEIGHTS_MAX : c_int = 7;
-            pub static _SC_EXPR_NEST_MAX : c_int = 8;
-            pub static _SC_LINE_MAX : c_int = 9;
-            pub static _SC_NGROUPS_MAX : c_int = 10;
-            pub static _SC_OPEN_MAX : c_int = 11;
-            pub static _SC_2_C_BIND : c_int = 13;
-            pub static _SC_2_C_DEV : c_int = 14;
-            pub static _SC_2_C_VERSION : c_int = 15;
-            pub static _SC_2_CHAR_TERM : c_int = 16;
-            pub static _SC_2_FORT_DEV : c_int = 17;
-            pub static _SC_2_FORT_RUN : c_int = 18;
-            pub static _SC_2_LOCALEDEF : c_int = 19;
-            pub static _SC_2_SW_DEV : c_int = 20;
-            pub static _SC_2_UPE : c_int = 21;
-            pub static _SC_2_VERSION : c_int = 22;
-            pub static _SC_JOB_CONTROL : c_int = 23;
-            pub static _SC_SAVED_IDS : c_int = 24;
-            pub static _SC_VERSION : c_int = 25;
-            pub static _SC_RE_DUP_MAX : c_int = 26;
-            pub static _SC_STREAM_MAX : c_int = 27;
-            pub static _SC_TZNAME_MAX : c_int = 28;
-            pub static _SC_PAGESIZE : c_int = 39;
+            pub const _SC_ARG_MAX : c_int = 0;
+            pub const _SC_BC_BASE_MAX : c_int = 1;
+            pub const _SC_BC_DIM_MAX : c_int = 2;
+            pub const _SC_BC_SCALE_MAX : c_int = 3;
+            pub const _SC_BC_STRING_MAX : c_int = 4;
+            pub const _SC_CHILD_MAX : c_int = 5;
+            pub const _SC_CLK_TCK : c_int = 6;
+            pub const _SC_COLL_WEIGHTS_MAX : c_int = 7;
+            pub const _SC_EXPR_NEST_MAX : c_int = 8;
+            pub const _SC_LINE_MAX : c_int = 9;
+            pub const _SC_NGROUPS_MAX : c_int = 10;
+            pub const _SC_OPEN_MAX : c_int = 11;
+            pub const _SC_2_C_BIND : c_int = 13;
+            pub const _SC_2_C_DEV : c_int = 14;
+            pub const _SC_2_C_VERSION : c_int = 15;
+            pub const _SC_2_CHAR_TERM : c_int = 16;
+            pub const _SC_2_FORT_DEV : c_int = 17;
+            pub const _SC_2_FORT_RUN : c_int = 18;
+            pub const _SC_2_LOCALEDEF : c_int = 19;
+            pub const _SC_2_SW_DEV : c_int = 20;
+            pub const _SC_2_UPE : c_int = 21;
+            pub const _SC_2_VERSION : c_int = 22;
+            pub const _SC_JOB_CONTROL : c_int = 23;
+            pub const _SC_SAVED_IDS : c_int = 24;
+            pub const _SC_VERSION : c_int = 25;
+            pub const _SC_RE_DUP_MAX : c_int = 26;
+            pub const _SC_STREAM_MAX : c_int = 27;
+            pub const _SC_TZNAME_MAX : c_int = 28;
+            pub const _SC_PAGESIZE : c_int = 39;
         }
     }
 
@@ -3157,21 +3157,21 @@ pub mod consts {
         pub mod c95 {
             use types::os::arch::c95::{c_int, c_uint};
 
-            pub static EXIT_FAILURE : c_int = 1;
-            pub static EXIT_SUCCESS : c_int = 0;
-            pub static RAND_MAX : c_int = 2147483647;
-            pub static EOF : c_int = -1;
-            pub static SEEK_SET : c_int = 0;
-            pub static SEEK_CUR : c_int = 1;
-            pub static SEEK_END : c_int = 2;
-            pub static _IOFBF : c_int = 0;
-            pub static _IONBF : c_int = 2;
-            pub static _IOLBF : c_int = 1;
-            pub static BUFSIZ : c_uint = 1024_u32;
-            pub static FOPEN_MAX : c_uint = 20_u32;
-            pub static FILENAME_MAX : c_uint = 1024_u32;
-            pub static L_tmpnam : c_uint = 1024_u32;
-            pub static TMP_MAX : c_uint = 308915776_u32;
+            pub const EXIT_FAILURE : c_int = 1;
+            pub const EXIT_SUCCESS : c_int = 0;
+            pub const RAND_MAX : c_int = 2147483647;
+            pub const EOF : c_int = -1;
+            pub const SEEK_SET : c_int = 0;
+            pub const SEEK_CUR : c_int = 1;
+            pub const SEEK_END : c_int = 2;
+            pub const _IOFBF : c_int = 0;
+            pub const _IONBF : c_int = 2;
+            pub const _IOLBF : c_int = 1;
+            pub const BUFSIZ : c_uint = 1024_u32;
+            pub const FOPEN_MAX : c_uint = 20_u32;
+            pub const FILENAME_MAX : c_uint = 1024_u32;
+            pub const L_tmpnam : c_uint = 1024_u32;
+            pub const TMP_MAX : c_uint = 308915776_u32;
         }
         pub mod c99 {
         }
@@ -3180,384 +3180,384 @@ pub mod consts {
             use types::os::arch::c95::c_int;
             use types::os::arch::posix88::mode_t;
 
-            pub static O_RDONLY : c_int = 0;
-            pub static O_WRONLY : c_int = 1;
-            pub static O_RDWR : c_int = 2;
-            pub static O_APPEND : c_int = 8;
-            pub static O_CREAT : c_int = 512;
-            pub static O_EXCL : c_int = 2048;
-            pub static O_TRUNC : c_int = 1024;
-            pub static S_IFIFO : mode_t = 4096;
-            pub static S_IFCHR : mode_t = 8192;
-            pub static S_IFBLK : mode_t = 24576;
-            pub static S_IFDIR : mode_t = 16384;
-            pub static S_IFREG : mode_t = 32768;
-            pub static S_IFLNK : mode_t = 40960;
-            pub static S_IFMT : mode_t = 61440;
-            pub static S_IEXEC : mode_t = 64;
-            pub static S_IWRITE : mode_t = 128;
-            pub static S_IREAD : mode_t = 256;
-            pub static S_IRWXU : mode_t = 448;
-            pub static S_IXUSR : mode_t = 64;
-            pub static S_IWUSR : mode_t = 128;
-            pub static S_IRUSR : mode_t = 256;
-            pub static F_OK : c_int = 0;
-            pub static R_OK : c_int = 4;
-            pub static W_OK : c_int = 2;
-            pub static X_OK : c_int = 1;
-            pub static STDIN_FILENO : c_int = 0;
-            pub static STDOUT_FILENO : c_int = 1;
-            pub static STDERR_FILENO : c_int = 2;
-            pub static F_LOCK : c_int = 1;
-            pub static F_TEST : c_int = 3;
-            pub static F_TLOCK : c_int = 2;
-            pub static F_ULOCK : c_int = 0;
-            pub static SIGHUP : c_int = 1;
-            pub static SIGINT : c_int = 2;
-            pub static SIGQUIT : c_int = 3;
-            pub static SIGILL : c_int = 4;
-            pub static SIGABRT : c_int = 6;
-            pub static SIGFPE : c_int = 8;
-            pub static SIGKILL : c_int = 9;
-            pub static SIGSEGV : c_int = 11;
-            pub static SIGPIPE : c_int = 13;
-            pub static SIGALRM : c_int = 14;
-            pub static SIGTERM : c_int = 15;
-
-            pub static PROT_NONE : c_int = 0;
-            pub static PROT_READ : c_int = 1;
-            pub static PROT_WRITE : c_int = 2;
-            pub static PROT_EXEC : c_int = 4;
-
-            pub static MAP_FILE : c_int = 0x0000;
-            pub static MAP_SHARED : c_int = 0x0001;
-            pub static MAP_PRIVATE : c_int = 0x0002;
-            pub static MAP_FIXED : c_int = 0x0010;
-            pub static MAP_ANON : c_int = 0x1000;
-
-            pub static MAP_FAILED : *mut c_void = -1 as *mut c_void;
-
-            pub static MCL_CURRENT : c_int = 0x0001;
-            pub static MCL_FUTURE : c_int = 0x0002;
-
-            pub static MS_SYNC : c_int = 0x0000;
-            pub static MS_ASYNC : c_int = 0x0001;
-            pub static MS_INVALIDATE : c_int = 0x0002;
-
-            pub static EPERM : c_int = 1;
-            pub static ENOENT : c_int = 2;
-            pub static ESRCH : c_int = 3;
-            pub static EINTR : c_int = 4;
-            pub static EIO : c_int = 5;
-            pub static ENXIO : c_int = 6;
-            pub static E2BIG : c_int = 7;
-            pub static ENOEXEC : c_int = 8;
-            pub static EBADF : c_int = 9;
-            pub static ECHILD : c_int = 10;
-            pub static EDEADLK : c_int = 11;
-            pub static ENOMEM : c_int = 12;
-            pub static EACCES : c_int = 13;
-            pub static EFAULT : c_int = 14;
-            pub static ENOTBLK : c_int = 15;
-            pub static EBUSY : c_int = 16;
-            pub static EEXIST : c_int = 17;
-            pub static EXDEV : c_int = 18;
-            pub static ENODEV : c_int = 19;
-            pub static ENOTDIR : c_int = 20;
-            pub static EISDIR : c_int = 21;
-            pub static EINVAL : c_int = 22;
-            pub static ENFILE : c_int = 23;
-            pub static EMFILE : c_int = 24;
-            pub static ENOTTY : c_int = 25;
-            pub static ETXTBSY : c_int = 26;
-            pub static EFBIG : c_int = 27;
-            pub static ENOSPC : c_int = 28;
-            pub static ESPIPE : c_int = 29;
-            pub static EROFS : c_int = 30;
-            pub static EMLINK : c_int = 31;
-            pub static EPIPE : c_int = 32;
-            pub static EDOM : c_int = 33;
-            pub static ERANGE : c_int = 34;
-            pub static EAGAIN : c_int = 35;
-            pub static EWOULDBLOCK : c_int = 35;
-            pub static EINPROGRESS : c_int = 36;
-            pub static EALREADY : c_int = 37;
-            pub static ENOTSOCK : c_int = 38;
-            pub static EDESTADDRREQ : c_int = 39;
-            pub static EMSGSIZE : c_int = 40;
-            pub static EPROTOTYPE : c_int = 41;
-            pub static ENOPROTOOPT : c_int = 42;
-            pub static EPROTONOSUPPORT : c_int = 43;
-            pub static ESOCKTNOSUPPORT : c_int = 44;
-            pub static EOPNOTSUPP : c_int = 45;
-            pub static EPFNOSUPPORT : c_int = 46;
-            pub static EAFNOSUPPORT : c_int = 47;
-            pub static EADDRINUSE : c_int = 48;
-            pub static EADDRNOTAVAIL : c_int = 49;
-            pub static ENETDOWN : c_int = 50;
-            pub static ENETUNREACH : c_int = 51;
-            pub static ENETRESET : c_int = 52;
-            pub static ECONNABORTED : c_int = 53;
-            pub static ECONNRESET : c_int = 54;
-            pub static ENOBUFS : c_int = 55;
-            pub static EISCONN : c_int = 56;
-            pub static ENOTCONN : c_int = 57;
-            pub static ESHUTDOWN : c_int = 58;
-            pub static ETOOMANYREFS : c_int = 59;
-            pub static ETIMEDOUT : c_int = 60;
-            pub static ECONNREFUSED : c_int = 61;
-            pub static ELOOP : c_int = 62;
-            pub static ENAMETOOLONG : c_int = 63;
-            pub static EHOSTDOWN : c_int = 64;
-            pub static EHOSTUNREACH : c_int = 65;
-            pub static ENOTEMPTY : c_int = 66;
-            pub static EPROCLIM : c_int = 67;
-            pub static EUSERS : c_int = 68;
-            pub static EDQUOT : c_int = 69;
-            pub static ESTALE : c_int = 70;
-            pub static EREMOTE : c_int = 71;
-            pub static EBADRPC : c_int = 72;
-            pub static ERPCMISMATCH : c_int = 73;
-            pub static EPROGUNAVAIL : c_int = 74;
-            pub static EPROGMISMATCH : c_int = 75;
-            pub static EPROCUNAVAIL : c_int = 76;
-            pub static ENOLCK : c_int = 77;
-            pub static ENOSYS : c_int = 78;
-            pub static EFTYPE : c_int = 79;
-            pub static EAUTH : c_int = 80;
-            pub static ENEEDAUTH : c_int = 81;
-            pub static EIDRM : c_int = 82;
-            pub static ENOMSG : c_int = 83;
-            pub static EOVERFLOW : c_int = 84;
-            pub static ECANCELED : c_int = 85;
-            pub static EILSEQ : c_int = 86;
-            pub static ENOATTR : c_int = 87;
-            pub static EDOOFUS : c_int = 88;
-            pub static EBADMSG : c_int = 89;
-            pub static EMULTIHOP : c_int = 90;
-            pub static ENOLINK : c_int = 91;
-            pub static EPROTO : c_int = 92;
-            pub static ENOMEDIUM : c_int = 93;
-            pub static EUNUSED94 : c_int = 94;
-            pub static EUNUSED95 : c_int = 95;
-            pub static EUNUSED96 : c_int = 96;
-            pub static EUNUSED97 : c_int = 97;
-            pub static EUNUSED98 : c_int = 98;
-            pub static EASYNC : c_int = 99;
-            pub static ELAST : c_int = 99;
+            pub const O_RDONLY : c_int = 0;
+            pub const O_WRONLY : c_int = 1;
+            pub const O_RDWR : c_int = 2;
+            pub const O_APPEND : c_int = 8;
+            pub const O_CREAT : c_int = 512;
+            pub const O_EXCL : c_int = 2048;
+            pub const O_TRUNC : c_int = 1024;
+            pub const S_IFIFO : mode_t = 4096;
+            pub const S_IFCHR : mode_t = 8192;
+            pub const S_IFBLK : mode_t = 24576;
+            pub const S_IFDIR : mode_t = 16384;
+            pub const S_IFREG : mode_t = 32768;
+            pub const S_IFLNK : mode_t = 40960;
+            pub const S_IFMT : mode_t = 61440;
+            pub const S_IEXEC : mode_t = 64;
+            pub const S_IWRITE : mode_t = 128;
+            pub const S_IREAD : mode_t = 256;
+            pub const S_IRWXU : mode_t = 448;
+            pub const S_IXUSR : mode_t = 64;
+            pub const S_IWUSR : mode_t = 128;
+            pub const S_IRUSR : mode_t = 256;
+            pub const F_OK : c_int = 0;
+            pub const R_OK : c_int = 4;
+            pub const W_OK : c_int = 2;
+            pub const X_OK : c_int = 1;
+            pub const STDIN_FILENO : c_int = 0;
+            pub const STDOUT_FILENO : c_int = 1;
+            pub const STDERR_FILENO : c_int = 2;
+            pub const F_LOCK : c_int = 1;
+            pub const F_TEST : c_int = 3;
+            pub const F_TLOCK : c_int = 2;
+            pub const F_ULOCK : c_int = 0;
+            pub const SIGHUP : c_int = 1;
+            pub const SIGINT : c_int = 2;
+            pub const SIGQUIT : c_int = 3;
+            pub const SIGILL : c_int = 4;
+            pub const SIGABRT : c_int = 6;
+            pub const SIGFPE : c_int = 8;
+            pub const SIGKILL : c_int = 9;
+            pub const SIGSEGV : c_int = 11;
+            pub const SIGPIPE : c_int = 13;
+            pub const SIGALRM : c_int = 14;
+            pub const SIGTERM : c_int = 15;
+
+            pub const PROT_NONE : c_int = 0;
+            pub const PROT_READ : c_int = 1;
+            pub const PROT_WRITE : c_int = 2;
+            pub const PROT_EXEC : c_int = 4;
+
+            pub const MAP_FILE : c_int = 0x0000;
+            pub const MAP_SHARED : c_int = 0x0001;
+            pub const MAP_PRIVATE : c_int = 0x0002;
+            pub const MAP_FIXED : c_int = 0x0010;
+            pub const MAP_ANON : c_int = 0x1000;
+
+            pub const MAP_FAILED : *mut c_void = -1 as *mut c_void;
+
+            pub const MCL_CURRENT : c_int = 0x0001;
+            pub const MCL_FUTURE : c_int = 0x0002;
+
+            pub const MS_SYNC : c_int = 0x0000;
+            pub const MS_ASYNC : c_int = 0x0001;
+            pub const MS_INVALIDATE : c_int = 0x0002;
+
+            pub const EPERM : c_int = 1;
+            pub const ENOENT : c_int = 2;
+            pub const ESRCH : c_int = 3;
+            pub const EINTR : c_int = 4;
+            pub const EIO : c_int = 5;
+            pub const ENXIO : c_int = 6;
+            pub const E2BIG : c_int = 7;
+            pub const ENOEXEC : c_int = 8;
+            pub const EBADF : c_int = 9;
+            pub const ECHILD : c_int = 10;
+            pub const EDEADLK : c_int = 11;
+            pub const ENOMEM : c_int = 12;
+            pub const EACCES : c_int = 13;
+            pub const EFAULT : c_int = 14;
+            pub const ENOTBLK : c_int = 15;
+            pub const EBUSY : c_int = 16;
+            pub const EEXIST : c_int = 17;
+            pub const EXDEV : c_int = 18;
+            pub const ENODEV : c_int = 19;
+            pub const ENOTDIR : c_int = 20;
+            pub const EISDIR : c_int = 21;
+            pub const EINVAL : c_int = 22;
+            pub const ENFILE : c_int = 23;
+            pub const EMFILE : c_int = 24;
+            pub const ENOTTY : c_int = 25;
+            pub const ETXTBSY : c_int = 26;
+            pub const EFBIG : c_int = 27;
+            pub const ENOSPC : c_int = 28;
+            pub const ESPIPE : c_int = 29;
+            pub const EROFS : c_int = 30;
+            pub const EMLINK : c_int = 31;
+            pub const EPIPE : c_int = 32;
+            pub const EDOM : c_int = 33;
+            pub const ERANGE : c_int = 34;
+            pub const EAGAIN : c_int = 35;
+            pub const EWOULDBLOCK : c_int = 35;
+            pub const EINPROGRESS : c_int = 36;
+            pub const EALREADY : c_int = 37;
+            pub const ENOTSOCK : c_int = 38;
+            pub const EDESTADDRREQ : c_int = 39;
+            pub const EMSGSIZE : c_int = 40;
+            pub const EPROTOTYPE : c_int = 41;
+            pub const ENOPROTOOPT : c_int = 42;
+            pub const EPROTONOSUPPORT : c_int = 43;
+            pub const ESOCKTNOSUPPORT : c_int = 44;
+            pub const EOPNOTSUPP : c_int = 45;
+            pub const EPFNOSUPPORT : c_int = 46;
+            pub const EAFNOSUPPORT : c_int = 47;
+            pub const EADDRINUSE : c_int = 48;
+            pub const EADDRNOTAVAIL : c_int = 49;
+            pub const ENETDOWN : c_int = 50;
+            pub const ENETUNREACH : c_int = 51;
+            pub const ENETRESET : c_int = 52;
+            pub const ECONNABORTED : c_int = 53;
+            pub const ECONNRESET : c_int = 54;
+            pub const ENOBUFS : c_int = 55;
+            pub const EISCONN : c_int = 56;
+            pub const ENOTCONN : c_int = 57;
+            pub const ESHUTDOWN : c_int = 58;
+            pub const ETOOMANYREFS : c_int = 59;
+            pub const ETIMEDOUT : c_int = 60;
+            pub const ECONNREFUSED : c_int = 61;
+            pub const ELOOP : c_int = 62;
+            pub const ENAMETOOLONG : c_int = 63;
+            pub const EHOSTDOWN : c_int = 64;
+            pub const EHOSTUNREACH : c_int = 65;
+            pub const ENOTEMPTY : c_int = 66;
+            pub const EPROCLIM : c_int = 67;
+            pub const EUSERS : c_int = 68;
+            pub const EDQUOT : c_int = 69;
+            pub const ESTALE : c_int = 70;
+            pub const EREMOTE : c_int = 71;
+            pub const EBADRPC : c_int = 72;
+            pub const ERPCMISMATCH : c_int = 73;
+            pub const EPROGUNAVAIL : c_int = 74;
+            pub const EPROGMISMATCH : c_int = 75;
+            pub const EPROCUNAVAIL : c_int = 76;
+            pub const ENOLCK : c_int = 77;
+            pub const ENOSYS : c_int = 78;
+            pub const EFTYPE : c_int = 79;
+            pub const EAUTH : c_int = 80;
+            pub const ENEEDAUTH : c_int = 81;
+            pub const EIDRM : c_int = 82;
+            pub const ENOMSG : c_int = 83;
+            pub const EOVERFLOW : c_int = 84;
+            pub const ECANCELED : c_int = 85;
+            pub const EILSEQ : c_int = 86;
+            pub const ENOATTR : c_int = 87;
+            pub const EDOOFUS : c_int = 88;
+            pub const EBADMSG : c_int = 89;
+            pub const EMULTIHOP : c_int = 90;
+            pub const ENOLINK : c_int = 91;
+            pub const EPROTO : c_int = 92;
+            pub const ENOMEDIUM : c_int = 93;
+            pub const EUNUSED94 : c_int = 94;
+            pub const EUNUSED95 : c_int = 95;
+            pub const EUNUSED96 : c_int = 96;
+            pub const EUNUSED97 : c_int = 97;
+            pub const EUNUSED98 : c_int = 98;
+            pub const EASYNC : c_int = 99;
+            pub const ELAST : c_int = 99;
         }
         pub mod posix01 {
             use types::os::arch::c95::{c_int, size_t};
 
-            pub static F_DUPFD : c_int = 0;
-            pub static F_GETFD : c_int = 1;
-            pub static F_SETFD : c_int = 2;
-            pub static F_GETFL : c_int = 3;
-            pub static F_SETFL : c_int = 4;
-
-            pub static SIGTRAP : c_int = 5;
-            pub static SIGPIPE: c_int = 13;
-            pub static SIG_IGN: size_t = 1;
-
-            pub static GLOB_APPEND   : c_int = 0x0001;
-            pub static GLOB_DOOFFS   : c_int = 0x0002;
-            pub static GLOB_ERR      : c_int = 0x0004;
-            pub static GLOB_MARK     : c_int = 0x0008;
-            pub static GLOB_NOCHECK  : c_int = 0x0010;
-            pub static GLOB_NOSORT   : c_int = 0x0020;
-            pub static GLOB_NOESCAPE : c_int = 0x2000;
-
-            pub static GLOB_NOSPACE  : c_int = -1;
-            pub static GLOB_ABORTED  : c_int = -2;
-            pub static GLOB_NOMATCH  : c_int = -3;
-
-            pub static POSIX_MADV_NORMAL : c_int = 0;
-            pub static POSIX_MADV_RANDOM : c_int = 1;
-            pub static POSIX_MADV_SEQUENTIAL : c_int = 2;
-            pub static POSIX_MADV_WILLNEED : c_int = 3;
-            pub static POSIX_MADV_DONTNEED : c_int = 4;
-
-            pub static _SC_IOV_MAX : c_int = 56;
-            pub static _SC_GETGR_R_SIZE_MAX : c_int = 70;
-            pub static _SC_GETPW_R_SIZE_MAX : c_int = 71;
-            pub static _SC_LOGIN_NAME_MAX : c_int = 73;
-            pub static _SC_MQ_PRIO_MAX : c_int = 75;
-            pub static _SC_THREAD_ATTR_STACKADDR : c_int = 82;
-            pub static _SC_THREAD_ATTR_STACKSIZE : c_int = 83;
-            pub static _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 85;
-            pub static _SC_THREAD_KEYS_MAX : c_int = 86;
-            pub static _SC_THREAD_PRIO_INHERIT : c_int = 87;
-            pub static _SC_THREAD_PRIO_PROTECT : c_int = 88;
-            pub static _SC_THREAD_PRIORITY_SCHEDULING : c_int = 89;
-            pub static _SC_THREAD_PROCESS_SHARED : c_int = 90;
-            pub static _SC_THREAD_SAFE_FUNCTIONS : c_int = 91;
-            pub static _SC_THREAD_STACK_MIN : c_int = 93;
-            pub static _SC_THREAD_THREADS_MAX : c_int = 94;
-            pub static _SC_THREADS : c_int = 96;
-            pub static _SC_TTY_NAME_MAX : c_int = 101;
-            pub static _SC_ATEXIT_MAX : c_int = 107;
-            pub static _SC_XOPEN_CRYPT : c_int = 108;
-            pub static _SC_XOPEN_ENH_I18N : c_int = 109;
-            pub static _SC_XOPEN_LEGACY : c_int = 110;
-            pub static _SC_XOPEN_REALTIME : c_int = 111;
-            pub static _SC_XOPEN_REALTIME_THREADS : c_int = 112;
-            pub static _SC_XOPEN_SHM : c_int = 113;
-            pub static _SC_XOPEN_UNIX : c_int = 115;
-            pub static _SC_XOPEN_VERSION : c_int = 116;
-            pub static _SC_XOPEN_XCU_VERSION : c_int = 117;
-
-            pub static PTHREAD_CREATE_JOINABLE: c_int = 0;
-            pub static PTHREAD_CREATE_DETACHED: c_int = 1;
+            pub const F_DUPFD : c_int = 0;
+            pub const F_GETFD : c_int = 1;
+            pub const F_SETFD : c_int = 2;
+            pub const F_GETFL : c_int = 3;
+            pub const F_SETFL : c_int = 4;
+
+            pub const SIGTRAP : c_int = 5;
+            pub const SIGPIPE: c_int = 13;
+            pub const SIG_IGN: size_t = 1;
+
+            pub const GLOB_APPEND   : c_int = 0x0001;
+            pub const GLOB_DOOFFS   : c_int = 0x0002;
+            pub const GLOB_ERR      : c_int = 0x0004;
+            pub const GLOB_MARK     : c_int = 0x0008;
+            pub const GLOB_NOCHECK  : c_int = 0x0010;
+            pub const GLOB_NOSORT   : c_int = 0x0020;
+            pub const GLOB_NOESCAPE : c_int = 0x2000;
+
+            pub const GLOB_NOSPACE  : c_int = -1;
+            pub const GLOB_ABORTED  : c_int = -2;
+            pub const GLOB_NOMATCH  : c_int = -3;
+
+            pub const POSIX_MADV_NORMAL : c_int = 0;
+            pub const POSIX_MADV_RANDOM : c_int = 1;
+            pub const POSIX_MADV_SEQUENTIAL : c_int = 2;
+            pub const POSIX_MADV_WILLNEED : c_int = 3;
+            pub const POSIX_MADV_DONTNEED : c_int = 4;
+
+            pub const _SC_IOV_MAX : c_int = 56;
+            pub const _SC_GETGR_R_SIZE_MAX : c_int = 70;
+            pub const _SC_GETPW_R_SIZE_MAX : c_int = 71;
+            pub const _SC_LOGIN_NAME_MAX : c_int = 73;
+            pub const _SC_MQ_PRIO_MAX : c_int = 75;
+            pub const _SC_THREAD_ATTR_STACKADDR : c_int = 82;
+            pub const _SC_THREAD_ATTR_STACKSIZE : c_int = 83;
+            pub const _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 85;
+            pub const _SC_THREAD_KEYS_MAX : c_int = 86;
+            pub const _SC_THREAD_PRIO_INHERIT : c_int = 87;
+            pub const _SC_THREAD_PRIO_PROTECT : c_int = 88;
+            pub const _SC_THREAD_PRIORITY_SCHEDULING : c_int = 89;
+            pub const _SC_THREAD_PROCESS_SHARED : c_int = 90;
+            pub const _SC_THREAD_SAFE_FUNCTIONS : c_int = 91;
+            pub const _SC_THREAD_STACK_MIN : c_int = 93;
+            pub const _SC_THREAD_THREADS_MAX : c_int = 94;
+            pub const _SC_THREADS : c_int = 96;
+            pub const _SC_TTY_NAME_MAX : c_int = 101;
+            pub const _SC_ATEXIT_MAX : c_int = 107;
+            pub const _SC_XOPEN_CRYPT : c_int = 108;
+            pub const _SC_XOPEN_ENH_I18N : c_int = 109;
+            pub const _SC_XOPEN_LEGACY : c_int = 110;
+            pub const _SC_XOPEN_REALTIME : c_int = 111;
+            pub const _SC_XOPEN_REALTIME_THREADS : c_int = 112;
+            pub const _SC_XOPEN_SHM : c_int = 113;
+            pub const _SC_XOPEN_UNIX : c_int = 115;
+            pub const _SC_XOPEN_VERSION : c_int = 116;
+            pub const _SC_XOPEN_XCU_VERSION : c_int = 117;
+
+            pub const PTHREAD_CREATE_JOINABLE: c_int = 0;
+            pub const PTHREAD_CREATE_DETACHED: c_int = 1;
 
             #[cfg(target_arch = "arm")]
-            pub static PTHREAD_STACK_MIN: size_t = 4096;
+            pub const PTHREAD_STACK_MIN: size_t = 4096;
 
             #[cfg(all(target_os = "freebsd",
                       any(target_arch = "mips",
                           target_arch = "mipsel",
                           target_arch = "x86",
                           target_arch = "x86_64")))]
-            pub static PTHREAD_STACK_MIN: size_t = 2048;
+            pub const PTHREAD_STACK_MIN: size_t = 2048;
 
             #[cfg(target_os = "dragonfly")]
-            pub static PTHREAD_STACK_MIN: size_t = 1024;
+            pub const PTHREAD_STACK_MIN: size_t = 1024;
 
-            pub static CLOCK_REALTIME: c_int = 0;
-            pub static CLOCK_MONOTONIC: c_int = 4;
+            pub const CLOCK_REALTIME: c_int = 0;
+            pub const CLOCK_MONOTONIC: c_int = 4;
         }
         pub mod posix08 {
         }
         pub mod bsd44 {
             use types::os::arch::c95::c_int;
 
-            pub static MADV_NORMAL : c_int = 0;
-            pub static MADV_RANDOM : c_int = 1;
-            pub static MADV_SEQUENTIAL : c_int = 2;
-            pub static MADV_WILLNEED : c_int = 3;
-            pub static MADV_DONTNEED : c_int = 4;
-            pub static MADV_FREE : c_int = 5;
-            pub static MADV_NOSYNC : c_int = 6;
-            pub static MADV_AUTOSYNC : c_int = 7;
-            pub static MADV_NOCORE : c_int = 8;
-            pub static MADV_CORE : c_int = 9;
-            pub static MADV_PROTECT : c_int = 10;
-
-            pub static MINCORE_INCORE : c_int =  0x1;
-            pub static MINCORE_REFERENCED : c_int = 0x2;
-            pub static MINCORE_MODIFIED : c_int = 0x4;
-            pub static MINCORE_REFERENCED_OTHER : c_int = 0x8;
-            pub static MINCORE_MODIFIED_OTHER : c_int = 0x10;
-            pub static MINCORE_SUPER : c_int = 0x20;
-
-            pub static AF_INET: c_int = 2;
-            pub static AF_INET6: c_int = 28;
-            pub static AF_UNIX: c_int = 1;
-            pub static SOCK_STREAM: c_int = 1;
-            pub static SOCK_DGRAM: c_int = 2;
-            pub static SOCK_RAW: c_int = 3;
-            pub static IPPROTO_TCP: c_int = 6;
-            pub static IPPROTO_IP: c_int = 0;
-            pub static IPPROTO_IPV6: c_int = 41;
-            pub static IP_MULTICAST_TTL: c_int = 10;
-            pub static IP_MULTICAST_LOOP: c_int = 11;
-            pub static IP_TTL: c_int = 4;
-            pub static IP_HDRINCL: c_int = 2;
-            pub static IP_ADD_MEMBERSHIP: c_int = 12;
-            pub static IP_DROP_MEMBERSHIP: c_int = 13;
-            pub static IPV6_ADD_MEMBERSHIP: c_int = 12;
-            pub static IPV6_DROP_MEMBERSHIP: c_int = 13;
-
-            pub static TCP_NODELAY: c_int = 1;
-            pub static TCP_KEEPIDLE: c_int = 256;
-            pub static SOL_SOCKET: c_int = 0xffff;
-            pub static SO_KEEPALIVE: c_int = 0x0008;
-            pub static SO_BROADCAST: c_int = 0x0020;
-            pub static SO_REUSEADDR: c_int = 0x0004;
-            pub static SO_ERROR: c_int = 0x1007;
-
-            pub static IFF_LOOPBACK: c_int = 0x8;
-
-            pub static SHUT_RD: c_int = 0;
-            pub static SHUT_WR: c_int = 1;
-            pub static SHUT_RDWR: c_int = 2;
+            pub const MADV_NORMAL : c_int = 0;
+            pub const MADV_RANDOM : c_int = 1;
+            pub const MADV_SEQUENTIAL : c_int = 2;
+            pub const MADV_WILLNEED : c_int = 3;
+            pub const MADV_DONTNEED : c_int = 4;
+            pub const MADV_FREE : c_int = 5;
+            pub const MADV_NOSYNC : c_int = 6;
+            pub const MADV_AUTOSYNC : c_int = 7;
+            pub const MADV_NOCORE : c_int = 8;
+            pub const MADV_CORE : c_int = 9;
+            pub const MADV_PROTECT : c_int = 10;
+
+            pub const MINCORE_INCORE : c_int =  0x1;
+            pub const MINCORE_REFERENCED : c_int = 0x2;
+            pub const MINCORE_MODIFIED : c_int = 0x4;
+            pub const MINCORE_REFERENCED_OTHER : c_int = 0x8;
+            pub const MINCORE_MODIFIED_OTHER : c_int = 0x10;
+            pub const MINCORE_SUPER : c_int = 0x20;
+
+            pub const AF_INET: c_int = 2;
+            pub const AF_INET6: c_int = 28;
+            pub const AF_UNIX: c_int = 1;
+            pub const SOCK_STREAM: c_int = 1;
+            pub const SOCK_DGRAM: c_int = 2;
+            pub const SOCK_RAW: c_int = 3;
+            pub const IPPROTO_TCP: c_int = 6;
+            pub const IPPROTO_IP: c_int = 0;
+            pub const IPPROTO_IPV6: c_int = 41;
+            pub const IP_MULTICAST_TTL: c_int = 10;
+            pub const IP_MULTICAST_LOOP: c_int = 11;
+            pub const IP_TTL: c_int = 4;
+            pub const IP_HDRINCL: c_int = 2;
+            pub const IP_ADD_MEMBERSHIP: c_int = 12;
+            pub const IP_DROP_MEMBERSHIP: c_int = 13;
+            pub const IPV6_ADD_MEMBERSHIP: c_int = 12;
+            pub const IPV6_DROP_MEMBERSHIP: c_int = 13;
+
+            pub const TCP_NODELAY: c_int = 1;
+            pub const TCP_KEEPIDLE: c_int = 256;
+            pub const SOL_SOCKET: c_int = 0xffff;
+            pub const SO_KEEPALIVE: c_int = 0x0008;
+            pub const SO_BROADCAST: c_int = 0x0020;
+            pub const SO_REUSEADDR: c_int = 0x0004;
+            pub const SO_ERROR: c_int = 0x1007;
+
+            pub const IFF_LOOPBACK: c_int = 0x8;
+
+            pub const SHUT_RD: c_int = 0;
+            pub const SHUT_WR: c_int = 1;
+            pub const SHUT_RDWR: c_int = 2;
         }
         pub mod extra {
             use types::os::arch::c95::c_int;
 
-            pub static O_SYNC : c_int = 128;
-            pub static O_NONBLOCK : c_int = 4;
-            pub static CTL_KERN: c_int = 1;
-            pub static KERN_PROC: c_int = 14;
+            pub const O_SYNC : c_int = 128;
+            pub const O_NONBLOCK : c_int = 4;
+            pub const CTL_KERN: c_int = 1;
+            pub const KERN_PROC: c_int = 14;
             #[cfg(target_os = "freebsd")]
-            pub static KERN_PROC_PATHNAME: c_int = 12;
+            pub const KERN_PROC_PATHNAME: c_int = 12;
             #[cfg(target_os = "dragonfly")]
-            pub static KERN_PROC_PATHNAME: c_int = 9;
+            pub const KERN_PROC_PATHNAME: c_int = 9;
 
-            pub static MAP_COPY : c_int = 0x0002;
-            pub static MAP_RENAME : c_int = 0x0020;
-            pub static MAP_NORESERVE : c_int = 0x0040;
-            pub static MAP_HASSEMAPHORE : c_int = 0x0200;
-            pub static MAP_STACK : c_int = 0x0400;
-            pub static MAP_NOSYNC : c_int = 0x0800;
-            pub static MAP_NOCORE : c_int = 0x020000;
+            pub const MAP_COPY : c_int = 0x0002;
+            pub const MAP_RENAME : c_int = 0x0020;
+            pub const MAP_NORESERVE : c_int = 0x0040;
+            pub const MAP_HASSEMAPHORE : c_int = 0x0200;
+            pub const MAP_STACK : c_int = 0x0400;
+            pub const MAP_NOSYNC : c_int = 0x0800;
+            pub const MAP_NOCORE : c_int = 0x020000;
 
-            pub static IPPROTO_RAW : c_int = 255;
+            pub const IPPROTO_RAW : c_int = 255;
         }
         pub mod sysconf {
             use types::os::arch::c95::c_int;
 
-            pub static _SC_ARG_MAX : c_int = 1;
-            pub static _SC_CHILD_MAX : c_int = 2;
-            pub static _SC_CLK_TCK : c_int = 3;
-            pub static _SC_NGROUPS_MAX : c_int = 4;
-            pub static _SC_OPEN_MAX : c_int = 5;
-            pub static _SC_JOB_CONTROL : c_int = 6;
-            pub static _SC_SAVED_IDS : c_int = 7;
-            pub static _SC_VERSION : c_int = 8;
-            pub static _SC_BC_BASE_MAX : c_int = 9;
-            pub static _SC_BC_DIM_MAX : c_int = 10;
-            pub static _SC_BC_SCALE_MAX : c_int = 11;
-            pub static _SC_BC_STRING_MAX : c_int = 12;
-            pub static _SC_COLL_WEIGHTS_MAX : c_int = 13;
-            pub static _SC_EXPR_NEST_MAX : c_int = 14;
-            pub static _SC_LINE_MAX : c_int = 15;
-            pub static _SC_RE_DUP_MAX : c_int = 16;
-            pub static _SC_2_VERSION : c_int = 17;
-            pub static _SC_2_C_BIND : c_int = 18;
-            pub static _SC_2_C_DEV : c_int = 19;
-            pub static _SC_2_CHAR_TERM : c_int = 20;
-            pub static _SC_2_FORT_DEV : c_int = 21;
-            pub static _SC_2_FORT_RUN : c_int = 22;
-            pub static _SC_2_LOCALEDEF : c_int = 23;
-            pub static _SC_2_SW_DEV : c_int = 24;
-            pub static _SC_2_UPE : c_int = 25;
-            pub static _SC_STREAM_MAX : c_int = 26;
-            pub static _SC_TZNAME_MAX : c_int = 27;
-            pub static _SC_ASYNCHRONOUS_IO : c_int = 28;
-            pub static _SC_MAPPED_FILES : c_int = 29;
-            pub static _SC_MEMLOCK : c_int = 30;
-            pub static _SC_MEMLOCK_RANGE : c_int = 31;
-            pub static _SC_MEMORY_PROTECTION : c_int = 32;
-            pub static _SC_MESSAGE_PASSING : c_int = 33;
-            pub static _SC_PRIORITIZED_IO : c_int = 34;
-            pub static _SC_PRIORITY_SCHEDULING : c_int = 35;
-            pub static _SC_REALTIME_SIGNALS : c_int = 36;
-            pub static _SC_SEMAPHORES : c_int = 37;
-            pub static _SC_FSYNC : c_int = 38;
-            pub static _SC_SHARED_MEMORY_OBJECTS : c_int = 39;
-            pub static _SC_SYNCHRONIZED_IO : c_int = 40;
-            pub static _SC_TIMERS : c_int = 41;
-            pub static _SC_AIO_LISTIO_MAX : c_int = 42;
-            pub static _SC_AIO_MAX : c_int = 43;
-            pub static _SC_AIO_PRIO_DELTA_MAX : c_int = 44;
-            pub static _SC_DELAYTIMER_MAX : c_int = 45;
-            pub static _SC_MQ_OPEN_MAX : c_int = 46;
-            pub static _SC_PAGESIZE : c_int = 47;
-            pub static _SC_RTSIG_MAX : c_int = 48;
-            pub static _SC_SEM_NSEMS_MAX : c_int = 49;
-            pub static _SC_SEM_VALUE_MAX : c_int = 50;
-            pub static _SC_SIGQUEUE_MAX : c_int = 51;
-            pub static _SC_TIMER_MAX : c_int = 52;
+            pub const _SC_ARG_MAX : c_int = 1;
+            pub const _SC_CHILD_MAX : c_int = 2;
+            pub const _SC_CLK_TCK : c_int = 3;
+            pub const _SC_NGROUPS_MAX : c_int = 4;
+            pub const _SC_OPEN_MAX : c_int = 5;
+            pub const _SC_JOB_CONTROL : c_int = 6;
+            pub const _SC_SAVED_IDS : c_int = 7;
+            pub const _SC_VERSION : c_int = 8;
+            pub const _SC_BC_BASE_MAX : c_int = 9;
+            pub const _SC_BC_DIM_MAX : c_int = 10;
+            pub const _SC_BC_SCALE_MAX : c_int = 11;
+            pub const _SC_BC_STRING_MAX : c_int = 12;
+            pub const _SC_COLL_WEIGHTS_MAX : c_int = 13;
+            pub const _SC_EXPR_NEST_MAX : c_int = 14;
+            pub const _SC_LINE_MAX : c_int = 15;
+            pub const _SC_RE_DUP_MAX : c_int = 16;
+            pub const _SC_2_VERSION : c_int = 17;
+            pub const _SC_2_C_BIND : c_int = 18;
+            pub const _SC_2_C_DEV : c_int = 19;
+            pub const _SC_2_CHAR_TERM : c_int = 20;
+            pub const _SC_2_FORT_DEV : c_int = 21;
+            pub const _SC_2_FORT_RUN : c_int = 22;
+            pub const _SC_2_LOCALEDEF : c_int = 23;
+            pub const _SC_2_SW_DEV : c_int = 24;
+            pub const _SC_2_UPE : c_int = 25;
+            pub const _SC_STREAM_MAX : c_int = 26;
+            pub const _SC_TZNAME_MAX : c_int = 27;
+            pub const _SC_ASYNCHRONOUS_IO : c_int = 28;
+            pub const _SC_MAPPED_FILES : c_int = 29;
+            pub const _SC_MEMLOCK : c_int = 30;
+            pub const _SC_MEMLOCK_RANGE : c_int = 31;
+            pub const _SC_MEMORY_PROTECTION : c_int = 32;
+            pub const _SC_MESSAGE_PASSING : c_int = 33;
+            pub const _SC_PRIORITIZED_IO : c_int = 34;
+            pub const _SC_PRIORITY_SCHEDULING : c_int = 35;
+            pub const _SC_REALTIME_SIGNALS : c_int = 36;
+            pub const _SC_SEMAPHORES : c_int = 37;
+            pub const _SC_FSYNC : c_int = 38;
+            pub const _SC_SHARED_MEMORY_OBJECTS : c_int = 39;
+            pub const _SC_SYNCHRONIZED_IO : c_int = 40;
+            pub const _SC_TIMERS : c_int = 41;
+            pub const _SC_AIO_LISTIO_MAX : c_int = 42;
+            pub const _SC_AIO_MAX : c_int = 43;
+            pub const _SC_AIO_PRIO_DELTA_MAX : c_int = 44;
+            pub const _SC_DELAYTIMER_MAX : c_int = 45;
+            pub const _SC_MQ_OPEN_MAX : c_int = 46;
+            pub const _SC_PAGESIZE : c_int = 47;
+            pub const _SC_RTSIG_MAX : c_int = 48;
+            pub const _SC_SEM_NSEMS_MAX : c_int = 49;
+            pub const _SC_SEM_VALUE_MAX : c_int = 50;
+            pub const _SC_SIGQUEUE_MAX : c_int = 51;
+            pub const _SC_TIMER_MAX : c_int = 52;
         }
     }
 
@@ -3566,21 +3566,21 @@ pub mod consts {
         pub mod c95 {
             use types::os::arch::c95::{c_int, c_uint};
 
-            pub static EXIT_FAILURE : c_int = 1;
-            pub static EXIT_SUCCESS : c_int = 0;
-            pub static RAND_MAX : c_int = 2147483647;
-            pub static EOF : c_int = -1;
-            pub static SEEK_SET : c_int = 0;
-            pub static SEEK_CUR : c_int = 1;
-            pub static SEEK_END : c_int = 2;
-            pub static _IOFBF : c_int = 0;
-            pub static _IONBF : c_int = 2;
-            pub static _IOLBF : c_int = 1;
-            pub static BUFSIZ : c_uint = 1024_u32;
-            pub static FOPEN_MAX : c_uint = 20_u32;
-            pub static FILENAME_MAX : c_uint = 1024_u32;
-            pub static L_tmpnam : c_uint = 1024_u32;
-            pub static TMP_MAX : c_uint = 308915776_u32;
+            pub const EXIT_FAILURE : c_int = 1;
+            pub const EXIT_SUCCESS : c_int = 0;
+            pub const RAND_MAX : c_int = 2147483647;
+            pub const EOF : c_int = -1;
+            pub const SEEK_SET : c_int = 0;
+            pub const SEEK_CUR : c_int = 1;
+            pub const SEEK_END : c_int = 2;
+            pub const _IOFBF : c_int = 0;
+            pub const _IONBF : c_int = 2;
+            pub const _IOLBF : c_int = 1;
+            pub const BUFSIZ : c_uint = 1024_u32;
+            pub const FOPEN_MAX : c_uint = 20_u32;
+            pub const FILENAME_MAX : c_uint = 1024_u32;
+            pub const L_tmpnam : c_uint = 1024_u32;
+            pub const TMP_MAX : c_uint = 308915776_u32;
         }
         pub mod c99 {
         }
@@ -3589,378 +3589,378 @@ pub mod consts {
             use types::os::arch::c95::c_int;
             use types::os::arch::posix88::mode_t;
 
-            pub static O_RDONLY : c_int = 0;
-            pub static O_WRONLY : c_int = 1;
-            pub static O_RDWR : c_int = 2;
-            pub static O_APPEND : c_int = 8;
-            pub static O_CREAT : c_int = 512;
-            pub static O_EXCL : c_int = 2048;
-            pub static O_TRUNC : c_int = 1024;
-            pub static S_IFIFO : mode_t = 4096;
-            pub static S_IFCHR : mode_t = 8192;
-            pub static S_IFBLK : mode_t = 24576;
-            pub static S_IFDIR : mode_t = 16384;
-            pub static S_IFREG : mode_t = 32768;
-            pub static S_IFLNK : mode_t = 40960;
-            pub static S_IFMT : mode_t = 61440;
-            pub static S_IEXEC : mode_t = 64;
-            pub static S_IWRITE : mode_t = 128;
-            pub static S_IREAD : mode_t = 256;
-            pub static S_IRWXU : mode_t = 448;
-            pub static S_IXUSR : mode_t = 64;
-            pub static S_IWUSR : mode_t = 128;
-            pub static S_IRUSR : mode_t = 256;
-            pub static F_OK : c_int = 0;
-            pub static R_OK : c_int = 4;
-            pub static W_OK : c_int = 2;
-            pub static X_OK : c_int = 1;
-            pub static STDIN_FILENO : c_int = 0;
-            pub static STDOUT_FILENO : c_int = 1;
-            pub static STDERR_FILENO : c_int = 2;
-            pub static F_LOCK : c_int = 1;
-            pub static F_TEST : c_int = 3;
-            pub static F_TLOCK : c_int = 2;
-            pub static F_ULOCK : c_int = 0;
-            pub static SIGHUP : c_int = 1;
-            pub static SIGINT : c_int = 2;
-            pub static SIGQUIT : c_int = 3;
-            pub static SIGILL : c_int = 4;
-            pub static SIGABRT : c_int = 6;
-            pub static SIGFPE : c_int = 8;
-            pub static SIGKILL : c_int = 9;
-            pub static SIGSEGV : c_int = 11;
-            pub static SIGPIPE : c_int = 13;
-            pub static SIGALRM : c_int = 14;
-            pub static SIGTERM : c_int = 15;
-
-            pub static PROT_NONE : c_int = 0;
-            pub static PROT_READ : c_int = 1;
-            pub static PROT_WRITE : c_int = 2;
-            pub static PROT_EXEC : c_int = 4;
-
-            pub static MAP_FILE : c_int = 0x0000;
-            pub static MAP_SHARED : c_int = 0x0001;
-            pub static MAP_PRIVATE : c_int = 0x0002;
-            pub static MAP_FIXED : c_int = 0x0010;
-            pub static MAP_ANON : c_int = 0x1000;
-
-            pub static MAP_FAILED : *mut c_void = -1 as *mut c_void;
-
-            pub static MCL_CURRENT : c_int = 0x0001;
-            pub static MCL_FUTURE : c_int = 0x0002;
-
-            pub static MS_ASYNC : c_int = 0x0001;
-            pub static MS_INVALIDATE : c_int = 0x0002;
-            pub static MS_SYNC : c_int = 0x0010;
-
-            pub static MS_KILLPAGES : c_int = 0x0004;
-            pub static MS_DEACTIVATE : c_int = 0x0008;
-
-            pub static EPERM : c_int = 1;
-            pub static ENOENT : c_int = 2;
-            pub static ESRCH : c_int = 3;
-            pub static EINTR : c_int = 4;
-            pub static EIO : c_int = 5;
-            pub static ENXIO : c_int = 6;
-            pub static E2BIG : c_int = 7;
-            pub static ENOEXEC : c_int = 8;
-            pub static EBADF : c_int = 9;
-            pub static ECHILD : c_int = 10;
-            pub static EDEADLK : c_int = 11;
-            pub static ENOMEM : c_int = 12;
-            pub static EACCES : c_int = 13;
-            pub static EFAULT : c_int = 14;
-            pub static ENOTBLK : c_int = 15;
-            pub static EBUSY : c_int = 16;
-            pub static EEXIST : c_int = 17;
-            pub static EXDEV : c_int = 18;
-            pub static ENODEV : c_int = 19;
-            pub static ENOTDIR : c_int = 20;
-            pub static EISDIR : c_int = 21;
-            pub static EINVAL : c_int = 22;
-            pub static ENFILE : c_int = 23;
-            pub static EMFILE : c_int = 24;
-            pub static ENOTTY : c_int = 25;
-            pub static ETXTBSY : c_int = 26;
-            pub static EFBIG : c_int = 27;
-            pub static ENOSPC : c_int = 28;
-            pub static ESPIPE : c_int = 29;
-            pub static EROFS : c_int = 30;
-            pub static EMLINK : c_int = 31;
-            pub static EPIPE : c_int = 32;
-            pub static EDOM : c_int = 33;
-            pub static ERANGE : c_int = 34;
-            pub static EAGAIN : c_int = 35;
-            pub static EWOULDBLOCK : c_int = EAGAIN;
-            pub static EINPROGRESS : c_int = 36;
-            pub static EALREADY : c_int = 37;
-            pub static ENOTSOCK : c_int = 38;
-            pub static EDESTADDRREQ : c_int = 39;
-            pub static EMSGSIZE : c_int = 40;
-            pub static EPROTOTYPE : c_int = 41;
-            pub static ENOPROTOOPT : c_int = 42;
-            pub static EPROTONOSUPPORT : c_int = 43;
-            pub static ESOCKTNOSUPPORT : c_int = 44;
-            pub static ENOTSUP : c_int = 45;
-            pub static EPFNOSUPPORT : c_int = 46;
-            pub static EAFNOSUPPORT : c_int = 47;
-            pub static EADDRINUSE : c_int = 48;
-            pub static EADDRNOTAVAIL : c_int = 49;
-            pub static ENETDOWN : c_int = 50;
-            pub static ENETUNREACH : c_int = 51;
-            pub static ENETRESET : c_int = 52;
-            pub static ECONNABORTED : c_int = 53;
-            pub static ECONNRESET : c_int = 54;
-            pub static ENOBUFS : c_int = 55;
-            pub static EISCONN : c_int = 56;
-            pub static ENOTCONN : c_int = 57;
-            pub static ESHUTDOWN : c_int = 58;
-            pub static ETOOMANYREFS : c_int = 59;
-            pub static ETIMEDOUT : c_int = 60;
-            pub static ECONNREFUSED : c_int = 61;
-            pub static ELOOP : c_int = 62;
-            pub static ENAMETOOLONG : c_int = 63;
-            pub static EHOSTDOWN : c_int = 64;
-            pub static EHOSTUNREACH : c_int = 65;
-            pub static ENOTEMPTY : c_int = 66;
-            pub static EPROCLIM : c_int = 67;
-            pub static EUSERS : c_int = 68;
-            pub static EDQUOT : c_int = 69;
-            pub static ESTALE : c_int = 70;
-            pub static EREMOTE : c_int = 71;
-            pub static EBADRPC : c_int = 72;
-            pub static ERPCMISMATCH : c_int = 73;
-            pub static EPROGUNAVAIL : c_int = 74;
-            pub static EPROGMISMATCH : c_int = 75;
-            pub static EPROCUNAVAIL : c_int = 76;
-            pub static ENOLCK : c_int = 77;
-            pub static ENOSYS : c_int = 78;
-            pub static EFTYPE : c_int = 79;
-            pub static EAUTH : c_int = 80;
-            pub static ENEEDAUTH : c_int = 81;
-            pub static EPWROFF : c_int = 82;
-            pub static EDEVERR : c_int = 83;
-            pub static EOVERFLOW : c_int = 84;
-            pub static EBADEXEC : c_int = 85;
-            pub static EBADARCH : c_int = 86;
-            pub static ESHLIBVERS : c_int = 87;
-            pub static EBADMACHO : c_int = 88;
-            pub static ECANCELED : c_int = 89;
-            pub static EIDRM : c_int = 90;
-            pub static ENOMSG : c_int = 91;
-            pub static EILSEQ : c_int = 92;
-            pub static ENOATTR : c_int = 93;
-            pub static EBADMSG : c_int = 94;
-            pub static EMULTIHOP : c_int = 95;
-            pub static ENODATA : c_int = 96;
-            pub static ENOLINK : c_int = 97;
-            pub static ENOSR : c_int = 98;
-            pub static ENOSTR : c_int = 99;
-            pub static EPROTO : c_int = 100;
-            pub static ETIME : c_int = 101;
-            pub static EOPNOTSUPP : c_int = 102;
-            pub static ENOPOLICY : c_int = 103;
-            pub static ENOTRECOVERABLE : c_int = 104;
-            pub static EOWNERDEAD : c_int = 105;
-            pub static EQFULL : c_int = 106;
-            pub static ELAST : c_int = 106;
+            pub const O_RDONLY : c_int = 0;
+            pub const O_WRONLY : c_int = 1;
+            pub const O_RDWR : c_int = 2;
+            pub const O_APPEND : c_int = 8;
+            pub const O_CREAT : c_int = 512;
+            pub const O_EXCL : c_int = 2048;
+            pub const O_TRUNC : c_int = 1024;
+            pub const S_IFIFO : mode_t = 4096;
+            pub const S_IFCHR : mode_t = 8192;
+            pub const S_IFBLK : mode_t = 24576;
+            pub const S_IFDIR : mode_t = 16384;
+            pub const S_IFREG : mode_t = 32768;
+            pub const S_IFLNK : mode_t = 40960;
+            pub const S_IFMT : mode_t = 61440;
+            pub const S_IEXEC : mode_t = 64;
+            pub const S_IWRITE : mode_t = 128;
+            pub const S_IREAD : mode_t = 256;
+            pub const S_IRWXU : mode_t = 448;
+            pub const S_IXUSR : mode_t = 64;
+            pub const S_IWUSR : mode_t = 128;
+            pub const S_IRUSR : mode_t = 256;
+            pub const F_OK : c_int = 0;
+            pub const R_OK : c_int = 4;
+            pub const W_OK : c_int = 2;
+            pub const X_OK : c_int = 1;
+            pub const STDIN_FILENO : c_int = 0;
+            pub const STDOUT_FILENO : c_int = 1;
+            pub const STDERR_FILENO : c_int = 2;
+            pub const F_LOCK : c_int = 1;
+            pub const F_TEST : c_int = 3;
+            pub const F_TLOCK : c_int = 2;
+            pub const F_ULOCK : c_int = 0;
+            pub const SIGHUP : c_int = 1;
+            pub const SIGINT : c_int = 2;
+            pub const SIGQUIT : c_int = 3;
+            pub const SIGILL : c_int = 4;
+            pub const SIGABRT : c_int = 6;
+            pub const SIGFPE : c_int = 8;
+            pub const SIGKILL : c_int = 9;
+            pub const SIGSEGV : c_int = 11;
+            pub const SIGPIPE : c_int = 13;
+            pub const SIGALRM : c_int = 14;
+            pub const SIGTERM : c_int = 15;
+
+            pub const PROT_NONE : c_int = 0;
+            pub const PROT_READ : c_int = 1;
+            pub const PROT_WRITE : c_int = 2;
+            pub const PROT_EXEC : c_int = 4;
+
+            pub const MAP_FILE : c_int = 0x0000;
+            pub const MAP_SHARED : c_int = 0x0001;
+            pub const MAP_PRIVATE : c_int = 0x0002;
+            pub const MAP_FIXED : c_int = 0x0010;
+            pub const MAP_ANON : c_int = 0x1000;
+
+            pub const MAP_FAILED : *mut c_void = -1 as *mut c_void;
+
+            pub const MCL_CURRENT : c_int = 0x0001;
+            pub const MCL_FUTURE : c_int = 0x0002;
+
+            pub const MS_ASYNC : c_int = 0x0001;
+            pub const MS_INVALIDATE : c_int = 0x0002;
+            pub const MS_SYNC : c_int = 0x0010;
+
+            pub const MS_KILLPAGES : c_int = 0x0004;
+            pub const MS_DEACTIVATE : c_int = 0x0008;
+
+            pub const EPERM : c_int = 1;
+            pub const ENOENT : c_int = 2;
+            pub const ESRCH : c_int = 3;
+            pub const EINTR : c_int = 4;
+            pub const EIO : c_int = 5;
+            pub const ENXIO : c_int = 6;
+            pub const E2BIG : c_int = 7;
+            pub const ENOEXEC : c_int = 8;
+            pub const EBADF : c_int = 9;
+            pub const ECHILD : c_int = 10;
+            pub const EDEADLK : c_int = 11;
+            pub const ENOMEM : c_int = 12;
+            pub const EACCES : c_int = 13;
+            pub const EFAULT : c_int = 14;
+            pub const ENOTBLK : c_int = 15;
+            pub const EBUSY : c_int = 16;
+            pub const EEXIST : c_int = 17;
+            pub const EXDEV : c_int = 18;
+            pub const ENODEV : c_int = 19;
+            pub const ENOTDIR : c_int = 20;
+            pub const EISDIR : c_int = 21;
+            pub const EINVAL : c_int = 22;
+            pub const ENFILE : c_int = 23;
+            pub const EMFILE : c_int = 24;
+            pub const ENOTTY : c_int = 25;
+            pub const ETXTBSY : c_int = 26;
+            pub const EFBIG : c_int = 27;
+            pub const ENOSPC : c_int = 28;
+            pub const ESPIPE : c_int = 29;
+            pub const EROFS : c_int = 30;
+            pub const EMLINK : c_int = 31;
+            pub const EPIPE : c_int = 32;
+            pub const EDOM : c_int = 33;
+            pub const ERANGE : c_int = 34;
+            pub const EAGAIN : c_int = 35;
+            pub const EWOULDBLOCK : c_int = EAGAIN;
+            pub const EINPROGRESS : c_int = 36;
+            pub const EALREADY : c_int = 37;
+            pub const ENOTSOCK : c_int = 38;
+            pub const EDESTADDRREQ : c_int = 39;
+            pub const EMSGSIZE : c_int = 40;
+            pub const EPROTOTYPE : c_int = 41;
+            pub const ENOPROTOOPT : c_int = 42;
+            pub const EPROTONOSUPPORT : c_int = 43;
+            pub const ESOCKTNOSUPPORT : c_int = 44;
+            pub const ENOTSUP : c_int = 45;
+            pub const EPFNOSUPPORT : c_int = 46;
+            pub const EAFNOSUPPORT : c_int = 47;
+            pub const EADDRINUSE : c_int = 48;
+            pub const EADDRNOTAVAIL : c_int = 49;
+            pub const ENETDOWN : c_int = 50;
+            pub const ENETUNREACH : c_int = 51;
+            pub const ENETRESET : c_int = 52;
+            pub const ECONNABORTED : c_int = 53;
+            pub const ECONNRESET : c_int = 54;
+            pub const ENOBUFS : c_int = 55;
+            pub const EISCONN : c_int = 56;
+            pub const ENOTCONN : c_int = 57;
+            pub const ESHUTDOWN : c_int = 58;
+            pub const ETOOMANYREFS : c_int = 59;
+            pub const ETIMEDOUT : c_int = 60;
+            pub const ECONNREFUSED : c_int = 61;
+            pub const ELOOP : c_int = 62;
+            pub const ENAMETOOLONG : c_int = 63;
+            pub const EHOSTDOWN : c_int = 64;
+            pub const EHOSTUNREACH : c_int = 65;
+            pub const ENOTEMPTY : c_int = 66;
+            pub const EPROCLIM : c_int = 67;
+            pub const EUSERS : c_int = 68;
+            pub const EDQUOT : c_int = 69;
+            pub const ESTALE : c_int = 70;
+            pub const EREMOTE : c_int = 71;
+            pub const EBADRPC : c_int = 72;
+            pub const ERPCMISMATCH : c_int = 73;
+            pub const EPROGUNAVAIL : c_int = 74;
+            pub const EPROGMISMATCH : c_int = 75;
+            pub const EPROCUNAVAIL : c_int = 76;
+            pub const ENOLCK : c_int = 77;
+            pub const ENOSYS : c_int = 78;
+            pub const EFTYPE : c_int = 79;
+            pub const EAUTH : c_int = 80;
+            pub const ENEEDAUTH : c_int = 81;
+            pub const EPWROFF : c_int = 82;
+            pub const EDEVERR : c_int = 83;
+            pub const EOVERFLOW : c_int = 84;
+            pub const EBADEXEC : c_int = 85;
+            pub const EBADARCH : c_int = 86;
+            pub const ESHLIBVERS : c_int = 87;
+            pub const EBADMACHO : c_int = 88;
+            pub const ECANCELED : c_int = 89;
+            pub const EIDRM : c_int = 90;
+            pub const ENOMSG : c_int = 91;
+            pub const EILSEQ : c_int = 92;
+            pub const ENOATTR : c_int = 93;
+            pub const EBADMSG : c_int = 94;
+            pub const EMULTIHOP : c_int = 95;
+            pub const ENODATA : c_int = 96;
+            pub const ENOLINK : c_int = 97;
+            pub const ENOSR : c_int = 98;
+            pub const ENOSTR : c_int = 99;
+            pub const EPROTO : c_int = 100;
+            pub const ETIME : c_int = 101;
+            pub const EOPNOTSUPP : c_int = 102;
+            pub const ENOPOLICY : c_int = 103;
+            pub const ENOTRECOVERABLE : c_int = 104;
+            pub const EOWNERDEAD : c_int = 105;
+            pub const EQFULL : c_int = 106;
+            pub const ELAST : c_int = 106;
         }
         pub mod posix01 {
             use types::os::arch::c95::{c_int, size_t};
 
-            pub static F_DUPFD : c_int = 0;
-            pub static F_GETFD : c_int = 1;
-            pub static F_SETFD : c_int = 2;
-            pub static F_GETFL : c_int = 3;
-            pub static F_SETFL : c_int = 4;
-
-            pub static SIGTRAP : c_int = 5;
-            pub static SIGPIPE: c_int = 13;
-            pub static SIG_IGN: size_t = 1;
-
-            pub static GLOB_APPEND   : c_int = 0x0001;
-            pub static GLOB_DOOFFS   : c_int = 0x0002;
-            pub static GLOB_ERR      : c_int = 0x0004;
-            pub static GLOB_MARK     : c_int = 0x0008;
-            pub static GLOB_NOCHECK  : c_int = 0x0010;
-            pub static GLOB_NOSORT   : c_int = 0x0020;
-            pub static GLOB_NOESCAPE : c_int = 0x2000;
-
-            pub static GLOB_NOSPACE  : c_int = -1;
-            pub static GLOB_ABORTED  : c_int = -2;
-            pub static GLOB_NOMATCH  : c_int = -3;
-
-            pub static POSIX_MADV_NORMAL : c_int = 0;
-            pub static POSIX_MADV_RANDOM : c_int = 1;
-            pub static POSIX_MADV_SEQUENTIAL : c_int = 2;
-            pub static POSIX_MADV_WILLNEED : c_int = 3;
-            pub static POSIX_MADV_DONTNEED : c_int = 4;
-
-            pub static _SC_IOV_MAX : c_int = 56;
-            pub static _SC_GETGR_R_SIZE_MAX : c_int = 70;
-            pub static _SC_GETPW_R_SIZE_MAX : c_int = 71;
-            pub static _SC_LOGIN_NAME_MAX : c_int = 73;
-            pub static _SC_MQ_PRIO_MAX : c_int = 75;
-            pub static _SC_THREAD_ATTR_STACKADDR : c_int = 82;
-            pub static _SC_THREAD_ATTR_STACKSIZE : c_int = 83;
-            pub static _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 85;
-            pub static _SC_THREAD_KEYS_MAX : c_int = 86;
-            pub static _SC_THREAD_PRIO_INHERIT : c_int = 87;
-            pub static _SC_THREAD_PRIO_PROTECT : c_int = 88;
-            pub static _SC_THREAD_PRIORITY_SCHEDULING : c_int = 89;
-            pub static _SC_THREAD_PROCESS_SHARED : c_int = 90;
-            pub static _SC_THREAD_SAFE_FUNCTIONS : c_int = 91;
-            pub static _SC_THREAD_STACK_MIN : c_int = 93;
-            pub static _SC_THREAD_THREADS_MAX : c_int = 94;
-            pub static _SC_THREADS : c_int = 96;
-            pub static _SC_TTY_NAME_MAX : c_int = 101;
-            pub static _SC_ATEXIT_MAX : c_int = 107;
-            pub static _SC_XOPEN_CRYPT : c_int = 108;
-            pub static _SC_XOPEN_ENH_I18N : c_int = 109;
-            pub static _SC_XOPEN_LEGACY : c_int = 110;
-            pub static _SC_XOPEN_REALTIME : c_int = 111;
-            pub static _SC_XOPEN_REALTIME_THREADS : c_int = 112;
-            pub static _SC_XOPEN_SHM : c_int = 113;
-            pub static _SC_XOPEN_UNIX : c_int = 115;
-            pub static _SC_XOPEN_VERSION : c_int = 116;
-            pub static _SC_XOPEN_XCU_VERSION : c_int = 121;
-
-            pub static PTHREAD_CREATE_JOINABLE: c_int = 1;
-            pub static PTHREAD_CREATE_DETACHED: c_int = 2;
-            pub static PTHREAD_STACK_MIN: size_t = 8192;
+            pub const F_DUPFD : c_int = 0;
+            pub const F_GETFD : c_int = 1;
+            pub const F_SETFD : c_int = 2;
+            pub const F_GETFL : c_int = 3;
+            pub const F_SETFL : c_int = 4;
+
+            pub const SIGTRAP : c_int = 5;
+            pub const SIGPIPE: c_int = 13;
+            pub const SIG_IGN: size_t = 1;
+
+            pub const GLOB_APPEND   : c_int = 0x0001;
+            pub const GLOB_DOOFFS   : c_int = 0x0002;
+            pub const GLOB_ERR      : c_int = 0x0004;
+            pub const GLOB_MARK     : c_int = 0x0008;
+            pub const GLOB_NOCHECK  : c_int = 0x0010;
+            pub const GLOB_NOSORT   : c_int = 0x0020;
+            pub const GLOB_NOESCAPE : c_int = 0x2000;
+
+            pub const GLOB_NOSPACE  : c_int = -1;
+            pub const GLOB_ABORTED  : c_int = -2;
+            pub const GLOB_NOMATCH  : c_int = -3;
+
+            pub const POSIX_MADV_NORMAL : c_int = 0;
+            pub const POSIX_MADV_RANDOM : c_int = 1;
+            pub const POSIX_MADV_SEQUENTIAL : c_int = 2;
+            pub const POSIX_MADV_WILLNEED : c_int = 3;
+            pub const POSIX_MADV_DONTNEED : c_int = 4;
+
+            pub const _SC_IOV_MAX : c_int = 56;
+            pub const _SC_GETGR_R_SIZE_MAX : c_int = 70;
+            pub const _SC_GETPW_R_SIZE_MAX : c_int = 71;
+            pub const _SC_LOGIN_NAME_MAX : c_int = 73;
+            pub const _SC_MQ_PRIO_MAX : c_int = 75;
+            pub const _SC_THREAD_ATTR_STACKADDR : c_int = 82;
+            pub const _SC_THREAD_ATTR_STACKSIZE : c_int = 83;
+            pub const _SC_THREAD_DESTRUCTOR_ITERATIONS : c_int = 85;
+            pub const _SC_THREAD_KEYS_MAX : c_int = 86;
+            pub const _SC_THREAD_PRIO_INHERIT : c_int = 87;
+            pub const _SC_THREAD_PRIO_PROTECT : c_int = 88;
+            pub const _SC_THREAD_PRIORITY_SCHEDULING : c_int = 89;
+            pub const _SC_THREAD_PROCESS_SHARED : c_int = 90;
+            pub const _SC_THREAD_SAFE_FUNCTIONS : c_int = 91;
+            pub const _SC_THREAD_STACK_MIN : c_int = 93;
+            pub const _SC_THREAD_THREADS_MAX : c_int = 94;
+            pub const _SC_THREADS : c_int = 96;
+            pub const _SC_TTY_NAME_MAX : c_int = 101;
+            pub const _SC_ATEXIT_MAX : c_int = 107;
+            pub const _SC_XOPEN_CRYPT : c_int = 108;
+            pub const _SC_XOPEN_ENH_I18N : c_int = 109;
+            pub const _SC_XOPEN_LEGACY : c_int = 110;
+            pub const _SC_XOPEN_REALTIME : c_int = 111;
+            pub const _SC_XOPEN_REALTIME_THREADS : c_int = 112;
+            pub const _SC_XOPEN_SHM : c_int = 113;
+            pub const _SC_XOPEN_UNIX : c_int = 115;
+            pub const _SC_XOPEN_VERSION : c_int = 116;
+            pub const _SC_XOPEN_XCU_VERSION : c_int = 121;
+
+            pub const PTHREAD_CREATE_JOINABLE: c_int = 1;
+            pub const PTHREAD_CREATE_DETACHED: c_int = 2;
+            pub const PTHREAD_STACK_MIN: size_t = 8192;
         }
         pub mod posix08 {
         }
         pub mod bsd44 {
             use types::os::arch::c95::c_int;
 
-            pub static MADV_NORMAL : c_int = 0;
-            pub static MADV_RANDOM : c_int = 1;
-            pub static MADV_SEQUENTIAL : c_int = 2;
-            pub static MADV_WILLNEED : c_int = 3;
-            pub static MADV_DONTNEED : c_int = 4;
-            pub static MADV_FREE : c_int = 5;
-            pub static MADV_ZERO_WIRED_PAGES : c_int = 6;
-            pub static MADV_FREE_REUSABLE : c_int = 7;
-            pub static MADV_FREE_REUSE : c_int = 8;
-            pub static MADV_CAN_REUSE : c_int = 9;
-
-            pub static MINCORE_INCORE : c_int =  0x1;
-            pub static MINCORE_REFERENCED : c_int = 0x2;
-            pub static MINCORE_MODIFIED : c_int = 0x4;
-            pub static MINCORE_REFERENCED_OTHER : c_int = 0x8;
-            pub static MINCORE_MODIFIED_OTHER : c_int = 0x10;
-
-            pub static AF_UNIX: c_int = 1;
-            pub static AF_INET: c_int = 2;
-            pub static AF_INET6: c_int = 30;
-            pub static SOCK_STREAM: c_int = 1;
-            pub static SOCK_DGRAM: c_int = 2;
-            pub static SOCK_RAW: c_int = 3;
-            pub static IPPROTO_TCP: c_int = 6;
-            pub static IPPROTO_IP: c_int = 0;
-            pub static IPPROTO_IPV6: c_int = 41;
-            pub static IP_MULTICAST_TTL: c_int = 10;
-            pub static IP_MULTICAST_LOOP: c_int = 11;
-            pub static IP_TTL: c_int = 4;
-            pub static IP_HDRINCL: c_int = 2;
-            pub static IP_ADD_MEMBERSHIP: c_int = 12;
-            pub static IP_DROP_MEMBERSHIP: c_int = 13;
-            pub static IPV6_ADD_MEMBERSHIP: c_int = 12;
-            pub static IPV6_DROP_MEMBERSHIP: c_int = 13;
-
-            pub static TCP_NODELAY: c_int = 0x01;
-            pub static TCP_KEEPALIVE: c_int = 0x10;
-            pub static SOL_SOCKET: c_int = 0xffff;
-            pub static SO_KEEPALIVE: c_int = 0x0008;
-            pub static SO_BROADCAST: c_int = 0x0020;
-            pub static SO_REUSEADDR: c_int = 0x0004;
-            pub static SO_ERROR: c_int = 0x1007;
-
-            pub static IFF_LOOPBACK: c_int = 0x8;
-
-            pub static SHUT_RD: c_int = 0;
-            pub static SHUT_WR: c_int = 1;
-            pub static SHUT_RDWR: c_int = 2;
+            pub const MADV_NORMAL : c_int = 0;
+            pub const MADV_RANDOM : c_int = 1;
+            pub const MADV_SEQUENTIAL : c_int = 2;
+            pub const MADV_WILLNEED : c_int = 3;
+            pub const MADV_DONTNEED : c_int = 4;
+            pub const MADV_FREE : c_int = 5;
+            pub const MADV_ZERO_WIRED_PAGES : c_int = 6;
+            pub const MADV_FREE_REUSABLE : c_int = 7;
+            pub const MADV_FREE_REUSE : c_int = 8;
+            pub const MADV_CAN_REUSE : c_int = 9;
+
+            pub const MINCORE_INCORE : c_int =  0x1;
+            pub const MINCORE_REFERENCED : c_int = 0x2;
+            pub const MINCORE_MODIFIED : c_int = 0x4;
+            pub const MINCORE_REFERENCED_OTHER : c_int = 0x8;
+            pub const MINCORE_MODIFIED_OTHER : c_int = 0x10;
+
+            pub const AF_UNIX: c_int = 1;
+            pub const AF_INET: c_int = 2;
+            pub const AF_INET6: c_int = 30;
+            pub const SOCK_STREAM: c_int = 1;
+            pub const SOCK_DGRAM: c_int = 2;
+            pub const SOCK_RAW: c_int = 3;
+            pub const IPPROTO_TCP: c_int = 6;
+            pub const IPPROTO_IP: c_int = 0;
+            pub const IPPROTO_IPV6: c_int = 41;
+            pub const IP_MULTICAST_TTL: c_int = 10;
+            pub const IP_MULTICAST_LOOP: c_int = 11;
+            pub const IP_TTL: c_int = 4;
+            pub const IP_HDRINCL: c_int = 2;
+            pub const IP_ADD_MEMBERSHIP: c_int = 12;
+            pub const IP_DROP_MEMBERSHIP: c_int = 13;
+            pub const IPV6_ADD_MEMBERSHIP: c_int = 12;
+            pub const IPV6_DROP_MEMBERSHIP: c_int = 13;
+
+            pub const TCP_NODELAY: c_int = 0x01;
+            pub const TCP_KEEPALIVE: c_int = 0x10;
+            pub const SOL_SOCKET: c_int = 0xffff;
+            pub const SO_KEEPALIVE: c_int = 0x0008;
+            pub const SO_BROADCAST: c_int = 0x0020;
+            pub const SO_REUSEADDR: c_int = 0x0004;
+            pub const SO_ERROR: c_int = 0x1007;
+
+            pub const IFF_LOOPBACK: c_int = 0x8;
+
+            pub const SHUT_RD: c_int = 0;
+            pub const SHUT_WR: c_int = 1;
+            pub const SHUT_RDWR: c_int = 2;
         }
         pub mod extra {
             use types::os::arch::c95::c_int;
 
-            pub static O_DSYNC : c_int = 4194304;
-            pub static O_SYNC : c_int = 128;
-            pub static O_NONBLOCK : c_int = 4;
-            pub static F_FULLFSYNC : c_int = 51;
-
-            pub static MAP_COPY : c_int = 0x0002;
-            pub static MAP_RENAME : c_int = 0x0020;
-            pub static MAP_NORESERVE : c_int = 0x0040;
-            pub static MAP_NOEXTEND : c_int = 0x0100;
-            pub static MAP_HASSEMAPHORE : c_int = 0x0200;
-            pub static MAP_NOCACHE : c_int = 0x0400;
-            pub static MAP_JIT : c_int = 0x0800;
-            pub static MAP_STACK : c_int = 0;
-
-            pub static IPPROTO_RAW : c_int = 255;
+            pub const O_DSYNC : c_int = 4194304;
+            pub const O_SYNC : c_int = 128;
+            pub const O_NONBLOCK : c_int = 4;
+            pub const F_FULLFSYNC : c_int = 51;
+
+            pub const MAP_COPY : c_int = 0x0002;
+            pub const MAP_RENAME : c_int = 0x0020;
+            pub const MAP_NORESERVE : c_int = 0x0040;
+            pub const MAP_NOEXTEND : c_int = 0x0100;
+            pub const MAP_HASSEMAPHORE : c_int = 0x0200;
+            pub const MAP_NOCACHE : c_int = 0x0400;
+            pub const MAP_JIT : c_int = 0x0800;
+            pub const MAP_STACK : c_int = 0;
+
+            pub const IPPROTO_RAW : c_int = 255;
         }
         pub mod sysconf {
             use types::os::arch::c95::c_int;
 
-            pub static _SC_ARG_MAX : c_int = 1;
-            pub static _SC_CHILD_MAX : c_int = 2;
-            pub static _SC_CLK_TCK : c_int = 3;
-            pub static _SC_NGROUPS_MAX : c_int = 4;
-            pub static _SC_OPEN_MAX : c_int = 5;
-            pub static _SC_JOB_CONTROL : c_int = 6;
-            pub static _SC_SAVED_IDS : c_int = 7;
-            pub static _SC_VERSION : c_int = 8;
-            pub static _SC_BC_BASE_MAX : c_int = 9;
-            pub static _SC_BC_DIM_MAX : c_int = 10;
-            pub static _SC_BC_SCALE_MAX : c_int = 11;
-            pub static _SC_BC_STRING_MAX : c_int = 12;
-            pub static _SC_COLL_WEIGHTS_MAX : c_int = 13;
-            pub static _SC_EXPR_NEST_MAX : c_int = 14;
-            pub static _SC_LINE_MAX : c_int = 15;
-            pub static _SC_RE_DUP_MAX : c_int = 16;
-            pub static _SC_2_VERSION : c_int = 17;
-            pub static _SC_2_C_BIND : c_int = 18;
-            pub static _SC_2_C_DEV : c_int = 19;
-            pub static _SC_2_CHAR_TERM : c_int = 20;
-            pub static _SC_2_FORT_DEV : c_int = 21;
-            pub static _SC_2_FORT_RUN : c_int = 22;
-            pub static _SC_2_LOCALEDEF : c_int = 23;
-            pub static _SC_2_SW_DEV : c_int = 24;
-            pub static _SC_2_UPE : c_int = 25;
-            pub static _SC_STREAM_MAX : c_int = 26;
-            pub static _SC_TZNAME_MAX : c_int = 27;
-            pub static _SC_ASYNCHRONOUS_IO : c_int = 28;
-            pub static _SC_PAGESIZE : c_int = 29;
-            pub static _SC_MEMLOCK : c_int = 30;
-            pub static _SC_MEMLOCK_RANGE : c_int = 31;
-            pub static _SC_MEMORY_PROTECTION : c_int = 32;
-            pub static _SC_MESSAGE_PASSING : c_int = 33;
-            pub static _SC_PRIORITIZED_IO : c_int = 34;
-            pub static _SC_PRIORITY_SCHEDULING : c_int = 35;
-            pub static _SC_REALTIME_SIGNALS : c_int = 36;
-            pub static _SC_SEMAPHORES : c_int = 37;
-            pub static _SC_FSYNC : c_int = 38;
-            pub static _SC_SHARED_MEMORY_OBJECTS : c_int = 39;
-            pub static _SC_SYNCHRONIZED_IO : c_int = 40;
-            pub static _SC_TIMERS : c_int = 41;
-            pub static _SC_AIO_LISTIO_MAX : c_int = 42;
-            pub static _SC_AIO_MAX : c_int = 43;
-            pub static _SC_AIO_PRIO_DELTA_MAX : c_int = 44;
-            pub static _SC_DELAYTIMER_MAX : c_int = 45;
-            pub static _SC_MQ_OPEN_MAX : c_int = 46;
-            pub static _SC_MAPPED_FILES : c_int = 47;
-            pub static _SC_RTSIG_MAX : c_int = 48;
-            pub static _SC_SEM_NSEMS_MAX : c_int = 49;
-            pub static _SC_SEM_VALUE_MAX : c_int = 50;
-            pub static _SC_SIGQUEUE_MAX : c_int = 51;
-            pub static _SC_TIMER_MAX : c_int = 52;
-            pub static _SC_XBS5_ILP32_OFF32 : c_int = 122;
-            pub static _SC_XBS5_ILP32_OFFBIG : c_int = 123;
-            pub static _SC_XBS5_LP64_OFF64 : c_int = 124;
-            pub static _SC_XBS5_LPBIG_OFFBIG : c_int = 125;
+            pub const _SC_ARG_MAX : c_int = 1;
+            pub const _SC_CHILD_MAX : c_int = 2;
+            pub const _SC_CLK_TCK : c_int = 3;
+            pub const _SC_NGROUPS_MAX : c_int = 4;
+            pub const _SC_OPEN_MAX : c_int = 5;
+            pub const _SC_JOB_CONTROL : c_int = 6;
+            pub const _SC_SAVED_IDS : c_int = 7;
+            pub const _SC_VERSION : c_int = 8;
+            pub const _SC_BC_BASE_MAX : c_int = 9;
+            pub const _SC_BC_DIM_MAX : c_int = 10;
+            pub const _SC_BC_SCALE_MAX : c_int = 11;
+            pub const _SC_BC_STRING_MAX : c_int = 12;
+            pub const _SC_COLL_WEIGHTS_MAX : c_int = 13;
+            pub const _SC_EXPR_NEST_MAX : c_int = 14;
+            pub const _SC_LINE_MAX : c_int = 15;
+            pub const _SC_RE_DUP_MAX : c_int = 16;
+            pub const _SC_2_VERSION : c_int = 17;
+            pub const _SC_2_C_BIND : c_int = 18;
+            pub const _SC_2_C_DEV : c_int = 19;
+            pub const _SC_2_CHAR_TERM : c_int = 20;
+            pub const _SC_2_FORT_DEV : c_int = 21;
+            pub const _SC_2_FORT_RUN : c_int = 22;
+            pub const _SC_2_LOCALEDEF : c_int = 23;
+            pub const _SC_2_SW_DEV : c_int = 24;
+            pub const _SC_2_UPE : c_int = 25;
+            pub const _SC_STREAM_MAX : c_int = 26;
+            pub const _SC_TZNAME_MAX : c_int = 27;
+            pub const _SC_ASYNCHRONOUS_IO : c_int = 28;
+            pub const _SC_PAGESIZE : c_int = 29;
+            pub const _SC_MEMLOCK : c_int = 30;
+            pub const _SC_MEMLOCK_RANGE : c_int = 31;
+            pub const _SC_MEMORY_PROTECTION : c_int = 32;
+            pub const _SC_MESSAGE_PASSING : c_int = 33;
+            pub const _SC_PRIORITIZED_IO : c_int = 34;
+            pub const _SC_PRIORITY_SCHEDULING : c_int = 35;
+            pub const _SC_REALTIME_SIGNALS : c_int = 36;
+            pub const _SC_SEMAPHORES : c_int = 37;
+            pub const _SC_FSYNC : c_int = 38;
+            pub const _SC_SHARED_MEMORY_OBJECTS : c_int = 39;
+            pub const _SC_SYNCHRONIZED_IO : c_int = 40;
+            pub const _SC_TIMERS : c_int = 41;
+            pub const _SC_AIO_LISTIO_MAX : c_int = 42;
+            pub const _SC_AIO_MAX : c_int = 43;
+            pub const _SC_AIO_PRIO_DELTA_MAX : c_int = 44;
+            pub const _SC_DELAYTIMER_MAX : c_int = 45;
+            pub const _SC_MQ_OPEN_MAX : c_int = 46;
+            pub const _SC_MAPPED_FILES : c_int = 47;
+            pub const _SC_RTSIG_MAX : c_int = 48;
+            pub const _SC_SEM_NSEMS_MAX : c_int = 49;
+            pub const _SC_SEM_VALUE_MAX : c_int = 50;
+            pub const _SC_SIGQUEUE_MAX : c_int = 51;
+            pub const _SC_TIMER_MAX : c_int = 52;
+            pub const _SC_XBS5_ILP32_OFF32 : c_int = 122;
+            pub const _SC_XBS5_ILP32_OFFBIG : c_int = 123;
+            pub const _SC_XBS5_LP64_OFF64 : c_int = 124;
+            pub const _SC_XBS5_LPBIG_OFFBIG : c_int = 125;
         }
     }
 }
@@ -4356,7 +4356,7 @@ pub mod funcs {
             use types::os::arch::posix88::{gid_t, off_t, pid_t};
             use types::os::arch::posix88::{ssize_t, uid_t};
 
-            pub static _PC_NAME_MAX: c_int = 4;
+            pub const _PC_NAME_MAX: c_int = 4;
 
             extern {
                 pub fn access(path: *const c_char, amode: c_int) -> c_int;
diff --git a/src/liblog/lib.rs b/src/liblog/lib.rs
index aa853b0474a03..b6d6e9dfe5052 100644
--- a/src/liblog/lib.rs
+++ b/src/liblog/lib.rs
@@ -188,10 +188,10 @@ mod directive;
 
 /// Maximum logging level of a module that can be specified. Common logging
 /// levels are found in the DEBUG/INFO/WARN/ERROR constants.
-pub static MAX_LOG_LEVEL: u32 = 255;
+pub const MAX_LOG_LEVEL: u32 = 255;
 
 /// The default logging level of a crate if no other is specified.
-static DEFAULT_LOG_LEVEL: u32 = 1;
+const DEFAULT_LOG_LEVEL: u32 = 1;
 
 /// An unsafe constant that is the maximum logging level of any module
 /// specified. This is the first line of defense to determining whether a
@@ -205,13 +205,13 @@ static mut DIRECTIVES: *const Vec<directive::LogDirective> =
 static mut FILTER: *const Regex = 0 as *const _;
 
 /// Debug log level
-pub static DEBUG: u32 = 4;
+pub const DEBUG: u32 = 4;
 /// Info log level
-pub static INFO: u32 = 3;
+pub const INFO: u32 = 3;
 /// Warn log level
-pub static WARN: u32 = 2;
+pub const WARN: u32 = 2;
 /// Error log level
-pub static ERROR: u32 = 1;
+pub const ERROR: u32 = 1;
 
 local_data_key!(local_logger: Box<Logger + Send>)
 
diff --git a/src/libnative/io/c_unix.rs b/src/libnative/io/c_unix.rs
index a8ebcda3cdd1a..c2af9c03c42c1 100644
--- a/src/libnative/io/c_unix.rs
+++ b/src/libnative/io/c_unix.rs
@@ -23,41 +23,41 @@ use libc;
           target_os = "ios",
           target_os = "freebsd",
           target_os = "dragonfly"))]
-pub static FIONBIO: libc::c_ulong = 0x8004667e;
+pub const FIONBIO: libc::c_ulong = 0x8004667e;
 #[cfg(any(all(target_os = "linux",
               any(target_arch = "x86",
                   target_arch = "x86_64",
                   target_arch = "arm")),
           target_os = "android"))]
-pub static FIONBIO: libc::c_ulong = 0x5421;
+pub const FIONBIO: libc::c_ulong = 0x5421;
 #[cfg(all(target_os = "linux",
           any(target_arch = "mips", target_arch = "mipsel")))]
-pub static FIONBIO: libc::c_ulong = 0x667e;
+pub const FIONBIO: libc::c_ulong = 0x667e;
 
 #[cfg(any(target_os = "macos",
           target_os = "ios",
           target_os = "freebsd",
           target_os = "dragonfly"))]
-pub static FIOCLEX: libc::c_ulong = 0x20006601;
+pub const FIOCLEX: libc::c_ulong = 0x20006601;
 #[cfg(any(all(target_os = "linux",
               any(target_arch = "x86",
                   target_arch = "x86_64",
                   target_arch = "arm")),
           target_os = "android"))]
-pub static FIOCLEX: libc::c_ulong = 0x5451;
+pub const FIOCLEX: libc::c_ulong = 0x5451;
 #[cfg(all(target_os = "linux",
           any(target_arch = "mips", target_arch = "mipsel")))]
-pub static FIOCLEX: libc::c_ulong = 0x6601;
+pub const FIOCLEX: libc::c_ulong = 0x6601;
 
 #[cfg(any(target_os = "macos",
           target_os = "ios",
           target_os = "freebsd",
           target_os = "dragonfly"))]
-pub static MSG_DONTWAIT: libc::c_int = 0x80;
+pub const MSG_DONTWAIT: libc::c_int = 0x80;
 #[cfg(any(target_os = "linux", target_os = "android"))]
-pub static MSG_DONTWAIT: libc::c_int = 0x40;
+pub const MSG_DONTWAIT: libc::c_int = 0x40;
 
-pub static WNOHANG: libc::c_int = 1;
+pub const WNOHANG: libc::c_int = 1;
 
 extern {
     pub fn gettimeofday(timeval: *mut libc::timeval,
@@ -89,7 +89,7 @@ extern {
 
 #[cfg(any(target_os = "macos", target_os = "ios"))]
 mod select {
-    pub static FD_SETSIZE: uint = 1024;
+    pub const FD_SETSIZE: uint = 1024;
 
     #[repr(C)]
     pub struct fd_set {
@@ -109,7 +109,7 @@ mod select {
     use std::uint;
     use libc;
 
-    pub static FD_SETSIZE: uint = 1024;
+    pub const FD_SETSIZE: uint = 1024;
 
     #[repr(C)]
     pub struct fd_set {
@@ -131,14 +131,14 @@ mod select {
 mod signal {
     use libc;
 
-    pub static SA_NOCLDSTOP: libc::c_ulong = 0x00000001;
-    pub static SA_NOCLDWAIT: libc::c_ulong = 0x00000002;
-    pub static SA_NODEFER: libc::c_ulong = 0x40000000;
-    pub static SA_ONSTACK: libc::c_ulong = 0x08000000;
-    pub static SA_RESETHAND: libc::c_ulong = 0x80000000;
-    pub static SA_RESTART: libc::c_ulong = 0x10000000;
-    pub static SA_SIGINFO: libc::c_ulong = 0x00000004;
-    pub static SIGCHLD: libc::c_int = 17;
+    pub const SA_NOCLDSTOP: libc::c_ulong = 0x00000001;
+    pub const SA_NOCLDWAIT: libc::c_ulong = 0x00000002;
+    pub const SA_NODEFER: libc::c_ulong = 0x40000000;
+    pub const SA_ONSTACK: libc::c_ulong = 0x08000000;
+    pub const SA_RESETHAND: libc::c_ulong = 0x80000000;
+    pub const SA_RESTART: libc::c_ulong = 0x10000000;
+    pub const SA_SIGINFO: libc::c_ulong = 0x00000004;
+    pub const SIGCHLD: libc::c_int = 17;
 
     // This definition is not as accurate as it could be, {pid, uid, status} is
     // actually a giant union. Currently we're only interested in these fields,
@@ -179,14 +179,14 @@ mod signal {
 mod signal {
     use libc;
 
-    pub static SA_NOCLDSTOP: libc::c_ulong = 0x00000001;
-    pub static SA_NOCLDWAIT: libc::c_ulong = 0x00010000;
-    pub static SA_NODEFER: libc::c_ulong = 0x40000000;
-    pub static SA_ONSTACK: libc::c_ulong = 0x08000000;
-    pub static SA_RESETHAND: libc::c_ulong = 0x80000000;
-    pub static SA_RESTART: libc::c_ulong = 0x10000000;
-    pub static SA_SIGINFO: libc::c_ulong = 0x00000008;
-    pub static SIGCHLD: libc::c_int = 18;
+    pub const SA_NOCLDSTOP: libc::c_ulong = 0x00000001;
+    pub const SA_NOCLDWAIT: libc::c_ulong = 0x00010000;
+    pub const SA_NODEFER: libc::c_ulong = 0x40000000;
+    pub const SA_ONSTACK: libc::c_ulong = 0x08000000;
+    pub const SA_RESETHAND: libc::c_ulong = 0x80000000;
+    pub const SA_RESTART: libc::c_ulong = 0x10000000;
+    pub const SA_SIGINFO: libc::c_ulong = 0x00000008;
+    pub const SIGCHLD: libc::c_int = 18;
 
     // This definition is not as accurate as it could be, {pid, uid, status} is
     // actually a giant union. Currently we're only interested in these fields,
@@ -223,14 +223,14 @@ mod signal {
 mod signal {
     use libc;
 
-    pub static SA_ONSTACK: libc::c_int = 0x0001;
-    pub static SA_RESTART: libc::c_int = 0x0002;
-    pub static SA_RESETHAND: libc::c_int = 0x0004;
-    pub static SA_NOCLDSTOP: libc::c_int = 0x0008;
-    pub static SA_NODEFER: libc::c_int = 0x0010;
-    pub static SA_NOCLDWAIT: libc::c_int = 0x0020;
-    pub static SA_SIGINFO: libc::c_int = 0x0040;
-    pub static SIGCHLD: libc::c_int = 20;
+    pub const SA_ONSTACK: libc::c_int = 0x0001;
+    pub const SA_RESTART: libc::c_int = 0x0002;
+    pub const SA_RESETHAND: libc::c_int = 0x0004;
+    pub const SA_NOCLDSTOP: libc::c_int = 0x0008;
+    pub const SA_NODEFER: libc::c_int = 0x0010;
+    pub const SA_NOCLDWAIT: libc::c_int = 0x0020;
+    pub const SA_SIGINFO: libc::c_int = 0x0040;
+    pub const SIGCHLD: libc::c_int = 20;
 
     #[cfg(any(target_os = "macos", target_os = "ios"))]
     pub type sigset_t = u32;
diff --git a/src/libnative/io/c_windows.rs b/src/libnative/io/c_windows.rs
index 909b37895b7b5..067a31166a500 100644
--- a/src/libnative/io/c_windows.rs
+++ b/src/libnative/io/c_windows.rs
@@ -14,26 +14,26 @@
 
 use libc;
 
-pub static WSADESCRIPTION_LEN: uint = 256;
-pub static WSASYS_STATUS_LEN: uint = 128;
-pub static FIONBIO: libc::c_long = 0x8004667e;
-static FD_SETSIZE: uint = 64;
-pub static MSG_DONTWAIT: libc::c_int = 0;
-pub static ERROR_ILLEGAL_CHARACTER: libc::c_int = 582;
-pub static ENABLE_ECHO_INPUT: libc::DWORD = 0x4;
-pub static ENABLE_EXTENDED_FLAGS: libc::DWORD = 0x80;
-pub static ENABLE_INSERT_MODE: libc::DWORD = 0x20;
-pub static ENABLE_LINE_INPUT: libc::DWORD = 0x2;
-pub static ENABLE_PROCESSED_INPUT: libc::DWORD = 0x1;
-pub static ENABLE_QUICK_EDIT_MODE: libc::DWORD = 0x40;
-pub static WSA_INVALID_EVENT: WSAEVENT = 0 as WSAEVENT;
-
-pub static FD_ACCEPT: libc::c_long = 0x08;
-pub static FD_MAX_EVENTS: uint = 10;
-pub static WSA_INFINITE: libc::DWORD = libc::INFINITE;
-pub static WSA_WAIT_TIMEOUT: libc::DWORD = libc::consts::os::extra::WAIT_TIMEOUT;
-pub static WSA_WAIT_EVENT_0: libc::DWORD = libc::consts::os::extra::WAIT_OBJECT_0;
-pub static WSA_WAIT_FAILED: libc::DWORD = libc::consts::os::extra::WAIT_FAILED;
+pub const WSADESCRIPTION_LEN: uint = 256;
+pub const WSASYS_STATUS_LEN: uint = 128;
+pub const FIONBIO: libc::c_long = 0x8004667e;
+pub const FD_SETSIZE: uint = 64;
+pub const MSG_DONTWAIT: libc::c_int = 0;
+pub const ERROR_ILLEGAL_CHARACTER: libc::c_int = 582;
+pub const ENABLE_ECHO_INPUT: libc::DWORD = 0x4;
+pub const ENABLE_EXTENDED_FLAGS: libc::DWORD = 0x80;
+pub const ENABLE_INSERT_MODE: libc::DWORD = 0x20;
+pub const ENABLE_LINE_INPUT: libc::DWORD = 0x2;
+pub const ENABLE_PROCESSED_INPUT: libc::DWORD = 0x1;
+pub const ENABLE_QUICK_EDIT_MODE: libc::DWORD = 0x40;
+pub const WSA_INVALID_EVENT: WSAEVENT = 0 as WSAEVENT;
+
+pub const FD_ACCEPT: libc::c_long = 0x08;
+pub const FD_MAX_EVENTS: uint = 10;
+pub const WSA_INFINITE: libc::DWORD = libc::INFINITE;
+pub const WSA_WAIT_TIMEOUT: libc::DWORD = libc::consts::os::extra::WAIT_TIMEOUT;
+pub const WSA_WAIT_EVENT_0: libc::DWORD = libc::consts::os::extra::WAIT_OBJECT_0;
+pub const WSA_WAIT_FAILED: libc::DWORD = libc::consts::os::extra::WAIT_FAILED;
 
 #[repr(C)]
 #[cfg(target_arch = "x86")]
diff --git a/src/libnum/bigint.rs b/src/libnum/bigint.rs
index af2ff747fe968..e52d62a040be8 100644
--- a/src/libnum/bigint.rs
+++ b/src/libnum/bigint.rs
@@ -77,7 +77,7 @@ pub type BigDigit = u32;
 /// size is the double of the size of `BigDigit`.
 pub type DoubleBigDigit = u64;
 
-pub static ZERO_BIG_DIGIT: BigDigit = 0;
+pub const ZERO_BIG_DIGIT: BigDigit = 0;
 static ZERO_VEC: [BigDigit, ..1] = [ZERO_BIG_DIGIT];
 
 #[allow(non_snake_case)]
@@ -87,10 +87,10 @@ pub mod BigDigit {
 
     // `DoubleBigDigit` size dependent
     #[allow(non_uppercase_statics)]
-    pub static bits: uint = 32;
+    pub const bits: uint = 32;
 
     #[allow(non_uppercase_statics)]
-    pub static base: DoubleBigDigit = 1 << bits;
+    pub const base: DoubleBigDigit = 1 << bits;
     #[allow(non_uppercase_statics)]
     static lo_mask: DoubleBigDigit = (-1 as DoubleBigDigit) >> bits;
 
diff --git a/src/libnum/complex.rs b/src/libnum/complex.rs
index 0e70527cdca79..6690b1d5ddc7a 100644
--- a/src/libnum/complex.rs
+++ b/src/libnum/complex.rs
@@ -194,13 +194,13 @@ mod test {
     use std::num::{Zero, One, Float};
     use std::hash::hash;
 
-    pub static _0_0i : Complex64 = Complex { re: 0.0, im: 0.0 };
-    pub static _1_0i : Complex64 = Complex { re: 1.0, im: 0.0 };
-    pub static _1_1i : Complex64 = Complex { re: 1.0, im: 1.0 };
-    pub static _0_1i : Complex64 = Complex { re: 0.0, im: 1.0 };
-    pub static _neg1_1i : Complex64 = Complex { re: -1.0, im: 1.0 };
-    pub static _05_05i : Complex64 = Complex { re: 0.5, im: 0.5 };
-    pub static all_consts : [Complex64, .. 5] = [_0_0i, _1_0i, _1_1i, _neg1_1i, _05_05i];
+    pub const _0_0i : Complex64 = Complex { re: 0.0, im: 0.0 };
+    pub const _1_0i : Complex64 = Complex { re: 1.0, im: 0.0 };
+    pub const _1_1i : Complex64 = Complex { re: 1.0, im: 1.0 };
+    pub const _0_1i : Complex64 = Complex { re: 0.0, im: 1.0 };
+    pub const _neg1_1i : Complex64 = Complex { re: -1.0, im: 1.0 };
+    pub const _05_05i : Complex64 = Complex { re: 0.5, im: 0.5 };
+    pub const all_consts : [Complex64, .. 5] = [_0_0i, _1_0i, _1_1i, _neg1_1i, _05_05i];
 
     #[test]
     fn test_consts() {
diff --git a/src/librand/chacha.rs b/src/librand/chacha.rs
index df33e6e2ced0c..83d03bb265e95 100644
--- a/src/librand/chacha.rs
+++ b/src/librand/chacha.rs
@@ -14,9 +14,9 @@ use core::prelude::*;
 
 use {Rng, SeedableRng, Rand};
 
-static KEY_WORDS    : uint =  8; // 8 words for the 256-bit key
-static STATE_WORDS  : uint = 16;
-static CHACHA_ROUNDS: uint = 20; // Cryptographically secure from 8 upwards as of this writing
+const KEY_WORDS    : uint =  8; // 8 words for the 256-bit key
+const STATE_WORDS  : uint = 16;
+const CHACHA_ROUNDS: uint = 20; // Cryptographically secure from 8 upwards as of this writing
 
 /// A random number generator that uses the ChaCha20 algorithm [1].
 ///
diff --git a/src/librand/isaac.rs b/src/librand/isaac.rs
index 0a857da92bbe4..9bfd9177e348b 100644
--- a/src/librand/isaac.rs
+++ b/src/librand/isaac.rs
@@ -16,9 +16,9 @@ use core::slice::raw;
 
 use {Rng, SeedableRng, Rand};
 
-static RAND_SIZE_LEN: u32 = 8;
-static RAND_SIZE: u32 = 1 << (RAND_SIZE_LEN as uint);
-static RAND_SIZE_UINT: uint = 1 << (RAND_SIZE_LEN as uint);
+const RAND_SIZE_LEN: u32 = 8;
+const RAND_SIZE: u32 = 1 << (RAND_SIZE_LEN as uint);
+const RAND_SIZE_UINT: uint = 1 << (RAND_SIZE_LEN as uint);
 
 /// A random number generator that uses the ISAAC algorithm[1].
 ///
@@ -251,8 +251,8 @@ impl Rand for IsaacRng {
     }
 }
 
-static RAND_SIZE_64_LEN: uint = 8;
-static RAND_SIZE_64: uint = 1 << RAND_SIZE_64_LEN;
+const RAND_SIZE_64_LEN: uint = 8;
+const RAND_SIZE_64: uint = 1 << RAND_SIZE_64_LEN;
 
 /// A random number generator that uses ISAAC-64[1], the 64-bit
 /// variant of the ISAAC algorithm.
@@ -356,8 +356,8 @@ impl Isaac64Rng {
         // abbreviations
         let mut a = self.a;
         let mut b = self.b + self.c;
-        static MIDPOINT: uint =  RAND_SIZE_64 / 2;
-        static MP_VEC: [(uint, uint), .. 2] = [(0,MIDPOINT), (MIDPOINT, 0)];
+        const MIDPOINT: uint =  RAND_SIZE_64 / 2;
+        const MP_VEC: [(uint, uint), .. 2] = [(0,MIDPOINT), (MIDPOINT, 0)];
         macro_rules! ind (
             ($x:expr) => {
                 *self.mem.unsafe_get(($x as uint >> 3) & (RAND_SIZE_64 - 1))
diff --git a/src/libregex/parse.rs b/src/libregex/parse.rs
index bf57643263139..1d1d1a0e9c5ca 100644
--- a/src/libregex/parse.rs
+++ b/src/libregex/parse.rs
@@ -162,12 +162,12 @@ impl BuildAst {
 /// expression.
 pub type Flags = u8;
 
-pub static FLAG_EMPTY:      u8 = 0;
-pub static FLAG_NOCASE:     u8 = 1 << 0; // i
-pub static FLAG_MULTI:      u8 = 1 << 1; // m
-pub static FLAG_DOTNL:      u8 = 1 << 2; // s
-pub static FLAG_SWAP_GREED: u8 = 1 << 3; // U
-pub static FLAG_NEGATED:    u8 = 1 << 4; // char class or not word boundary
+pub const FLAG_EMPTY:      u8 = 0;
+pub const FLAG_NOCASE:     u8 = 1 << 0; // i
+pub const FLAG_MULTI:      u8 = 1 << 1; // m
+pub const FLAG_DOTNL:      u8 = 1 << 2; // s
+pub const FLAG_SWAP_GREED: u8 = 1 << 3; // U
+pub const FLAG_NEGATED:    u8 = 1 << 4; // char class or not word boundary
 
 struct Parser<'a> {
     // The input, parsed only as a sequence of UTF8 code points.
@@ -1025,7 +1025,7 @@ fn find_class(classes: NamedClasses, name: &str) -> Option<Vec<(char, char)>> {
 }
 
 type Class = &'static [(char, char)];
-type NamedClasses = &'static [(&'static str, Class)];
+type NamedClasses = &'static [(&'static str, &'static Class)];
 
 static ASCII_CLASSES: NamedClasses = &[
     // Classes must be in alphabetical order so that bsearch works.
@@ -1044,19 +1044,34 @@ static ASCII_CLASSES: NamedClasses = &[
     // [:word:]       word characters (== [0-9A-Za-z_])
     // [:xdigit:]     hex digit (== [0-9A-Fa-f])
     // Taken from: http://golang.org/pkg/regex/syntax/
-    ("alnum", &[('0', '9'), ('A', 'Z'), ('a', 'z')]),
-    ("alpha", &[('A', 'Z'), ('a', 'z')]),
-    ("ascii", &[('\x00', '\x7F')]),
-    ("blank", &[(' ', ' '), ('\t', '\t')]),
-    ("cntrl", &[('\x00', '\x1F'), ('\x7F', '\x7F')]),
-    ("digit", &[('0', '9')]),
-    ("graph", &[('!', '~')]),
-    ("lower", &[('a', 'z')]),
-    ("print", &[(' ', '~')]),
-    ("punct", &[('!', '/'), (':', '@'), ('[', '`'), ('{', '~')]),
-    ("space", &[('\t', '\t'), ('\n', '\n'), ('\x0B', '\x0B'), ('\x0C', '\x0C'),
-                ('\r', '\r'), (' ', ' ')]),
-    ("upper", &[('A', 'Z')]),
-    ("word", &[('0', '9'), ('A', 'Z'), ('a', 'z'), ('_', '_')]),
-    ("xdigit", &[('0', '9'), ('A', 'F'), ('a', 'f')]),
+    ("alnum", &ALNUM),
+    ("alpha", &ALPHA),
+    ("ascii", &ASCII),
+    ("blank", &BLANK),
+    ("cntrl", &CNTRL),
+    ("digit", &DIGIT),
+    ("graph", &GRAPH),
+    ("lower", &LOWER),
+    ("print", &PRINT),
+    ("punct", &PUNCT),
+    ("space", &SPACE),
+    ("upper", &UPPER),
+    ("word", &WORD),
+    ("xdigit", &XDIGIT),
 ];
+
+static ALNUM: Class = &[('0', '9'), ('A', 'Z'), ('a', 'z')];
+static ALPHA: Class = &[('A', 'Z'), ('a', 'z')];
+static ASCII: Class = &[('\x00', '\x7F')];
+static BLANK: Class = &[(' ', ' '), ('\t', '\t')];
+static CNTRL: Class = &[('\x00', '\x1F'), ('\x7F', '\x7F')];
+static DIGIT: Class = &[('0', '9')];
+static GRAPH: Class = &[('!', '~')];
+static LOWER: Class = &[('a', 'z')];
+static PRINT: Class = &[(' ', '~')];
+static PUNCT: Class = &[('!', '/'), (':', '@'), ('[', '`'), ('{', '~')];
+static SPACE: Class = &[('\t', '\t'), ('\n', '\n'), ('\x0B', '\x0B'),
+                        ('\x0C', '\x0C'), ('\r', '\r'), (' ', ' ')];
+static UPPER: Class = &[('A', 'Z')];
+static WORD: Class = &[('0', '9'), ('A', 'Z'), ('a', 'z'), ('_', '_')];
+static XDIGIT: Class = &[('0', '9'), ('A', 'F'), ('a', 'f')];
diff --git a/src/libregex/re.rs b/src/libregex/re.rs
index 0b5aeb215e66c..eebe9b85e3b9d 100644
--- a/src/libregex/re.rs
+++ b/src/libregex/re.rs
@@ -128,7 +128,7 @@ pub struct ExNative {
     #[doc(hidden)]
     pub original: &'static str,
     #[doc(hidden)]
-    pub names: &'static [Option<&'static str>],
+    pub names: &'static &'static [Option<&'static str>],
     #[doc(hidden)]
     pub prog: fn(MatchKind, &str, uint, uint) -> Vec<Option<uint>>
 }
diff --git a/src/libregex_macros/lib.rs b/src/libregex_macros/lib.rs
index 67018769fb371..c48b35a49808c 100644
--- a/src/libregex_macros/lib.rs
+++ b/src/libregex_macros/lib.rs
@@ -324,7 +324,7 @@ fn exec<'t>(which: ::regex::native::MatchKind, input: &'t str,
 
 ::regex::native::Native(::regex::native::ExNative {
     original: $regex,
-    names: CAP_NAMES,
+    names: &CAP_NAMES,
     prog: exec,
 })
         })
diff --git a/src/librustc/back/link.rs b/src/librustc/back/link.rs
index 295768d468eac..fc5d726bf67c2 100644
--- a/src/librustc/back/link.rs
+++ b/src/librustc/back/link.rs
@@ -55,22 +55,22 @@ use syntax::parse::token;
 
 // This is the "magic number" expected at the beginning of a LLVM bytecode
 // object in an rlib.
-pub static RLIB_BYTECODE_OBJECT_MAGIC: &'static [u8] = b"RUST_OBJECT";
+pub const RLIB_BYTECODE_OBJECT_MAGIC: &'static [u8] = b"RUST_OBJECT";
 
 // The version number this compiler will write to bytecode objects in rlibs
-pub static RLIB_BYTECODE_OBJECT_VERSION: u32 = 1;
+pub const RLIB_BYTECODE_OBJECT_VERSION: u32 = 1;
 
 // The offset in bytes the bytecode object format version number can be found at
-pub static RLIB_BYTECODE_OBJECT_VERSION_OFFSET: uint = 11;
+pub const RLIB_BYTECODE_OBJECT_VERSION_OFFSET: uint = 11;
 
 // The offset in bytes the size of the compressed bytecode can be found at in
 // format version 1
-pub static RLIB_BYTECODE_OBJECT_V1_DATASIZE_OFFSET: uint =
+pub const RLIB_BYTECODE_OBJECT_V1_DATASIZE_OFFSET: uint =
     RLIB_BYTECODE_OBJECT_VERSION_OFFSET + 4;
 
 // The offset in bytes the compressed LLVM bytecode can be found at in format
 // version 1
-pub static RLIB_BYTECODE_OBJECT_V1_DATA_OFFSET: uint =
+pub const RLIB_BYTECODE_OBJECT_V1_DATA_OFFSET: uint =
     RLIB_BYTECODE_OBJECT_V1_DATASIZE_OFFSET + 8;
 
 
diff --git a/src/librustc/driver/config.rs b/src/librustc/driver/config.rs
index 9ce012502446d..fdd3c5b5a2608 100644
--- a/src/librustc/driver/config.rs
+++ b/src/librustc/driver/config.rs
@@ -154,10 +154,10 @@ pub enum CrateType {
 
 macro_rules! debugging_opts(
     ([ $opt:ident ] $cnt:expr ) => (
-        pub static $opt: u64 = 1 << $cnt;
+        pub const $opt: u64 = 1 << $cnt;
     );
     ([ $opt:ident, $($rest:ident),* ] $cnt:expr ) => (
-        pub static $opt: u64 = 1 << $cnt;
+        pub const $opt: u64 = 1 << $cnt;
         debugging_opts!([ $($rest),* ] $cnt + 1)
     )
 )
@@ -268,7 +268,7 @@ macro_rules! cgoptions(
     }
 
     pub type CodegenSetter = fn(&mut CodegenOptions, v: Option<&str>) -> bool;
-    pub static CG_OPTIONS: &'static [(&'static str, CodegenSetter,
+    pub const CG_OPTIONS: &'static [(&'static str, CodegenSetter,
                                       &'static str)] =
         &[ $( (stringify!($opt), cgsetters::$opt, $desc) ),* ];
 
diff --git a/src/librustc/lint/builtin.rs b/src/librustc/lint/builtin.rs
index 4c147517a7f03..451d39fbc3def 100644
--- a/src/librustc/lint/builtin.rs
+++ b/src/librustc/lint/builtin.rs
@@ -978,7 +978,8 @@ impl LintPass for NonUppercaseStatics {
     fn check_item(&mut self, cx: &Context, it: &ast::Item) {
         match it.node {
             // only check static constants
-            ast::ItemStatic(_, ast::MutImmutable, _) => {
+            ast::ItemStatic(_, ast::MutImmutable, _) |
+            ast::ItemConst(..) => {
                 let s = token::get_ident(it.ident);
                 // check for lowercase letters rather than non-uppercase
                 // ones (some scripts don't have a concept of
@@ -998,7 +999,7 @@ impl LintPass for NonUppercaseStatics {
     fn check_pat(&mut self, cx: &Context, p: &ast::Pat) {
         // Lint for constants that look like binding identifiers (#7526)
         match (&p.node, cx.tcx.def_map.borrow().find(&p.id)) {
-            (&ast::PatIdent(_, ref path1, _), Some(&def::DefStatic(_, false))) => {
+            (&ast::PatIdent(_, ref path1, _), Some(&def::DefConst(..))) => {
                 let s = token::get_ident(path1.node);
                 if s.get().chars().any(|c| c.is_lowercase()) {
                     cx.span_lint(NON_UPPERCASE_STATICS, path1.span,
diff --git a/src/librustc/lint/context.rs b/src/librustc/lint/context.rs
index bb277511463b9..6d00724fb41fc 100644
--- a/src/librustc/lint/context.rs
+++ b/src/librustc/lint/context.rs
@@ -112,9 +112,9 @@ impl LintStore {
     pub fn register_pass(&mut self, sess: Option<&Session>,
                          from_plugin: bool, pass: LintPassObject) {
         for &lint in pass.get_lints().iter() {
-            self.lints.push((lint, from_plugin));
+            self.lints.push((*lint, from_plugin));
 
-            let id = LintId::of(lint);
+            let id = LintId::of(*lint);
             if !self.by_name.insert(lint.name_lower(), id) {
                 let msg = format!("duplicate specification of lint {}", lint.name_lower());
                 match (sess, from_plugin) {
diff --git a/src/librustc/lint/mod.rs b/src/librustc/lint/mod.rs
index 8047c12efc291..5afe5326171d7 100644
--- a/src/librustc/lint/mod.rs
+++ b/src/librustc/lint/mod.rs
@@ -99,12 +99,12 @@ macro_rules! declare_lint (
 macro_rules! lint_array ( ($( $lint:expr ),*) => (
     {
         #[allow(non_uppercase_statics)]
-        static array: LintArray = &[ $( $lint ),* ];
+        static array: LintArray = &[ $( &$lint ),* ];
         array
     }
 ))
 
-pub type LintArray = &'static [&'static Lint];
+pub type LintArray = &'static [&'static &'static Lint];
 
 /// Trait for types providing lint checks.
 ///
diff --git a/src/librustc/metadata/common.rs b/src/librustc/metadata/common.rs
index ef88795762e43..492feee6f84b3 100644
--- a/src/librustc/metadata/common.rs
+++ b/src/librustc/metadata/common.rs
@@ -15,83 +15,83 @@ use back::svh::Svh;
 
 // EBML enum definitions and utils shared by the encoder and decoder
 
-pub static tag_items: uint = 0x00;
+pub const tag_items: uint = 0x00;
 
-pub static tag_paths_data_name: uint = 0x01;
+pub const tag_paths_data_name: uint = 0x01;
 
-pub static tag_def_id: uint = 0x02;
+pub const tag_def_id: uint = 0x02;
 
-pub static tag_items_data: uint = 0x03;
+pub const tag_items_data: uint = 0x03;
 
-pub static tag_items_data_item: uint = 0x04;
+pub const tag_items_data_item: uint = 0x04;
 
-pub static tag_items_data_item_family: uint = 0x05;
+pub const tag_items_data_item_family: uint = 0x05;
 
-pub static tag_items_data_item_type: uint = 0x07;
+pub const tag_items_data_item_type: uint = 0x07;
 
-pub static tag_items_data_item_symbol: uint = 0x08;
+pub const tag_items_data_item_symbol: uint = 0x08;
 
-pub static tag_items_data_item_variant: uint = 0x09;
+pub const tag_items_data_item_variant: uint = 0x09;
 
-pub static tag_items_data_parent_item: uint = 0x0a;
+pub const tag_items_data_parent_item: uint = 0x0a;
 
-pub static tag_items_data_item_is_tuple_struct_ctor: uint = 0x0b;
+pub const tag_items_data_item_is_tuple_struct_ctor: uint = 0x0b;
 
-pub static tag_index: uint = 0x0c;
+pub const tag_index: uint = 0x0c;
 
-pub static tag_index_buckets: uint = 0x0d;
+pub const tag_index_buckets: uint = 0x0d;
 
-pub static tag_index_buckets_bucket: uint = 0x0e;
+pub const tag_index_buckets_bucket: uint = 0x0e;
 
-pub static tag_index_buckets_bucket_elt: uint = 0x0f;
+pub const tag_index_buckets_bucket_elt: uint = 0x0f;
 
-pub static tag_index_table: uint = 0x10;
+pub const tag_index_table: uint = 0x10;
 
-pub static tag_meta_item_name_value: uint = 0x11;
+pub const tag_meta_item_name_value: uint = 0x11;
 
-pub static tag_meta_item_name: uint = 0x12;
+pub const tag_meta_item_name: uint = 0x12;
 
-pub static tag_meta_item_value: uint = 0x13;
+pub const tag_meta_item_value: uint = 0x13;
 
-pub static tag_attributes: uint = 0x14;
+pub const tag_attributes: uint = 0x14;
 
-pub static tag_attribute: uint = 0x15;
+pub const tag_attribute: uint = 0x15;
 
-pub static tag_meta_item_word: uint = 0x16;
+pub const tag_meta_item_word: uint = 0x16;
 
-pub static tag_meta_item_list: uint = 0x17;
+pub const tag_meta_item_list: uint = 0x17;
 
 // The list of crates that this crate depends on
-pub static tag_crate_deps: uint = 0x18;
+pub const tag_crate_deps: uint = 0x18;
 
 // A single crate dependency
-pub static tag_crate_dep: uint = 0x19;
+pub const tag_crate_dep: uint = 0x19;
 
-pub static tag_crate_hash: uint = 0x1a;
-pub static tag_crate_crate_name: uint = 0x1b;
+pub const tag_crate_hash: uint = 0x1a;
+pub const tag_crate_crate_name: uint = 0x1b;
 
-pub static tag_crate_dep_crate_name: uint = 0x1d;
-pub static tag_crate_dep_hash: uint = 0x1e;
+pub const tag_crate_dep_crate_name: uint = 0x1d;
+pub const tag_crate_dep_hash: uint = 0x1e;
 
-pub static tag_mod_impl: uint = 0x1f;
+pub const tag_mod_impl: uint = 0x1f;
 
-pub static tag_item_trait_item: uint = 0x20;
+pub const tag_item_trait_item: uint = 0x20;
 
-pub static tag_item_trait_ref: uint = 0x21;
-pub static tag_item_super_trait_ref: uint = 0x22;
+pub const tag_item_trait_ref: uint = 0x21;
+pub const tag_item_super_trait_ref: uint = 0x22;
 
 // discriminator value for variants
-pub static tag_disr_val: uint = 0x23;
+pub const tag_disr_val: uint = 0x23;
 
 // used to encode ast_map::PathElem
-pub static tag_path: uint = 0x24;
-pub static tag_path_len: uint = 0x25;
-pub static tag_path_elem_mod: uint = 0x26;
-pub static tag_path_elem_name: uint = 0x27;
-pub static tag_item_field: uint = 0x28;
-pub static tag_item_field_origin: uint = 0x29;
-
-pub static tag_item_variances: uint = 0x2a;
+pub const tag_path: uint = 0x24;
+pub const tag_path_len: uint = 0x25;
+pub const tag_path_elem_mod: uint = 0x26;
+pub const tag_path_elem_name: uint = 0x27;
+pub const tag_item_field: uint = 0x28;
+pub const tag_item_field_origin: uint = 0x29;
+
+pub const tag_item_variances: uint = 0x2a;
 /*
   trait items contain tag_item_trait_item elements,
   impl items contain tag_item_impl_item elements, and classes
@@ -100,15 +100,15 @@ pub static tag_item_variances: uint = 0x2a;
   both, tag_item_trait_item and tag_item_impl_item have to be two
   different tags.
  */
-pub static tag_item_impl_item: uint = 0x30;
-pub static tag_item_trait_method_explicit_self: uint = 0x31;
+pub const tag_item_impl_item: uint = 0x30;
+pub const tag_item_trait_method_explicit_self: uint = 0x31;
 
 
 // Reexports are found within module tags. Each reexport contains def_ids
 // and names.
-pub static tag_items_data_item_reexport: uint = 0x38;
-pub static tag_items_data_item_reexport_def_id: uint = 0x39;
-pub static tag_items_data_item_reexport_name: uint = 0x3a;
+pub const tag_items_data_item_reexport: uint = 0x38;
+pub const tag_items_data_item_reexport_def_id: uint = 0x39;
+pub const tag_items_data_item_reexport_name: uint = 0x3a;
 
 // used to encode crate_ctxt side tables
 #[deriving(PartialEq)]
@@ -153,15 +153,15 @@ impl astencode_tag {
     }
 }
 
-pub static tag_item_trait_item_sort: uint = 0x60;
+pub const tag_item_trait_item_sort: uint = 0x60;
 
-pub static tag_item_trait_parent_sort: uint = 0x61;
+pub const tag_item_trait_parent_sort: uint = 0x61;
 
-pub static tag_item_impl_type_basename: uint = 0x62;
+pub const tag_item_impl_type_basename: uint = 0x62;
 
-pub static tag_crate_triple: uint = 0x66;
+pub const tag_crate_triple: uint = 0x66;
 
-pub static tag_dylib_dependency_formats: uint = 0x67;
+pub const tag_dylib_dependency_formats: uint = 0x67;
 
 // Language items are a top-level directory (for speed). Hierarchy:
 //
@@ -170,51 +170,51 @@ pub static tag_dylib_dependency_formats: uint = 0x67;
 //   - tag_lang_items_item_id: u32
 //   - tag_lang_items_item_node_id: u32
 
-pub static tag_lang_items: uint = 0x70;
-pub static tag_lang_items_item: uint = 0x71;
-pub static tag_lang_items_item_id: uint = 0x72;
-pub static tag_lang_items_item_node_id: uint = 0x73;
-pub static tag_lang_items_missing: uint = 0x74;
+pub const tag_lang_items: uint = 0x70;
+pub const tag_lang_items_item: uint = 0x71;
+pub const tag_lang_items_item_id: uint = 0x72;
+pub const tag_lang_items_item_node_id: uint = 0x73;
+pub const tag_lang_items_missing: uint = 0x74;
 
-pub static tag_item_unnamed_field: uint = 0x75;
-pub static tag_items_data_item_visibility: uint = 0x76;
+pub const tag_item_unnamed_field: uint = 0x75;
+pub const tag_items_data_item_visibility: uint = 0x76;
 
-pub static tag_item_method_tps: uint = 0x79;
-pub static tag_item_method_fty: uint = 0x7a;
+pub const tag_item_method_tps: uint = 0x79;
+pub const tag_item_method_fty: uint = 0x7a;
 
-pub static tag_mod_child: uint = 0x7b;
-pub static tag_misc_info: uint = 0x7c;
-pub static tag_misc_info_crate_items: uint = 0x7d;
+pub const tag_mod_child: uint = 0x7b;
+pub const tag_misc_info: uint = 0x7c;
+pub const tag_misc_info_crate_items: uint = 0x7d;
 
-pub static tag_item_method_provided_source: uint = 0x7e;
-pub static tag_item_impl_vtables: uint = 0x7f;
+pub const tag_item_method_provided_source: uint = 0x7e;
+pub const tag_item_impl_vtables: uint = 0x7f;
 
-pub static tag_impls: uint = 0x80;
-pub static tag_impls_impl: uint = 0x81;
+pub const tag_impls: uint = 0x80;
+pub const tag_impls_impl: uint = 0x81;
 
-pub static tag_items_data_item_inherent_impl: uint = 0x82;
-pub static tag_items_data_item_extension_impl: uint = 0x83;
+pub const tag_items_data_item_inherent_impl: uint = 0x82;
+pub const tag_items_data_item_extension_impl: uint = 0x83;
 
 // GAP 0x84, 0x85, 0x86
 
-pub static tag_native_libraries: uint = 0x87;
-pub static tag_native_libraries_lib: uint = 0x88;
-pub static tag_native_libraries_name: uint = 0x89;
-pub static tag_native_libraries_kind: uint = 0x8a;
+pub const tag_native_libraries: uint = 0x87;
+pub const tag_native_libraries_lib: uint = 0x88;
+pub const tag_native_libraries_name: uint = 0x89;
+pub const tag_native_libraries_kind: uint = 0x8a;
 
-pub static tag_plugin_registrar_fn: uint = 0x8b;
-pub static tag_exported_macros: uint = 0x8c;
-pub static tag_macro_def: uint = 0x8d;
+pub const tag_plugin_registrar_fn: uint = 0x8b;
+pub const tag_exported_macros: uint = 0x8c;
+pub const tag_macro_def: uint = 0x8d;
 
-pub static tag_method_argument_names: uint = 0x8e;
-pub static tag_method_argument_name: uint = 0x8f;
+pub const tag_method_argument_names: uint = 0x8e;
+pub const tag_method_argument_name: uint = 0x8f;
 
-pub static tag_reachable_extern_fns: uint = 0x90;
-pub static tag_reachable_extern_fn_id: uint = 0x91;
+pub const tag_reachable_extern_fns: uint = 0x90;
+pub const tag_reachable_extern_fn_id: uint = 0x91;
 
-pub static tag_items_data_item_stability: uint = 0x92;
+pub const tag_items_data_item_stability: uint = 0x92;
 
-pub static tag_items_data_item_repr: uint = 0x93;
+pub const tag_items_data_item_repr: uint = 0x93;
 
 #[deriving(Clone, Show)]
 pub struct LinkMeta {
@@ -222,29 +222,29 @@ pub struct LinkMeta {
     pub crate_hash: Svh,
 }
 
-pub static tag_unboxed_closures: uint = 0x95;
-pub static tag_unboxed_closure: uint = 0x96;
-pub static tag_unboxed_closure_type: uint = 0x97;
-pub static tag_unboxed_closure_kind: uint = 0x98;
+pub const tag_unboxed_closures: uint = 0x95;
+pub const tag_unboxed_closure: uint = 0x96;
+pub const tag_unboxed_closure_type: uint = 0x97;
+pub const tag_unboxed_closure_kind: uint = 0x98;
 
-pub static tag_struct_fields: uint = 0x99;
-pub static tag_struct_field: uint = 0x9a;
-pub static tag_struct_field_id: uint = 0x9b;
+pub const tag_struct_fields: uint = 0x99;
+pub const tag_struct_field: uint = 0x9a;
+pub const tag_struct_field_id: uint = 0x9b;
 
-pub static tag_attribute_is_sugared_doc: uint = 0x9c;
+pub const tag_attribute_is_sugared_doc: uint = 0x9c;
 
-pub static tag_trait_def_bounds: uint = 0x9d;
+pub const tag_trait_def_bounds: uint = 0x9d;
 
-pub static tag_items_data_region: uint = 0x9e;
+pub const tag_items_data_region: uint = 0x9e;
 
-pub static tag_region_param_def: uint = 0xa0;
-pub static tag_region_param_def_ident: uint = 0xa1;
-pub static tag_region_param_def_def_id: uint = 0xa2;
-pub static tag_region_param_def_space: uint = 0xa3;
-pub static tag_region_param_def_index: uint = 0xa4;
+pub const tag_region_param_def: uint = 0xa0;
+pub const tag_region_param_def_ident: uint = 0xa1;
+pub const tag_region_param_def_def_id: uint = 0xa2;
+pub const tag_region_param_def_space: uint = 0xa3;
+pub const tag_region_param_def_index: uint = 0xa4;
 
-pub static tag_type_param_def: uint = 0xa5;
+pub const tag_type_param_def: uint = 0xa5;
 
-pub static tag_item_generics: uint = 0xa6;
-pub static tag_method_ty_generics: uint = 0xa7;
+pub const tag_item_generics: uint = 0xa6;
+pub const tag_method_ty_generics: uint = 0xa7;
 
diff --git a/src/librustc/metadata/decoder.rs b/src/librustc/metadata/decoder.rs
index 58d0f132e06a2..dcf394aa3f406 100644
--- a/src/librustc/metadata/decoder.rs
+++ b/src/librustc/metadata/decoder.rs
@@ -126,12 +126,14 @@ enum Family {
     Trait,                 // I
     Struct,                // S
     PublicField,           // g
-    InheritedField         // N
+    InheritedField,        // N
+    Constant,              // C
 }
 
 fn item_family(item: rbml::Doc) -> Family {
     let fam = reader::get_doc(item, tag_items_data_item_family);
     match reader::doc_as_u8(fam) as char {
+      'C' => Constant,
       'c' => ImmStatic,
       'b' => MutStatic,
       'f' => Fn,
@@ -303,6 +305,7 @@ fn item_to_def_like(item: rbml::Doc, did: ast::DefId, cnum: ast::CrateNum)
     -> DefLike {
     let fam = item_family(item);
     match fam {
+        Constant  => DlDef(def::DefConst(did)),
         ImmStatic => DlDef(def::DefStatic(did, false)),
         MutStatic => DlDef(def::DefStatic(did, true)),
         Struct    => DlDef(def::DefStruct(did)),
diff --git a/src/librustc/metadata/encoder.rs b/src/librustc/metadata/encoder.rs
index 642f66e259a62..02f6a4a78dbc8 100644
--- a/src/librustc/metadata/encoder.rs
+++ b/src/librustc/metadata/encoder.rs
@@ -69,7 +69,6 @@ pub struct EncodeParams<'a, 'tcx: 'a> {
     pub tcx: &'a ty::ctxt<'tcx>,
     pub reexports2: &'a middle::resolve::ExportMap2,
     pub item_symbols: &'a RefCell<NodeMap<String>>,
-    pub non_inlineable_statics: &'a RefCell<NodeSet>,
     pub link_meta: &'a LinkMeta,
     pub cstore: &'a cstore::CStore,
     pub encode_inlined_item: EncodeInlinedItem<'a>,
@@ -81,7 +80,6 @@ pub struct EncodeContext<'a, 'tcx: 'a> {
     pub tcx: &'a ty::ctxt<'tcx>,
     pub reexports2: &'a middle::resolve::ExportMap2,
     pub item_symbols: &'a RefCell<NodeMap<String>>,
-    pub non_inlineable_statics: &'a RefCell<NodeSet>,
     pub link_meta: &'a LinkMeta,
     pub cstore: &'a cstore::CStore,
     pub encode_inlined_item: RefCell<EncodeInlinedItem<'a>>,
@@ -1069,12 +1067,20 @@ fn encode_info_for_item(ecx: &EncodeContext,
         encode_symbol(ecx, rbml_w, item.id);
         encode_name(rbml_w, item.ident.name);
         encode_path(rbml_w, path);
-
-        let inlineable = !ecx.non_inlineable_statics.borrow().contains(&item.id);
-
-        if inlineable {
-            encode_inlined_item(ecx, rbml_w, IIItemRef(item));
-        }
+        encode_visibility(rbml_w, vis);
+        encode_stability(rbml_w, stab);
+        encode_attributes(rbml_w, item.attrs.as_slice());
+        rbml_w.end_tag();
+      }
+      ItemConst(_, _) => {
+        add_to_index(item, rbml_w, index);
+        rbml_w.start_tag(tag_items_data_item);
+        encode_def_id(rbml_w, def_id);
+        encode_family(rbml_w, 'C');
+        encode_bounds_and_type(rbml_w, ecx, &lookup_item_type(tcx, def_id));
+        encode_name(rbml_w, item.ident.name);
+        encode_path(rbml_w, path);
+        encode_inlined_item(ecx, rbml_w, IIItemRef(item));
         encode_visibility(rbml_w, vis);
         encode_stability(rbml_w, stab);
         rbml_w.end_tag();
@@ -2029,7 +2035,7 @@ fn encode_dylib_dependency_formats(rbml_w: &mut Encoder, ecx: &EncodeContext) {
 
 // NB: Increment this as you change the metadata encoding version.
 #[allow(non_uppercase_statics)]
-pub static metadata_encoding_version : &'static [u8] = &[b'r', b'u', b's', b't', 0, 0, 0, 1 ];
+pub const metadata_encoding_version : &'static [u8] = &[b'r', b'u', b's', b't', 0, 0, 0, 1 ];
 
 pub fn encode_metadata(parms: EncodeParams, krate: &Crate) -> Vec<u8> {
     let mut wr = SeekableMemWriter::new();
@@ -2076,7 +2082,6 @@ fn encode_metadata_inner(wr: &mut SeekableMemWriter, parms: EncodeParams, krate:
         cstore,
         encode_inlined_item,
         link_meta,
-        non_inlineable_statics,
         reachable,
         ..
     } = parms;
@@ -2085,7 +2090,6 @@ fn encode_metadata_inner(wr: &mut SeekableMemWriter, parms: EncodeParams, krate:
         tcx: tcx,
         reexports2: reexports2,
         item_symbols: item_symbols,
-        non_inlineable_statics: non_inlineable_statics,
         link_meta: link_meta,
         cstore: cstore,
         encode_inlined_item: RefCell::new(encode_inlined_item),
diff --git a/src/librustc/metadata/loader.rs b/src/librustc/metadata/loader.rs
index dc97b6c0df8cc..62c179f598c96 100644
--- a/src/librustc/metadata/loader.rs
+++ b/src/librustc/metadata/loader.rs
@@ -241,23 +241,23 @@ use std::collections::hashmap::{Occupied, Vacant};
 use flate;
 use time;
 
-pub static MACOS_DLL_PREFIX: &'static str = "lib";
-pub static MACOS_DLL_SUFFIX: &'static str = ".dylib";
+pub const MACOS_DLL_PREFIX: &'static str = "lib";
+pub const MACOS_DLL_SUFFIX: &'static str = ".dylib";
 
-pub static WIN32_DLL_PREFIX: &'static str = "";
-pub static WIN32_DLL_SUFFIX: &'static str = ".dll";
+pub const WIN32_DLL_PREFIX: &'static str = "";
+pub const WIN32_DLL_SUFFIX: &'static str = ".dll";
 
-pub static LINUX_DLL_PREFIX: &'static str = "lib";
-pub static LINUX_DLL_SUFFIX: &'static str = ".so";
+pub const LINUX_DLL_PREFIX: &'static str = "lib";
+pub const LINUX_DLL_SUFFIX: &'static str = ".so";
 
-pub static FREEBSD_DLL_PREFIX: &'static str = "lib";
-pub static FREEBSD_DLL_SUFFIX: &'static str = ".so";
+pub const FREEBSD_DLL_PREFIX: &'static str = "lib";
+pub const FREEBSD_DLL_SUFFIX: &'static str = ".so";
 
-pub static DRAGONFLY_DLL_PREFIX: &'static str = "lib";
-pub static DRAGONFLY_DLL_SUFFIX: &'static str = ".so";
+pub const DRAGONFLY_DLL_PREFIX: &'static str = "lib";
+pub const DRAGONFLY_DLL_SUFFIX: &'static str = ".so";
 
-pub static ANDROID_DLL_PREFIX: &'static str = "lib";
-pub static ANDROID_DLL_SUFFIX: &'static str = ".so";
+pub const ANDROID_DLL_PREFIX: &'static str = "lib";
+pub const ANDROID_DLL_SUFFIX: &'static str = ".so";
 
 pub struct CrateMismatch {
     path: Path,
diff --git a/src/librustc/middle/astencode.rs b/src/librustc/middle/astencode.rs
index 2bd145706aaad..955228c99deed 100644
--- a/src/librustc/middle/astencode.rs
+++ b/src/librustc/middle/astencode.rs
@@ -460,6 +460,7 @@ impl tr for def::Def {
           def::DefMod(did) => { def::DefMod(did.tr(dcx)) }
           def::DefForeignMod(did) => { def::DefForeignMod(did.tr(dcx)) }
           def::DefStatic(did, m) => { def::DefStatic(did.tr(dcx), m) }
+          def::DefConst(did) => { def::DefConst(did.tr(dcx)) }
           def::DefLocal(nid) => { def::DefLocal(dcx.tr_id(nid)) }
           def::DefVariant(e_did, v_did, is_s) => {
             def::DefVariant(e_did.tr(dcx), v_did.tr(dcx), is_s)
diff --git a/src/librustc/middle/borrowck/gather_loans/mod.rs b/src/librustc/middle/borrowck/gather_loans/mod.rs
index cd003432ef22c..f2ff104ba1d10 100644
--- a/src/librustc/middle/borrowck/gather_loans/mod.rs
+++ b/src/librustc/middle/borrowck/gather_loans/mod.rs
@@ -169,15 +169,11 @@ fn check_aliasability(bccx: &BorrowckCtxt,
             // Borrow of an immutable static item:
             match safety {
                 mc::InteriorUnsafe => {
-                    // If the static item contains an Unsafe<T>, it has interior mutability.
-                    // In such cases, we cannot permit it to be borrowed, because the
-                    // static item resides in immutable memory and mutating it would
-                    // cause segfaults.
-                    bccx.tcx.sess.span_err(borrow_span,
-                                           "borrow of immutable static items \
-                                            with unsafe interior is not \
-                                            allowed");
-                    Err(())
+                    // If the static item contains an Unsafe<T>, it has interior
+                    // mutability.  In such cases, another phase of the compiler
+                    // will ensure that the type is `Sync` and then trans will
+                    // not put it in rodata, so this is ok to allow.
+                    Ok(())
                 }
                 mc::InteriorSafe => {
                     // Immutable static can be borrowed, no problem.
diff --git a/src/librustc/middle/borrowck/mod.rs b/src/librustc/middle/borrowck/mod.rs
index a86ae42006595..7d0d99443b0d8 100644
--- a/src/librustc/middle/borrowck/mod.rs
+++ b/src/librustc/middle/borrowck/mod.rs
@@ -106,7 +106,8 @@ fn borrowck_item(this: &mut BorrowckCtxt, item: &ast::Item) {
     // loan step is intended for things that have a data
     // flow dependent conditions.
     match item.node {
-        ast::ItemStatic(_, _, ref ex) => {
+        ast::ItemStatic(_, _, ref ex) |
+        ast::ItemConst(_, ref ex) => {
             gather_loans::gather_loans_in_static_initializer(this, &**ex);
         }
         _ => {
diff --git a/src/librustc/middle/check_const.rs b/src/librustc/middle/check_const.rs
index 5b6b0799235d0..f0455db6e3bb6 100644
--- a/src/librustc/middle/check_const.rs
+++ b/src/librustc/middle/check_const.rs
@@ -47,7 +47,9 @@ impl<'a, 'tcx, 'v> Visitor<'v> for CheckCrateVisitor<'a, 'tcx> {
         check_pat(self, p);
     }
     fn visit_expr(&mut self, ex: &Expr) {
-        check_expr(self, ex);
+        if check_expr(self, ex) {
+            visit::walk_expr(self, ex);
+        }
     }
 }
 
@@ -59,7 +61,8 @@ pub fn check_crate(tcx: &ty::ctxt) {
 
 fn check_item(v: &mut CheckCrateVisitor, it: &Item) {
     match it.node {
-        ItemStatic(_, _, ref ex) => {
+        ItemStatic(_, _, ref ex) |
+        ItemConst(_, ref ex) => {
             v.inside_const(|v| v.visit_expr(&**ex));
         }
         ItemEnum(ref enum_definition, _) => {
@@ -96,73 +99,81 @@ fn check_pat(v: &mut CheckCrateVisitor, p: &Pat) {
     }
 }
 
-fn check_expr(v: &mut CheckCrateVisitor, e: &Expr) {
-    if v.in_const {
-        match e.node {
-          ExprUnary(UnDeref, _) => { }
-          ExprUnary(UnUniq, _) => {
-            span_err!(v.tcx.sess, e.span, E0010, "cannot do allocations in constant expressions");
-            return;
-          }
-          ExprLit(ref lit) if ast_util::lit_is_str(&**lit) => {}
-          ExprBinary(..) | ExprUnary(..) => {
+fn check_expr(v: &mut CheckCrateVisitor, e: &Expr) -> bool {
+    if !v.in_const { return true }
+
+    match e.node {
+        ExprUnary(UnDeref, _) => {}
+        ExprUnary(UnUniq, _) => {
+            span_err!(v.tcx.sess, e.span, E0010,
+                      "cannot do allocations in constant expressions");
+            return false;
+        }
+        ExprLit(ref lit) if ast_util::lit_is_str(&**lit) => {}
+        ExprBinary(..) | ExprUnary(..) => {
             let method_call = typeck::MethodCall::expr(e.id);
             if v.tcx.method_map.borrow().contains_key(&method_call) {
                 span_err!(v.tcx.sess, e.span, E0011,
-                    "user-defined operators are not allowed in constant expressions");
+                          "user-defined operators are not allowed in constant \
+                           expressions");
             }
-          }
-          ExprLit(_) => (),
-          ExprCast(_, _) => {
+        }
+        ExprLit(_) => (),
+        ExprCast(_, _) => {
             let ety = ty::expr_ty(v.tcx, e);
             if !ty::type_is_numeric(ety) && !ty::type_is_unsafe_ptr(ety) {
                 span_err!(v.tcx.sess, e.span, E0012,
-                    "can not cast to `{}` in a constant expression",
-                    ppaux::ty_to_string(v.tcx, ety)
-                );
+                          "can not cast to `{}` in a constant expression",
+                          ppaux::ty_to_string(v.tcx, ety));
             }
-          }
-          ExprPath(ref pth) => {
+        }
+        ExprPath(ref pth) => {
             // NB: In the future you might wish to relax this slightly
             // to handle on-demand instantiation of functions via
             // foo::<bar> in a const. Currently that is only done on
             // a path in trans::callee that only works in block contexts.
             if !pth.segments.iter().all(|segment| segment.types.is_empty()) {
                 span_err!(v.tcx.sess, e.span, E0013,
-                    "paths in constants may only refer to items without type parameters");
+                          "paths in constants may only refer to items without \
+                           type parameters");
             }
             match v.tcx.def_map.borrow().find(&e.id) {
-              Some(&DefStatic(..)) |
-              Some(&DefFn(..)) |
-              Some(&DefVariant(_, _, _)) |
-              Some(&DefStruct(_)) => { }
-
-              Some(&def) => {
-                debug!("(checking const) found bad def: {:?}", def);
-                span_err!(v.tcx.sess, e.span, E0014,
-                    "paths in constants may only refer to constants or functions");
-              }
-              None => {
-                v.tcx.sess.span_bug(e.span, "unbound path in const?!");
-              }
+                Some(&DefStatic(..)) |
+                Some(&DefConst(..)) |
+                Some(&DefFn(..)) |
+                Some(&DefVariant(_, _, _)) |
+                Some(&DefStruct(_)) => { }
+
+                Some(&def) => {
+                    debug!("(checking const) found bad def: {:?}", def);
+                    span_err!(v.tcx.sess, e.span, E0014,
+                              "paths in constants may only refer to constants \
+                               or functions");
+                }
+                None => {
+                    v.tcx.sess.span_bug(e.span, "unbound path in const?!");
+                }
             }
-          }
-          ExprCall(ref callee, _) => {
+        }
+        ExprCall(ref callee, _) => {
             match v.tcx.def_map.borrow().find(&callee.id) {
                 Some(&DefStruct(..)) |
                 Some(&DefVariant(..)) => {}    // OK.
+
                 _ => {
                     span_err!(v.tcx.sess, e.span, E0015,
-                      "function calls in constants are limited to struct and enum constructors");
+                              "function calls in constants are limited to \
+                               struct and enum constructors");
                 }
             }
-          }
-          ExprBlock(ref block) => {
+        }
+        ExprBlock(ref block) => {
             // Check all statements in the block
             for stmt in block.stmts.iter() {
                 let block_span_err = |span|
                     span_err!(v.tcx.sess, span, E0016,
-                        "blocks in constants are limited to items and tail expressions");
+                              "blocks in constants are limited to items and \
+                               tail expressions");
                 match stmt.node {
                     StmtDecl(ref span, _) => {
                         match span.node {
@@ -174,40 +185,43 @@ fn check_expr(v: &mut CheckCrateVisitor, e: &Expr) {
                     }
                     StmtExpr(ref expr, _) => block_span_err(expr.span),
                     StmtSemi(ref semi, _) => block_span_err(semi.span),
-                    StmtMac(..) => v.tcx.sess.span_bug(e.span,
-                        "unexpanded statement macro in const?!")
+                    StmtMac(..) => {
+                        v.tcx.sess.span_bug(e.span, "unexpanded statement \
+                                                     macro in const?!")
+                    }
                 }
             }
             match block.expr {
-                Some(ref expr) => check_expr(v, &**expr),
+                Some(ref expr) => { check_expr(v, &**expr); }
                 None => {}
             }
-          }
-          ExprVec(_) |
-          ExprAddrOf(MutImmutable, _) |
-          ExprParen(..) |
-          ExprField(..) |
-          ExprTupField(..) |
-          ExprIndex(..) |
-          ExprTup(..) |
-          ExprRepeat(..) |
-          ExprStruct(..) => { }
-          ExprAddrOf(_, ref inner) => {
-                match inner.node {
-                    // Mutable slices are allowed.
-                    ExprVec(_) => {}
-                    _ => span_err!(v.tcx.sess, e.span, E0017,
-                                   "references in constants may only refer to immutable values")
+        }
+        ExprVec(_) |
+        ExprAddrOf(MutImmutable, _) |
+        ExprParen(..) |
+        ExprField(..) |
+        ExprTupField(..) |
+        ExprIndex(..) |
+        ExprTup(..) |
+        ExprRepeat(..) |
+        ExprStruct(..) => {}
 
-                }
-          },
+        ExprAddrOf(_, ref inner) => {
+            match inner.node {
+                // Mutable slices are allowed.
+                ExprVec(_) => {}
+                _ => span_err!(v.tcx.sess, e.span, E0017,
+                               "references in constants may only refer \
+                                to immutable values")
+
+            }
+        }
 
-          _ => {
-              span_err!(v.tcx.sess, e.span, E0019,
-                  "constant contains unimplemented expression type");
-              return;
-          }
+        _ => {
+            span_err!(v.tcx.sess, e.span, E0019,
+                      "constant contains unimplemented expression type");
+            return false;
         }
     }
-    visit::walk_expr(v, e);
+    true
 }
diff --git a/src/librustc/middle/check_match.rs b/src/librustc/middle/check_match.rs
index 92f04b108c19b..297640707687c 100644
--- a/src/librustc/middle/check_match.rs
+++ b/src/librustc/middle/check_match.rs
@@ -32,7 +32,7 @@ use syntax::ptr::P;
 use syntax::visit::{mod, Visitor, FnKind};
 use util::ppaux::ty_to_string;
 
-static DUMMY_WILD_PAT: Pat = Pat {
+pub const DUMMY_WILD_PAT: Pat = Pat {
     id: DUMMY_NODE_ID,
     node: PatWild(PatWildSingle),
     span: DUMMY_SP
@@ -299,9 +299,10 @@ fn raw_pat<'a>(p: &'a Pat) -> &'a Pat {
 fn check_exhaustive(cx: &MatchCheckCtxt, sp: Span, matrix: &Matrix) {
     match is_useful(cx, matrix, &[&DUMMY_WILD_PAT], ConstructWitness) {
         UsefulWithWitness(pats) => {
+            let dummy = DUMMY_WILD_PAT.clone();
             let witness = match pats.as_slice() {
                 [ref witness] => &**witness,
-                [] => &DUMMY_WILD_PAT,
+                [] => &dummy,
                 _ => unreachable!()
             };
             span_err!(cx.tcx.sess, sp, E0004,
@@ -349,7 +350,7 @@ impl<'a, 'tcx> Folder for StaticInliner<'a, 'tcx> {
             PatIdent(..) | PatEnum(..) => {
                 let def = self.tcx.def_map.borrow().find_copy(&pat.id);
                 match def {
-                    Some(DefStatic(did, _)) => match lookup_const_by_id(self.tcx, did) {
+                    Some(DefConst(did)) => match lookup_const_by_id(self.tcx, did) {
                         Some(const_expr) => {
                             const_expr_to_pat(self.tcx, const_expr).map(|mut new_pat| {
                                 new_pat.span = pat.span;
@@ -359,7 +360,7 @@ impl<'a, 'tcx> Folder for StaticInliner<'a, 'tcx> {
                         None => {
                             self.failed = true;
                             span_err!(self.tcx.sess, pat.span, E0158,
-                                "extern statics cannot be referenced in patterns");
+                                "statics cannot be referenced in patterns");
                             pat
                         }
                     },
@@ -555,8 +556,9 @@ fn is_useful(cx: &MatchCheckCtxt,
                             let arity = constructor_arity(cx, &c, left_ty);
                             let mut result = {
                                 let pat_slice = pats.as_slice();
+                                let dummy = DUMMY_WILD_PAT.clone();
                                 let subpats = Vec::from_fn(arity, |i| {
-                                    pat_slice.get(i).map_or(&DUMMY_WILD_PAT, |p| &**p)
+                                    pat_slice.get(i).map_or(&dummy, |p| &**p)
                                 });
                                 vec![construct_witness(cx, &c, subpats, left_ty)]
                             };
@@ -578,8 +580,9 @@ fn is_useful(cx: &MatchCheckCtxt,
                 }).collect();
                 match is_useful(cx, &matrix, v.tail(), witness) {
                     UsefulWithWitness(pats) => {
+                        let dummy = DUMMY_WILD_PAT.clone();
                         let arity = constructor_arity(cx, &constructor, left_ty);
-                        let wild_pats = Vec::from_elem(arity, &DUMMY_WILD_PAT);
+                        let wild_pats = Vec::from_elem(arity, &dummy);
                         let enum_pat = construct_witness(cx, &constructor, wild_pats, left_ty);
                         let mut new_pats = vec![enum_pat];
                         new_pats.extend(pats.into_iter());
@@ -600,10 +603,11 @@ fn is_useful_specialized(cx: &MatchCheckCtxt, &Matrix(ref m): &Matrix,
                          v: &[&Pat], ctor: Constructor, lty: ty::t,
                          witness: WitnessPreference) -> Usefulness {
     let arity = constructor_arity(cx, &ctor, lty);
+    let dummy = DUMMY_WILD_PAT.clone();
     let matrix = Matrix(m.iter().filter_map(|r| {
-        specialize(cx, r.as_slice(), &ctor, 0u, arity)
+        specialize(cx, r.as_slice(), &dummy, &ctor, 0u, arity)
     }).collect());
-    match specialize(cx, v, &ctor, 0u, arity) {
+    match specialize(cx, v, &dummy, &ctor, 0u, arity) {
         Some(v) => is_useful(cx, &matrix, v.as_slice(), witness),
         None => NotUseful
     }
@@ -624,23 +628,26 @@ fn pat_constructors(cx: &MatchCheckCtxt, p: &Pat,
     match pat.node {
         PatIdent(..) =>
             match cx.tcx.def_map.borrow().find(&pat.id) {
-                Some(&DefStatic(..)) =>
-                    cx.tcx.sess.span_bug(pat.span, "static pattern should've been rewritten"),
+                Some(&DefConst(..)) =>
+                    cx.tcx.sess.span_bug(pat.span, "const pattern should've \
+                                                    been rewritten"),
                 Some(&DefStruct(_)) => vec!(Single),
                 Some(&DefVariant(_, id, _)) => vec!(Variant(id)),
                 _ => vec!()
             },
         PatEnum(..) =>
             match cx.tcx.def_map.borrow().find(&pat.id) {
-                Some(&DefStatic(..)) =>
-                    cx.tcx.sess.span_bug(pat.span, "static pattern should've been rewritten"),
+                Some(&DefConst(..)) =>
+                    cx.tcx.sess.span_bug(pat.span, "static pattern should've \
+                                                    been rewritten"),
                 Some(&DefVariant(_, id, _)) => vec!(Variant(id)),
                 _ => vec!(Single)
             },
         PatStruct(..) =>
             match cx.tcx.def_map.borrow().find(&pat.id) {
-                Some(&DefStatic(..)) =>
-                    cx.tcx.sess.span_bug(pat.span, "static pattern should've been rewritten"),
+                Some(&DefConst(..)) =>
+                    cx.tcx.sess.span_bug(pat.span, "static pattern should've \
+                                                    been rewritten"),
                 Some(&DefVariant(_, id, _)) => vec!(Variant(id)),
                 _ => vec!(Single)
             },
@@ -722,7 +729,7 @@ fn range_covered_by_constructor(ctor: &Constructor,
 /// different patterns.
 /// Structure patterns with a partial wild pattern (Foo { a: 42, .. }) have their missing
 /// fields filled with wild patterns.
-pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat],
+pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat], dummy: &'a Pat,
                       constructor: &Constructor, col: uint, arity: uint) -> Option<Vec<&'a Pat>> {
     let &Pat {
         id: pat_id, node: ref node, span: pat_span
@@ -730,32 +737,34 @@ pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat],
     let head: Option<Vec<&Pat>> = match node {
 
         &PatWild(_) =>
-            Some(Vec::from_elem(arity, &DUMMY_WILD_PAT)),
+            Some(Vec::from_elem(arity, dummy)),
 
         &PatIdent(_, _, _) => {
             let opt_def = cx.tcx.def_map.borrow().find_copy(&pat_id);
             match opt_def {
-                Some(DefStatic(..)) =>
-                    cx.tcx.sess.span_bug(pat_span, "static pattern should've been rewritten"),
+                Some(DefConst(..)) =>
+                    cx.tcx.sess.span_bug(pat_span, "const pattern should've \
+                                                    been rewritten"),
                 Some(DefVariant(_, id, _)) => if *constructor == Variant(id) {
                     Some(vec!())
                 } else {
                     None
                 },
-                _ => Some(Vec::from_elem(arity, &DUMMY_WILD_PAT))
+                _ => Some(Vec::from_elem(arity, dummy))
             }
         }
 
         &PatEnum(_, ref args) => {
             let def = cx.tcx.def_map.borrow().get_copy(&pat_id);
             match def {
-                DefStatic(..) =>
-                    cx.tcx.sess.span_bug(pat_span, "static pattern should've been rewritten"),
+                DefConst(..) =>
+                    cx.tcx.sess.span_bug(pat_span, "const pattern should've \
+                                                    been rewritten"),
                 DefVariant(_, id, _) if *constructor != Variant(id) => None,
                 DefVariant(..) | DefStruct(..) => {
                     Some(match args {
                         &Some(ref args) => args.iter().map(|p| &**p).collect(),
-                        &None => Vec::from_elem(arity, &DUMMY_WILD_PAT)
+                        &None => Vec::from_elem(arity, dummy)
                     })
                 }
                 _ => None
@@ -766,8 +775,9 @@ pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat],
             // Is this a struct or an enum variant?
             let def = cx.tcx.def_map.borrow().get_copy(&pat_id);
             let class_id = match def {
-                DefStatic(..) =>
-                    cx.tcx.sess.span_bug(pat_span, "static pattern should've been rewritten"),
+                DefConst(..) =>
+                    cx.tcx.sess.span_bug(pat_span, "const pattern should've \
+                                                    been rewritten"),
                 DefVariant(_, variant_id, _) => if *constructor == Variant(variant_id) {
                     Some(variant_id)
                 } else {
@@ -790,7 +800,7 @@ pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat],
                 let args = struct_fields.iter().map(|sf| {
                     match pattern_fields.iter().find(|f| f.ident.name == sf.name) {
                         Some(ref f) => &*f.pat,
-                        _ => &DUMMY_WILD_PAT
+                        _ => dummy
                     }
                 }).collect();
                 args
@@ -833,13 +843,13 @@ pub fn specialize<'a>(cx: &MatchCheckCtxt, r: &[&'a Pat],
                 // Fixed-length vectors.
                 Single => {
                     let mut pats: Vec<&Pat> = before.iter().map(|p| &**p).collect();
-                    pats.grow_fn(arity - before.len() - after.len(), |_| &DUMMY_WILD_PAT);
+                    pats.grow_fn(arity - before.len() - after.len(), |_| dummy);
                     pats.extend(after.iter().map(|p| &**p));
                     Some(pats)
                 },
                 Slice(length) if before.len() + after.len() <= length && slice.is_some() => {
                     let mut pats: Vec<&Pat> = before.iter().map(|p| &**p).collect();
-                    pats.grow_fn(arity - before.len() - after.len(), |_| &DUMMY_WILD_PAT);
+                    pats.grow_fn(arity - before.len() - after.len(), |_| dummy);
                     pats.extend(after.iter().map(|p| &**p));
                     Some(pats)
                 },
diff --git a/src/librustc/middle/check_static.rs b/src/librustc/middle/check_static.rs
index 64e4d7ff28425..9cc1f92dc9304 100644
--- a/src/librustc/middle/check_static.rs
+++ b/src/librustc/middle/check_static.rs
@@ -25,48 +25,103 @@
 // by borrowck::gather_loans
 
 use middle::ty;
+use middle::def;
+use middle::typeck;
+use middle::traits;
+use middle::mem_categorization as mc;
+use middle::expr_use_visitor as euv;
+use util::nodemap::NodeSet;
 
 use syntax::ast;
+use syntax::print::pprust;
 use syntax::visit::Visitor;
+use syntax::codemap::{DUMMY_SP, Span};
 use syntax::visit;
-use syntax::print::pprust;
-
-
-fn safe_type_for_static_mut(cx: &ty::ctxt, e: &ast::Expr) -> Option<String> {
-    let node_ty = ty::node_id_to_type(cx, e.id);
-    let tcontents = ty::type_contents(cx, node_ty);
-    debug!("safe_type_for_static_mut(dtor={}, managed={}, owned={})",
-           tcontents.has_dtor(), tcontents.owns_managed(), tcontents.owns_owned())
-
-    let suffix = if tcontents.has_dtor() {
-        "destructors"
-    } else if tcontents.owns_managed() {
-        "managed pointers"
-    } else if tcontents.owns_owned() {
-        "owned pointers"
-    } else {
-        return None;
-    };
 
-    Some(format!("mutable static items are not allowed to have {}", suffix))
+#[deriving(Eq, PartialEq)]
+enum Mode {
+    InConstant,
+    InStatic,
+    InStaticMut,
+    InNothing,
 }
 
 struct CheckStaticVisitor<'a, 'tcx: 'a> {
     tcx: &'a ty::ctxt<'tcx>,
-    in_const: bool
+    mode: Mode,
+    checker: &'a mut GlobalChecker,
+}
+
+struct GlobalVisitor<'a, 'b, 't: 'b>(euv::ExprUseVisitor<'a, 'b, ty::ctxt<'t>>);
+struct GlobalChecker {
+    static_consumptions: NodeSet,
+    const_borrows: NodeSet,
+    static_interior_borrows: NodeSet,
 }
 
 pub fn check_crate(tcx: &ty::ctxt) {
-    visit::walk_crate(&mut CheckStaticVisitor { tcx: tcx, in_const: false },
-                      tcx.map.krate())
+    let mut checker = GlobalChecker {
+        static_consumptions: NodeSet::new(),
+        const_borrows: NodeSet::new(),
+        static_interior_borrows: NodeSet::new(),
+    };
+    {
+        let visitor = euv::ExprUseVisitor::new(&mut checker, tcx);
+        visit::walk_crate(&mut GlobalVisitor(visitor), tcx.map.krate());
+    }
+    visit::walk_crate(&mut CheckStaticVisitor {
+        tcx: tcx,
+        mode: InNothing,
+        checker: &mut checker,
+    }, tcx.map.krate());
 }
 
 impl<'a, 'tcx> CheckStaticVisitor<'a, 'tcx> {
-    fn with_const(&mut self, in_const: bool, f: |&mut CheckStaticVisitor<'a, 'tcx>|) {
-        let was_const = self.in_const;
-        self.in_const = in_const;
+    fn with_mode(&mut self, mode: Mode, f: |&mut CheckStaticVisitor<'a, 'tcx>|) {
+        let old = self.mode;
+        self.mode = mode;
         f(self);
-        self.in_const = was_const;
+        self.mode = old;
+    }
+
+    fn msg(&self) -> &'static str {
+        match self.mode {
+            InConstant => "constants",
+            InStaticMut | InStatic => "statics",
+            InNothing => unreachable!(),
+        }
+    }
+
+    fn check_static_mut_type(&self, e: &ast::Expr) {
+        let node_ty = ty::node_id_to_type(self.tcx, e.id);
+        let tcontents = ty::type_contents(self.tcx, node_ty);
+
+        let suffix = if tcontents.has_dtor() {
+            "destructors"
+        } else if tcontents.owns_owned() {
+            "owned pointers"
+        } else {
+            return
+        };
+
+        self.tcx.sess.span_err(e.span, format!("mutable statics are not allowed \
+                                                to have {}", suffix).as_slice());
+    }
+
+    fn check_static_type(&self, e: &ast::Expr) {
+        let ty = ty::node_id_to_type(self.tcx, e.id);
+        let infcx = typeck::infer::new_infer_ctxt(self.tcx);
+        let mut fulfill_cx = traits::FulfillmentContext::new();
+        let cause = traits::ObligationCause::misc(DUMMY_SP);
+        let obligation = traits::obligation_for_builtin_bound(self.tcx, cause, ty,
+                                                              ty::BoundSync);
+        fulfill_cx.register_obligation(self.tcx, obligation.unwrap());
+        let env = ty::empty_parameter_environment();
+        let result = fulfill_cx.select_all_or_error(&infcx, &env, self.tcx).is_ok();
+        if !result {
+            self.tcx.sess.span_err(e.span, "shared static items must have a \
+                                            type which implements Sync");
+        }
     }
 }
 
@@ -74,22 +129,20 @@ impl<'a, 'tcx, 'v> Visitor<'v> for CheckStaticVisitor<'a, 'tcx> {
     fn visit_item(&mut self, i: &ast::Item) {
         debug!("visit_item(item={})", pprust::item_to_string(i));
         match i.node {
-            ast::ItemStatic(_, mutability, ref expr) => {
-                match mutability {
-                    ast::MutImmutable => {
-                        self.with_const(true, |v| v.visit_expr(&**expr));
-                    }
-                    ast::MutMutable => {
-                        match safe_type_for_static_mut(self.tcx, &**expr) {
-                            Some(msg) => {
-                                self.tcx.sess.span_err(expr.span, msg.as_slice());
-                            }
-                            None => {}
-                        }
-                    }
-                }
+            ast::ItemStatic(_, ast::MutImmutable, ref expr) => {
+                self.check_static_type(&**expr);
+                self.with_mode(InStatic, |v| v.visit_expr(&**expr));
+            }
+            ast::ItemStatic(_, ast::MutMutable, ref expr) => {
+                self.check_static_mut_type(&**expr);
+                self.with_mode(InStaticMut, |v| v.visit_expr(&**expr));
+            }
+            ast::ItemConst(_, ref expr) => {
+                self.with_mode(InConstant, |v| v.visit_expr(&**expr));
+            }
+            _ => {
+                self.with_mode(InNothing, |v| visit::walk_item(v, i));
             }
-            _ => self.with_const(false, |v| visit::walk_item(v, i))
         }
     }
 
@@ -100,42 +153,170 @@ impl<'a, 'tcx, 'v> Visitor<'v> for CheckStaticVisitor<'a, 'tcx> {
     /// of a static item, this method does nothing but walking
     /// down through it.
     fn visit_expr(&mut self, e: &ast::Expr) {
-        debug!("visit_expr(expr={})", pprust::expr_to_string(e));
-
-        if !self.in_const {
+        if self.mode == InNothing {
             return visit::walk_expr(self, e);
         }
 
-        match e.node {
-            ast::ExprField(..) | ast::ExprTupField(..) | ast::ExprVec(..) |
-            ast::ExprBlock(..) | ast::ExprTup(..)  => {
-                visit::walk_expr(self, e);
+        let node_ty = ty::node_id_to_type(self.tcx, e.id);
+
+        match ty::get(node_ty).sty {
+            ty::ty_struct(did, _) |
+            ty::ty_enum(did, _) if ty::has_dtor(self.tcx, did) => {
+                self.tcx.sess.span_err(e.span,
+                                       format!("{} are not allowed to have \
+                                                destructors", self.msg()).as_slice())
             }
+            _ => {}
+        }
+
+        // statics cannot be consumed by value at any time, that would imply
+        // that they're an initializer (what a const is for) or kept in sync
+        // over time (not feasible), so deny it outright.
+        if self.checker.static_consumptions.remove(&e.id) {
+            self.tcx.sess.span_err(e.span, "cannot refer to other statics by \
+                                            value, use the address-of operator \
+                                            or a constant instead");
+        }
+
+        // Borrowed statics can specifically *only* have their address taken,
+        // not any number of other borrows such as borrowing fields, reading
+        // elements of an array, etc.
+        if self.checker.static_interior_borrows.remove(&e.id) {
+            self.tcx.sess.span_err(e.span, "cannot refer to the interior of \
+                                            another static, use a constant \
+                                            instead");
+        }
+
+        // constants cannot be borrowed if they contain interior mutability as
+        // it means that our "silent insertion of statics" could change
+        // initializer values (very bad).
+        if self.checker.const_borrows.remove(&e.id) {
+            let node_ty = ty::node_id_to_type(self.tcx, e.id);
+            let tcontents = ty::type_contents(self.tcx, node_ty);
+            if tcontents.interior_unsafe() {
+                self.tcx.sess.span_err(e.span, "cannot borrow a constant which \
+                                                contains interior mutability, \
+                                                create a static instead");
+            }
+        }
+
+        match e.node {
             ast::ExprAddrOf(ast::MutMutable, _) => {
-                span_err!(self.tcx.sess, e.span, E0020,
-                    "static items are not allowed to have mutable slices");
+                if self.mode != InStaticMut {
+                    span_err!(self.tcx.sess, e.span, E0020,
+                              "{} are not allowed to have mutable references",
+                              self.msg());
+                }
             },
             ast::ExprBox(..) |
             ast::ExprUnary(ast::UnUniq, _) => {
                 span_err!(self.tcx.sess, e.span, E0022,
-                    "static items are not allowed to have custom pointers");
+                          "{} are not allowed to have custom pointers",
+                          self.msg());
             }
-            _ => {
-                let node_ty = ty::node_id_to_type(self.tcx, e.id);
-
-                match ty::get(node_ty).sty {
-                    ty::ty_struct(did, _) |
-                    ty::ty_enum(did, _) => {
-                        if ty::has_dtor(self.tcx, did) {
-                            self.tcx.sess.span_err(e.span,
-                                "static items are not allowed to have destructors");
-                            return;
-                        }
+            ast::ExprPath(..) => {
+                match ty::resolve_expr(self.tcx, e) {
+                    def::DefStatic(..) if self.mode == InConstant => {
+                        let msg = "constants cannot refer to other statics, \
+                                   insert an intermediate constant \
+                                   instead";
+                        self.tcx.sess.span_err(e.span, msg.as_slice());
                     }
                     _ => {}
                 }
-                visit::walk_expr(self, e);
             }
+            _ => {}
+        }
+        visit::walk_expr(self, e);
+    }
+}
+
+impl<'a, 'b, 't, 'v> Visitor<'v> for GlobalVisitor<'a, 'b, 't> {
+    fn visit_item(&mut self, item: &ast::Item) {
+        match item.node {
+            ast::ItemConst(_, ref e) |
+            ast::ItemStatic(_, _, ref e) => {
+                let GlobalVisitor(ref mut v) = *self;
+                v.consume_expr(&**e);
+            }
+            _ => {}
         }
+        visit::walk_item(self, item);
     }
 }
+
+impl euv::Delegate for GlobalChecker {
+    fn consume(&mut self,
+               consume_id: ast::NodeId,
+               _consume_span: Span,
+               cmt: mc::cmt,
+               _mode: euv::ConsumeMode) {
+        let mut cur = &cmt;
+        loop {
+            match cur.cat {
+                mc::cat_static_item => {
+                    self.static_consumptions.insert(consume_id);
+                    break
+                }
+                mc::cat_deref(ref cmt, _, _) |
+                mc::cat_discr(ref cmt, _) |
+                mc::cat_downcast(ref cmt) |
+                mc::cat_interior(ref cmt, _) => cur = cmt,
+
+                mc::cat_rvalue(..) |
+                mc::cat_copied_upvar(..) |
+                mc::cat_upvar(..) |
+                mc::cat_local(..) => break,
+            }
+        }
+    }
+    fn borrow(&mut self,
+              borrow_id: ast::NodeId,
+              _borrow_span: Span,
+              cmt: mc::cmt,
+              _loan_region: ty::Region,
+              _bk: ty::BorrowKind,
+              _loan_cause: euv::LoanCause) {
+        let mut cur = &cmt;
+        let mut is_interior = false;
+        loop {
+            match cur.cat {
+                mc::cat_rvalue(..) => {
+                    self.const_borrows.insert(borrow_id);
+                    break
+                }
+                mc::cat_static_item => {
+                    if is_interior {
+                        self.static_interior_borrows.insert(borrow_id);
+                    }
+                    break
+                }
+                mc::cat_deref(ref cmt, _, _) |
+                mc::cat_interior(ref cmt, _) => {
+                    is_interior = true;
+                    cur = cmt;
+                }
+
+                mc::cat_downcast(..) |
+                mc::cat_discr(..) |
+                mc::cat_copied_upvar(..) |
+                mc::cat_upvar(..) |
+                mc::cat_local(..) => unreachable!(),
+            }
+        }
+    }
+
+    fn decl_without_init(&mut self,
+                         _id: ast::NodeId,
+                         _span: Span) {}
+    fn mutate(&mut self,
+              _assignment_id: ast::NodeId,
+              _assignment_span: Span,
+              _assignee_cmt: mc::cmt,
+              _mode: euv::MutateMode) {}
+    fn consume_pat(&mut self,
+                   _consume_pat: &ast::Pat,
+                   _cmt: mc::cmt,
+                   _mode: euv::ConsumeMode) {}
+}
+
diff --git a/src/librustc/middle/check_static_recursion.rs b/src/librustc/middle/check_static_recursion.rs
index b571a18c1ece7..1f76d9dba2635 100644
--- a/src/librustc/middle/check_static_recursion.rs
+++ b/src/librustc/middle/check_static_recursion.rs
@@ -13,9 +13,9 @@
 
 use driver::session::Session;
 use middle::resolve;
-use middle::def::DefStatic;
+use middle::def::{DefStatic, DefConst};
 
-use syntax::ast::{Crate, Expr, ExprPath, Item, ItemStatic, NodeId};
+use syntax::ast;
 use syntax::{ast_util, ast_map};
 use syntax::visit::Visitor;
 use syntax::visit;
@@ -27,13 +27,13 @@ struct CheckCrateVisitor<'a, 'ast: 'a> {
 }
 
 impl<'v, 'a, 'ast> Visitor<'v> for CheckCrateVisitor<'a, 'ast> {
-    fn visit_item(&mut self, i: &Item) {
+    fn visit_item(&mut self, i: &ast::Item) {
         check_item(self, i);
     }
 }
 
 pub fn check_crate<'ast>(sess: &Session,
-                         krate: &Crate,
+                         krate: &ast::Crate,
                          def_map: &resolve::DefMap,
                          ast_map: &ast_map::Map<'ast>) {
     let mut visitor = CheckCrateVisitor {
@@ -45,9 +45,10 @@ pub fn check_crate<'ast>(sess: &Session,
     sess.abort_if_errors();
 }
 
-fn check_item(v: &mut CheckCrateVisitor, it: &Item) {
+fn check_item(v: &mut CheckCrateVisitor, it: &ast::Item) {
     match it.node {
-        ItemStatic(_, _, ref ex) => {
+        ast::ItemStatic(_, _, ref ex) |
+        ast::ItemConst(_, ref ex) => {
             check_item_recursion(v.sess, v.ast_map, v.def_map, it);
             visit::walk_expr(v, &**ex)
         },
@@ -56,11 +57,11 @@ fn check_item(v: &mut CheckCrateVisitor, it: &Item) {
 }
 
 struct CheckItemRecursionVisitor<'a, 'ast: 'a> {
-    root_it: &'a Item,
+    root_it: &'a ast::Item,
     sess: &'a Session,
     ast_map: &'a ast_map::Map<'ast>,
     def_map: &'a resolve::DefMap,
-    idstack: Vec<NodeId>
+    idstack: Vec<ast::NodeId>
 }
 
 // Make sure a const item doesn't recursively refer to itself
@@ -68,7 +69,7 @@ struct CheckItemRecursionVisitor<'a, 'ast: 'a> {
 pub fn check_item_recursion<'a>(sess: &'a Session,
                                 ast_map: &'a ast_map::Map,
                                 def_map: &'a resolve::DefMap,
-                                it: &'a Item) {
+                                it: &'a ast::Item) {
 
     let mut visitor = CheckItemRecursionVisitor {
         root_it: it,
@@ -81,7 +82,7 @@ pub fn check_item_recursion<'a>(sess: &'a Session,
 }
 
 impl<'a, 'ast, 'v> Visitor<'v> for CheckItemRecursionVisitor<'a, 'ast> {
-    fn visit_item(&mut self, it: &Item) {
+    fn visit_item(&mut self, it: &ast::Item) {
         if self.idstack.iter().any(|x| x == &(it.id)) {
             self.sess.span_err(self.root_it.span, "recursive constant");
             return;
@@ -91,11 +92,12 @@ impl<'a, 'ast, 'v> Visitor<'v> for CheckItemRecursionVisitor<'a, 'ast> {
         self.idstack.pop();
     }
 
-    fn visit_expr(&mut self, e: &Expr) {
+    fn visit_expr(&mut self, e: &ast::Expr) {
         match e.node {
-            ExprPath(..) => {
+            ast::ExprPath(..) => {
                 match self.def_map.borrow().find(&e.id) {
-                    Some(&DefStatic(def_id, _)) if
+                    Some(&DefStatic(def_id, _)) |
+                    Some(&DefConst(def_id)) if
                             ast_util::is_local(def_id) => {
                         self.visit_item(&*self.ast_map.expect_item(def_id.node));
                     }
diff --git a/src/librustc/middle/const_eval.rs b/src/librustc/middle/const_eval.rs
index 98d2cefac0fcf..abcdc45bdcfde 100644
--- a/src/librustc/middle/const_eval.rs
+++ b/src/librustc/middle/const_eval.rs
@@ -87,7 +87,7 @@ pub fn join_all<It: Iterator<constness>>(mut cs: It) -> constness {
 fn lookup_const<'a>(tcx: &'a ty::ctxt, e: &Expr) -> Option<&'a Expr> {
     let opt_def = tcx.def_map.borrow().find_copy(&e.id);
     match opt_def {
-        Some(def::DefStatic(def_id, false)) => {
+        Some(def::DefConst(def_id)) => {
             lookup_const_by_id(tcx, def_id)
         }
         Some(def::DefVariant(enum_def, variant_def, _)) => {
@@ -155,7 +155,7 @@ pub fn lookup_const_by_id<'a>(tcx: &'a ty::ctxt, def_id: ast::DefId)
         match tcx.map.find(def_id.node) {
             None => None,
             Some(ast_map::NodeItem(it)) => match it.node {
-                ItemStatic(_, ast::MutImmutable, ref const_expr) => {
+                ItemConst(_, ref const_expr) => {
                     Some(&**const_expr)
                 }
                 _ => None
@@ -173,7 +173,7 @@ pub fn lookup_const_by_id<'a>(tcx: &'a ty::ctxt, def_id: ast::DefId)
         let expr_id = match csearch::maybe_get_item_ast(tcx, def_id,
             |a, b, c, d| astencode::decode_inlined_item(a, b, c, d)) {
             csearch::found(&ast::IIItem(ref item)) => match item.node {
-                ItemStatic(_, ast::MutImmutable, ref const_expr) => Some(const_expr.id),
+                ItemConst(_, ref const_expr) => Some(const_expr.id),
                 _ => None
             },
             _ => None
diff --git a/src/librustc/middle/dead.rs b/src/librustc/middle/dead.rs
index 1b2f62a9385a2..ff3720381009c 100644
--- a/src/librustc/middle/dead.rs
+++ b/src/librustc/middle/dead.rs
@@ -215,7 +215,8 @@ impl<'a, 'tcx> MarkSymbolVisitor<'a, 'tcx> {
                     ast::ItemFn(..)
                     | ast::ItemEnum(..)
                     | ast::ItemTy(..)
-                    | ast::ItemStatic(..) => {
+                    | ast::ItemStatic(..)
+                    | ast::ItemConst(..) => {
                         visit::walk_item(self, &*item);
                     }
                     _ => ()
diff --git a/src/librustc/middle/def.rs b/src/librustc/middle/def.rs
index bd42586435f26..3b7af9788ac57 100644
--- a/src/librustc/middle/def.rs
+++ b/src/librustc/middle/def.rs
@@ -20,6 +20,7 @@ pub enum Def {
     DefMod(ast::DefId),
     DefForeignMod(ast::DefId),
     DefStatic(ast::DefId, bool /* is_mutbl */),
+    DefConst(ast::DefId),
     DefLocal(ast::NodeId),
     DefVariant(ast::DefId /* enum */, ast::DefId /* variant */, bool /* is_structure */),
     DefTy(ast::DefId, bool /* is_enum */),
@@ -61,7 +62,7 @@ impl Def {
             DefForeignMod(id) | DefStatic(id, _) |
             DefVariant(_, id, _) | DefTy(id, _) | DefAssociatedTy(id) |
             DefTyParam(_, id, _) | DefUse(id) | DefStruct(id) | DefTrait(id) |
-            DefMethod(id, _) => {
+            DefMethod(id, _) | DefConst(id) => {
                 id
             }
             DefLocal(id) |
diff --git a/src/librustc/middle/expr_use_visitor.rs b/src/librustc/middle/expr_use_visitor.rs
index 51cdbfcf2514c..6cfdac93efc8a 100644
--- a/src/librustc/middle/expr_use_visitor.rs
+++ b/src/librustc/middle/expr_use_visitor.rs
@@ -267,7 +267,7 @@ impl<'d,'t,'tcx,TYPER:mc::Typer<'tcx>> ExprUseVisitor<'d,'t,TYPER> {
         }
     }
 
-    fn consume_expr(&mut self, expr: &ast::Expr) {
+    pub fn consume_expr(&mut self, expr: &ast::Expr) {
         debug!("consume_expr(expr={})", expr.repr(self.tcx()));
 
         let cmt = return_if_err!(self.mc.cat_expr(expr));
diff --git a/src/librustc/middle/graph.rs b/src/librustc/middle/graph.rs
index 9135ca07935a5..8484ec9293496 100644
--- a/src/librustc/middle/graph.rs
+++ b/src/librustc/middle/graph.rs
@@ -58,20 +58,20 @@ pub struct Edge<E> {
 #[deriving(Clone, PartialEq, Show)]
 pub struct NodeIndex(pub uint);
 #[allow(non_uppercase_statics)]
-pub static InvalidNodeIndex: NodeIndex = NodeIndex(uint::MAX);
+pub const InvalidNodeIndex: NodeIndex = NodeIndex(uint::MAX);
 
 #[deriving(PartialEq)]
 pub struct EdgeIndex(pub uint);
 #[allow(non_uppercase_statics)]
-pub static InvalidEdgeIndex: EdgeIndex = EdgeIndex(uint::MAX);
+pub const InvalidEdgeIndex: EdgeIndex = EdgeIndex(uint::MAX);
 
 // Use a private field here to guarantee no more instances are created:
 #[deriving(Show)]
 pub struct Direction { repr: uint }
 #[allow(non_uppercase_statics)]
-pub static Outgoing: Direction = Direction { repr: 0 };
+pub const Outgoing: Direction = Direction { repr: 0 };
 #[allow(non_uppercase_statics)]
-pub static Incoming: Direction = Direction { repr: 1 };
+pub const Incoming: Direction = Direction { repr: 1 };
 
 impl NodeIndex {
     fn get(&self) -> uint { let NodeIndex(v) = *self; v }
diff --git a/src/librustc/middle/mem_categorization.rs b/src/librustc/middle/mem_categorization.rs
index 9a0885ca30135..fa494b357c19d 100644
--- a/src/librustc/middle/mem_categorization.rs
+++ b/src/librustc/middle/mem_categorization.rs
@@ -544,7 +544,7 @@ impl<'t,'tcx,TYPER:Typer<'tcx>> MemCategorizationContext<'t,TYPER> {
 
         match def {
           def::DefStruct(..) | def::DefVariant(..) | def::DefFn(..) |
-          def::DefStaticMethod(..) => {
+          def::DefStaticMethod(..) | def::DefConst(..) => {
                 Ok(self.cat_rvalue_node(id, span, expr_ty))
           }
           def::DefMod(_) | def::DefForeignMod(_) | def::DefUse(_) |
@@ -1104,7 +1104,7 @@ impl<'t,'tcx,TYPER:Typer<'tcx>> MemCategorizationContext<'t,TYPER> {
                                                 |x,y,z| op(x,y,z)));
                     }
                 }
-                Some(&def::DefStatic(..)) => {
+                Some(&def::DefConst(..)) => {
                     for subpat in subpats.iter() {
                         if_ok!(self.cat_pattern(cmt.clone(), &**subpat, |x,y,z| op(x,y,z)));
                     }
diff --git a/src/librustc/middle/pat_util.rs b/src/librustc/middle/pat_util.rs
index e3806f02ed4c8..4d61baca70874 100644
--- a/src/librustc/middle/pat_util.rs
+++ b/src/librustc/middle/pat_util.rs
@@ -46,7 +46,7 @@ pub fn pat_is_const(dm: &resolve::DefMap, pat: &Pat) -> bool {
     match pat.node {
         PatIdent(_, _, None) | PatEnum(..) => {
             match dm.borrow().find(&pat.id) {
-                Some(&DefStatic(_, false)) => true,
+                Some(&DefConst(..)) => true,
                 _ => false
             }
         }
diff --git a/src/librustc/middle/privacy.rs b/src/librustc/middle/privacy.rs
index 7e415d1f5c1a7..e434d859993c0 100644
--- a/src/librustc/middle/privacy.rs
+++ b/src/librustc/middle/privacy.rs
@@ -805,6 +805,7 @@ impl<'a, 'tcx> PrivacyVisitor<'a, 'tcx> {
             def::DefStaticMethod(..) => ck("static method"),
             def::DefFn(..) => ck("function"),
             def::DefStatic(..) => ck("static"),
+            def::DefConst(..) => ck("const"),
             def::DefVariant(..) => ck("variant"),
             def::DefTy(_, false) => ck("type"),
             def::DefTy(_, true) => ck("enum"),
@@ -1181,7 +1182,7 @@ impl<'a, 'tcx> SanePrivacyVisitor<'a, 'tcx> {
                 }
             }
 
-            ast::ItemStatic(..) | ast::ItemStruct(..) |
+            ast::ItemConst(..) | ast::ItemStatic(..) | ast::ItemStruct(..) |
             ast::ItemFn(..) | ast::ItemMod(..) | ast::ItemTy(..) |
             ast::ItemMac(..) => {}
         }
@@ -1245,7 +1246,7 @@ impl<'a, 'tcx> SanePrivacyVisitor<'a, 'tcx> {
                 }
             }
 
-            ast::ItemStatic(..) |
+            ast::ItemStatic(..) | ast::ItemConst(..) |
             ast::ItemFn(..) | ast::ItemMod(..) | ast::ItemTy(..) |
             ast::ItemMac(..) => {}
         }
diff --git a/src/librustc/middle/reachable.rs b/src/librustc/middle/reachable.rs
index 555a033a568d1..5d6f7048b82e1 100644
--- a/src/librustc/middle/reachable.rs
+++ b/src/librustc/middle/reachable.rs
@@ -27,7 +27,6 @@ use syntax::abi;
 use syntax::ast;
 use syntax::ast_map;
 use syntax::ast_util::{is_local, PostExpansionMethod};
-use syntax::ast_util;
 use syntax::attr::{InlineAlways, InlineHint, InlineNever, InlineNone};
 use syntax::attr;
 use syntax::visit::Visitor;
@@ -121,15 +120,14 @@ impl<'a, 'tcx, 'v> Visitor<'v> for ReachableContext<'a, 'tcx> {
                         self.worklist.push(def_id.node)
                     } else {
                         match def {
-                            // If this path leads to a static, then we may have
-                            // to do some work to figure out whether the static
-                            // is indeed reachable. (Inlineable statics are
-                            // never reachable.)
-                            def::DefStatic(..) => {
+                            // If this path leads to a constant, then we need to
+                            // recurse into the constant to continue finding
+                            // items that are reachable.
+                            def::DefConst(..) => {
                                 self.worklist.push(def_id.node);
                             }
 
-                            // If this wasn't a static, then this destination is
+                            // If this wasn't a static, then the destination is
                             // surely reachable.
                             _ => {
                                 self.reachable_symbols.insert(def_id.node);
@@ -238,15 +236,14 @@ impl<'a, 'tcx> ReachableContext<'a, 'tcx> {
     fn propagate(&mut self) {
         let mut scanned = HashSet::new();
         loop {
-            if self.worklist.len() == 0 {
-                break
-            }
-            let search_item = self.worklist.pop().unwrap();
-            if scanned.contains(&search_item) {
+            let search_item = match self.worklist.pop() {
+                Some(item) => item,
+                None => break,
+            };
+            if !scanned.insert(search_item) {
                 continue
             }
 
-            scanned.insert(search_item);
             match self.tcx.map.find(search_item) {
                 Some(ref item) => self.propagate_node(item, search_item),
                 None if search_item == ast::CRATE_NODE_ID => {}
@@ -297,21 +294,17 @@ impl<'a, 'tcx> ReachableContext<'a, 'tcx> {
                         }
                     }
 
-                    // Statics with insignificant addresses are not reachable
-                    // because they're inlined specially into all other crates.
-                    ast::ItemStatic(_, mutbl, ref init) => {
-                        if !ast_util::static_has_significant_address(
-                                mutbl,
-                                item.attrs.as_slice()) {
-                            self.reachable_symbols.remove(&search_item);
-                        }
-                        visit::walk_expr(self, &**init);
+                    // Reachable constants will be inlined into other crates
+                    // unconditionally, so we need to make sure that their
+                    // contents are also reachable.
+                    ast::ItemConst(_, ref init) => {
+                        self.visit_expr(&**init);
                     }
 
                     // These are normal, nothing reachable about these
                     // inherently and their children are already in the
                     // worklist, as determined by the privacy pass
-                    ast::ItemTy(..) |
+                    ast::ItemTy(..) | ast::ItemStatic(_, _, _) |
                     ast::ItemMod(..) | ast::ItemForeignMod(..) |
                     ast::ItemImpl(..) | ast::ItemTrait(..) |
                     ast::ItemStruct(..) | ast::ItemEnum(..) => {}
diff --git a/src/librustc/middle/resolve.rs b/src/librustc/middle/resolve.rs
index 595739585a398..318bc05d05f88 100644
--- a/src/librustc/middle/resolve.rs
+++ b/src/librustc/middle/resolve.rs
@@ -29,7 +29,7 @@ use syntax::ast::{ExprPath, ExprProc, ExprStruct, ExprUnboxedFn, FnDecl};
 use syntax::ast::{ForeignItem, ForeignItemFn, ForeignItemStatic, Generics};
 use syntax::ast::{Ident, ImplItem, Item, ItemEnum, ItemFn, ItemForeignMod};
 use syntax::ast::{ItemImpl, ItemMac, ItemMod, ItemStatic, ItemStruct};
-use syntax::ast::{ItemTrait, ItemTy, LOCAL_CRATE, Local};
+use syntax::ast::{ItemTrait, ItemTy, LOCAL_CRATE, Local, ItemConst};
 use syntax::ast::{MethodImplItem, Mod, Name, NamedField, NodeId};
 use syntax::ast::{Pat, PatEnum, PatIdent, PatLit};
 use syntax::ast::{PatRange, PatStruct, Path, PathListIdent, PathListMod};
@@ -1243,6 +1243,12 @@ impl<'a> Resolver<'a> {
                     (DefStatic(local_def(item.id), mutbl), sp, is_public);
                 parent
             }
+            ItemConst(_, _) => {
+                self.add_child(ident, parent.clone(), ForbidDuplicateValues, sp)
+                    .define_value(DefConst(local_def(item.id)),
+                                  sp, is_public);
+                parent
+            }
             ItemFn(_, fn_style, _, _, _) => {
                 let name_bindings =
                     self.add_child(ident, parent.clone(), ForbidDuplicateValues, sp);
@@ -1829,7 +1835,7 @@ impl<'a> Resolver<'a> {
                 csearch::get_tuple_struct_definition_if_ctor(&self.session.cstore, ctor_id)
                     .map_or(def, |_| DefStruct(ctor_id)), DUMMY_SP, is_public);
           }
-          DefFn(..) | DefStaticMethod(..) | DefStatic(..) => {
+          DefFn(..) | DefStaticMethod(..) | DefStatic(..) | DefConst(..) => {
             debug!("(building reduced graph for external \
                     crate) building value (fn/static) {}", final_ident);
             child_name_bindings.define_value(def, DUMMY_SP, is_public);
@@ -4216,7 +4222,7 @@ impl<'a> Resolver<'a> {
                                       &**block);
             }
 
-            ItemStatic(..) => {
+            ItemConst(..) | ItemStatic(..) => {
                 self.with_constant_rib(|this| {
                     visit::walk_item(this, item);
                 });
@@ -5084,6 +5090,7 @@ impl<'a> Resolver<'a> {
                         Some(def @ (DefFn(..), _))      |
                         Some(def @ (DefVariant(..), _)) |
                         Some(def @ (DefStruct(..), _))  |
+                        Some(def @ (DefConst(..), _))  |
                         Some(def @ (DefStatic(..), _)) => {
                             self.record_def(pattern.id, def);
                         }
@@ -5171,12 +5178,14 @@ impl<'a> Resolver<'a> {
                             def @ DefVariant(..) | def @ DefStruct(..) => {
                                 return FoundStructOrEnumVariant(def, LastMod(AllPublic));
                             }
-                            def @ DefStatic(_, false) => {
+                            def @ DefConst(..) => {
                                 return FoundConst(def, LastMod(AllPublic));
                             }
-                            DefStatic(_, true) => {
+                            DefStatic(..) => {
                                 self.resolve_error(span,
-                                    "mutable static variables cannot be referenced in a pattern");
+                                                   "static variables cannot be \
+                                                    referenced in a pattern, \
+                                                    use a `const` instead");
                                 return BareIdentifierPatternUnresolved;
                             }
                             _ => {
diff --git a/src/librustc/middle/resolve_lifetime.rs b/src/librustc/middle/resolve_lifetime.rs
index 42ae877122490..6d84b8cb49dd2 100644
--- a/src/librustc/middle/resolve_lifetime.rs
+++ b/src/librustc/middle/resolve_lifetime.rs
@@ -92,7 +92,7 @@ impl<'a, 'v> Visitor<'v> for LifetimeContext<'a> {
             ast::ItemMod(..) |
             ast::ItemMac(..) |
             ast::ItemForeignMod(..) |
-            ast::ItemStatic(..) => {
+            ast::ItemStatic(..) | ast::ItemConst(..) => {
                 self.with(|_, f| f(RootScope), |v| visit::walk_item(v, item));
                 return;
             }
diff --git a/src/librustc/middle/save/mod.rs b/src/librustc/middle/save/mod.rs
index debcfe3933c03..4aba29d7bae16 100644
--- a/src/librustc/middle/save/mod.rs
+++ b/src/librustc/middle/save/mod.rs
@@ -230,6 +230,7 @@ impl <'l, 'tcx> DxrVisitor<'l, 'tcx> {
             def::DefAssociatedTy(..) |
             def::DefTrait(_) => Some(recorder::TypeRef),
             def::DefStatic(_, _) |
+            def::DefConst(_) |
             def::DefLocal(_) |
             def::DefVariant(_, _, _) |
             def::DefUpvar(..) => Some(recorder::VarRef),
@@ -521,6 +522,29 @@ impl <'l, 'tcx> DxrVisitor<'l, 'tcx> {
         self.visit_expr(expr);
     }
 
+    fn process_const(&mut self,
+                      item: &ast::Item,
+                      typ: &ast::Ty,
+                      expr: &ast::Expr)
+    {
+        let qualname = self.analysis.ty_cx.map.path_to_string(item.id);
+
+        let sub_span = self.span.sub_span_after_keyword(item.span,
+                                                        keywords::Const);
+        self.fmt.static_str(item.span,
+                            sub_span,
+                            item.id,
+                            get_ident(item.ident).get(),
+                            qualname.as_slice(),
+                            "",
+                            ty_to_string(&*typ).as_slice(),
+                            self.cur_scope);
+
+        // walk type and init value
+        self.visit_ty(&*typ);
+        self.visit_expr(expr);
+    }
+
     fn process_struct(&mut self,
                       item: &ast::Item,
                       def: &ast::StructDef,
@@ -740,6 +764,7 @@ impl <'l, 'tcx> DxrVisitor<'l, 'tcx> {
             def::DefUpvar(..) |
             def::DefLocal(..) |
             def::DefStatic(..) |
+            def::DefConst(..) |
             def::DefVariant(..) => self.fmt.ref_str(recorder::VarRef,
                                                     ex.span,
                                                     sub_span,
@@ -807,6 +832,7 @@ impl <'l, 'tcx> DxrVisitor<'l, 'tcx> {
             },
             def::DefLocal(_) |
             def::DefStatic(_,_) |
+            def::DefConst(..) |
             def::DefStruct(_) |
             def::DefFn(..) => self.write_sub_paths_truncated(path),
             _ => {},
@@ -1008,6 +1034,8 @@ impl<'l, 'tcx, 'v> Visitor<'v> for DxrVisitor<'l, 'tcx> {
                 self.process_fn(item, &**decl, ty_params, &**body),
             ast::ItemStatic(ref typ, mt, ref expr) =>
                 self.process_static(item, &**typ, mt, &**expr),
+            ast::ItemConst(ref typ, ref expr) =>
+                self.process_const(item, &**typ, &**expr),
             ast::ItemStruct(ref def, ref ty_params) => self.process_struct(item, &**def, ty_params),
             ast::ItemEnum(ref def, ref ty_params) => self.process_enum(item, def, ty_params),
             ast::ItemImpl(ref ty_params,
@@ -1386,6 +1414,7 @@ impl<'l, 'tcx, 'v> Visitor<'v> for DxrVisitor<'l, 'tcx> {
                                                             self.cur_scope),
                 // FIXME(nrc) what is this doing here?
                 def::DefStatic(_, _) => {}
+                def::DefConst(..) => {}
                 _ => error!("unexpected definition kind when processing collected paths: {:?}",
                             *def)
             }
diff --git a/src/librustc/middle/traexpr b/src/librustc/middle/traexpr
new file mode 100644
index 0000000000000..e69de29bb2d1d
diff --git a/src/librustc/middle/trans/_match.rs b/src/librustc/middle/trans/_match.rs
index 38f09d1957252..9eb02717f04a1 100644
--- a/src/librustc/middle/trans/_match.rs
+++ b/src/librustc/middle/trans/_match.rs
@@ -271,14 +271,14 @@ impl<'a> Opt<'a> {
         match *self {
             ConstantValue(ConstantExpr(lit_expr)) => {
                 let lit_ty = ty::node_id_to_type(bcx.tcx(), lit_expr.id);
-                let (llval, _, _) = consts::const_expr(ccx, &*lit_expr, true);
+                let (llval, _) = consts::const_expr(ccx, &*lit_expr);
                 let lit_datum = immediate_rvalue(llval, lit_ty);
                 let lit_datum = unpack_datum!(bcx, lit_datum.to_appropriate_datum(bcx));
                 SingleResult(Result::new(bcx, lit_datum.val))
             }
             ConstantRange(ConstantExpr(ref l1), ConstantExpr(ref l2)) => {
-                let (l1, _, _) = consts::const_expr(ccx, &**l1, true);
-                let (l2, _, _) = consts::const_expr(ccx, &**l2, true);
+                let (l1, _) = consts::const_expr(ccx, &**l1);
+                let (l2, _) = consts::const_expr(ccx, &**l2);
                 RangeResult(Result::new(bcx, l1), Result::new(bcx, l2))
             }
             Variant(disr_val, ref repr, _) => {
@@ -350,7 +350,20 @@ struct ArmData<'p, 'blk, 'tcx: 'blk> {
 struct Match<'a, 'p: 'a, 'blk: 'a, 'tcx: 'blk> {
     pats: Vec<&'p ast::Pat>,
     data: &'a ArmData<'p, 'blk, 'tcx>,
-    bound_ptrs: Vec<(Ident, ValueRef)>
+    bound_ptrs: Vec<(Ident, ValueRef)>,
+
+    // This is a pointer to an instance of check_match::DUMMY_WILD_PAT. The
+    // check_match code requires that we pass this in (with the same lifetime as
+    // the patterns passed in). Unfortunately this is required to be propagated
+    // into this structure in order to get the lifetimes to work.
+    //
+    // Lots of the `check_match` code will deal with &DUMMY_WILD_PAT when
+    // returning references, which used to have the `'static` lifetime before
+    // const was added to the language. The DUMMY_WILD_PAT does not implement
+    // Sync, however, so it must be a const, which longer has a static lifetime,
+    // hence we're passing it in here. This certainly isn't crucial, and if it
+    // can be removed, please do!
+    dummy: &'p ast::Pat,
 }
 
 impl<'a, 'p, 'blk, 'tcx> Repr for Match<'a, 'p, 'blk, 'tcx> {
@@ -403,21 +416,22 @@ fn expand_nested_bindings<'a, 'p, 'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
         *pats.get_mut(col) = pat;
         Match {
             pats: pats,
+            dummy: br.dummy,
             data: &*br.data,
             bound_ptrs: bound_ptrs
         }
     }).collect()
 }
 
-type EnterPatterns<'a> = <'p> |&[&'p ast::Pat]|: 'a -> Option<Vec<&'p ast::Pat>>;
+type EnterPatterns<'a, 'p> = |&[&'p ast::Pat]|: 'a -> Option<Vec<&'p ast::Pat>>;
 
-fn enter_match<'a, 'p, 'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
-                                   dm: &DefMap,
-                                   m: &[Match<'a, 'p, 'blk, 'tcx>],
-                                   col: uint,
-                                   val: ValueRef,
-                                   e: EnterPatterns)
-                                   -> Vec<Match<'a, 'p, 'blk, 'tcx>> {
+fn enter_match<'a, 'b, 'p, 'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
+                                       dm: &DefMap,
+                                       m: &[Match<'a, 'p, 'blk, 'tcx>],
+                                       col: uint,
+                                       val: ValueRef,
+                                       e: EnterPatterns<'b, 'p>)
+                                       -> Vec<Match<'a, 'p, 'blk, 'tcx>> {
     debug!("enter_match(bcx={}, m={}, col={}, val={})",
            bcx.to_str(),
            m.repr(bcx.tcx()),
@@ -450,6 +464,7 @@ fn enter_match<'a, 'p, 'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
             }
             Match {
                 pats: pats,
+                dummy: br.dummy,
                 data: br.data,
                 bound_ptrs: bound_ptrs
             }
@@ -544,7 +559,8 @@ fn enter_opt<'a, 'p, 'blk, 'tcx>(
 
     let mcx = check_match::MatchCheckCtxt { tcx: bcx.tcx() };
     enter_match(bcx, dm, m, col, val, |pats|
-        check_match::specialize(&mcx, pats.as_slice(), &ctor, col, variant_size)
+        check_match::specialize(&mcx, pats.as_slice(), m[0].dummy, &ctor, col,
+                                variant_size)
     )
 }
 
@@ -1025,7 +1041,9 @@ fn compile_submatch_continue<'a, 'p, 'blk, 'tcx>(mut bcx: Block<'blk, 'tcx>,
     match adt_vals {
         Some(field_vals) => {
             let pats = enter_match(bcx, dm, m, col, val, |pats|
-                check_match::specialize(&mcx, pats, &check_match::Single, col, field_vals.len())
+                check_match::specialize(&mcx, pats, m[0].dummy,
+                                        &check_match::Single, col,
+                                        field_vals.len())
             );
             let vals = field_vals.append(vals_left.as_slice());
             compile_submatch(bcx, pats.as_slice(), vals.as_slice(), chk, has_genuine_default);
@@ -1347,6 +1365,7 @@ fn trans_match_inner<'blk, 'tcx>(scope_cx: Block<'blk, 'tcx>,
         bindings_map: create_bindings_map(bcx, &**arm.pats.get(0), discr_expr, &*arm.body)
     }).collect();
 
+    let dummy = check_match::DUMMY_WILD_PAT.clone();
     let mut static_inliner = StaticInliner::new(scope_cx.tcx());
     let arm_pats: Vec<Vec<P<ast::Pat>>> = arm_datas.iter().map(|arm_data| {
         arm_data.arm.pats.iter().map(|p| static_inliner.fold_pat((*p).clone())).collect()
@@ -1355,6 +1374,7 @@ fn trans_match_inner<'blk, 'tcx>(scope_cx: Block<'blk, 'tcx>,
     for (arm_data, pats) in arm_datas.iter().zip(arm_pats.iter()) {
         matches.extend(pats.iter().map(|p| Match {
             pats: vec![&**p],
+            dummy: &dummy,
             data: arm_data,
             bound_ptrs: Vec::new(),
         }));
diff --git a/src/librustc/middle/trans/base.rs b/src/librustc/middle/trans/base.rs
index d175919fb8108..8df5b375a8167 100644
--- a/src/librustc/middle/trans/base.rs
+++ b/src/librustc/middle/trans/base.rs
@@ -32,7 +32,7 @@ use driver::config::{NoDebugInfo, FullDebugInfo};
 use driver::driver::{CrateAnalysis, CrateTranslation, ModuleTranslation};
 use driver::session::Session;
 use lint;
-use llvm::{BasicBlockRef, ModuleRef, ValueRef, Vector, get_param};
+use llvm::{BasicBlockRef, ValueRef, Vector, get_param};
 use llvm;
 use metadata::{csearch, encoder, loader};
 use middle::astencode;
@@ -89,7 +89,7 @@ use std::rc::Rc;
 use std::{i8, i16, i32, i64};
 use syntax::abi::{X86, X86_64, Arm, Mips, Mipsel, Rust, RustCall};
 use syntax::abi::{RustIntrinsic, Abi, OsWindows};
-use syntax::ast_util::{local_def, is_local};
+use syntax::ast_util::local_def;
 use syntax::attr::AttrMetaMethods;
 use syntax::attr;
 use syntax::codemap::Span;
@@ -317,17 +317,31 @@ pub fn decl_internal_rust_fn(ccx: &CrateContext, fn_ty: ty::t, name: &str) -> Va
     llfn
 }
 
-pub fn get_extern_const(externs: &mut ExternMap, llmod: ModuleRef,
-                        name: &str, ty: Type) -> ValueRef {
-    match externs.find_equiv(&name) {
+pub fn get_extern_const(ccx: &CrateContext, did: ast::DefId,
+                        t: ty::t) -> ValueRef {
+    let name = csearch::get_symbol(&ccx.sess().cstore, did);
+    let ty = type_of(ccx, t);
+    match ccx.externs().borrow_mut().find(&name) {
         Some(n) => return *n,
         None => ()
     }
     unsafe {
         let c = name.with_c_str(|buf| {
-            llvm::LLVMAddGlobal(llmod, ty.to_ref(), buf)
+            llvm::LLVMAddGlobal(ccx.llmod(), ty.to_ref(), buf)
         });
-        externs.insert(name.to_string(), c);
+        // Thread-local statics in some other crate need to *always* be linked
+        // against in a thread-local fashion, so we need to be sure to apply the
+        // thread-local attribute locally if it was present remotely. If we
+        // don't do this then linker errors can be generated where the linker
+        // complains that one object files has a thread local version of the
+        // symbol and another one doesn't.
+        ty::each_attr(ccx.tcx(), did, |attr| {
+            if attr.check_name("thread_local") {
+                llvm::set_thread_local(c, true);
+            }
+            true
+        });
+        ccx.externs().borrow_mut().insert(name.to_string(), c);
         return c;
     }
 }
@@ -935,11 +949,7 @@ pub fn trans_external_path(ccx: &CrateContext, did: ast::DefId, t: ty::t) -> Val
             get_extern_rust_fn(ccx, t, name.as_slice(), did)
         }
         _ => {
-            let llty = type_of(ccx, t);
-            get_extern_const(&mut *ccx.externs().borrow_mut(),
-                             ccx.llmod(),
-                             name.as_slice(),
-                             llty)
+            get_extern_const(ccx, did, t)
         }
     }
 }
@@ -2228,21 +2238,19 @@ pub fn trans_item(ccx: &CrateContext, item: &ast::Item) {
       ast::ItemEnum(ref enum_definition, _) => {
         enum_variant_size_lint(ccx, enum_definition, item.span, item.id);
       }
+      ast::ItemConst(_, ref expr) => {
+          // Recurse on the expression to catch items in blocks
+          let mut v = TransItemVisitor{ ccx: ccx };
+          v.visit_expr(&**expr);
+      }
       ast::ItemStatic(_, m, ref expr) => {
           // Recurse on the expression to catch items in blocks
           let mut v = TransItemVisitor{ ccx: ccx };
           v.visit_expr(&**expr);
 
-          let trans_everywhere = attr::requests_inline(item.attrs.as_slice());
-          for (ref ccx, is_origin) in ccx.maybe_iter(!from_external && trans_everywhere) {
-              consts::trans_const(ccx, m, item.id);
-
-              let g = get_item_val(ccx, item.id);
-              update_linkage(ccx,
-                             g,
-                             Some(item.id),
-                             if is_origin { OriginalTranslation } else { InlinedCopy });
-          }
+          consts::trans_static(ccx, m, item.id);
+          let g = get_item_val(ccx, item.id);
+          update_linkage(ccx, g, Some(item.id), OriginalTranslation);
 
           // Do static_assert checking. It can't really be done much earlier
           // because we need to get the value of the bool out of LLVM
@@ -2253,7 +2261,7 @@ pub fn trans_item(ccx: &CrateContext, item: &ast::Item) {
                                          static");
               }
 
-              let v = ccx.const_values().borrow().get_copy(&item.id);
+              let v = ccx.static_values().borrow().get_copy(&item.id);
               unsafe {
                   if !(llvm::LLVMConstIntGetZExtValue(v) != 0) {
                       ccx.sess().span_fatal(expr.span, "static assertion failed");
@@ -2667,23 +2675,21 @@ pub fn get_item_val(ccx: &CrateContext, id: ast::NodeId) -> ValueRef {
     let val = match item {
         ast_map::NodeItem(i) => {
             let ty = ty::node_id_to_type(ccx.tcx(), i.id);
-            let sym = exported_name(ccx, id, ty, i.attrs.as_slice());
+            let sym = || exported_name(ccx, id, ty, i.attrs.as_slice());
 
             let v = match i.node {
-                ast::ItemStatic(_, mutbl, ref expr) => {
+                ast::ItemStatic(_, _, ref expr) => {
                     // If this static came from an external crate, then
                     // we need to get the symbol from csearch instead of
                     // using the current crate's name/version
                     // information in the hash of the symbol
+                    let sym = sym();
                     debug!("making {}", sym);
-                    let is_local = !ccx.external_srcs().borrow().contains_key(&id);
 
                     // We need the translated value here, because for enums the
                     // LLVM type is not fully determined by the Rust type.
-                    let (v, inlineable, ty) = consts::const_expr(ccx, &**expr, is_local);
-                    ccx.const_values().borrow_mut().insert(id, v);
-                    let mut inlineable = inlineable;
-
+                    let (v, ty) = consts::const_expr(ccx, &**expr);
+                    ccx.static_values().borrow_mut().insert(id, v);
                     unsafe {
                         // boolean SSA values are i1, but they have to be stored in i8 slots,
                         // otherwise some LLVM optimization passes don't work as expected
@@ -2694,55 +2700,30 @@ pub fn get_item_val(ccx: &CrateContext, id: ast::NodeId) -> ValueRef {
                         };
                         if contains_null(sym.as_slice()) {
                             ccx.sess().fatal(
-                                format!("Illegal null byte in export_name value: `{}`",
-                                        sym).as_slice());
+                                format!("Illegal null byte in export_name \
+                                         value: `{}`", sym).as_slice());
                         }
                         let g = sym.as_slice().with_c_str(|buf| {
                             llvm::LLVMAddGlobal(ccx.llmod(), llty, buf)
                         });
 
-                        // Apply the `unnamed_addr` attribute if
-                        // requested
-                        if !ast_util::static_has_significant_address(
-                                mutbl,
-                                i.attrs.as_slice()) {
-                            llvm::SetUnnamedAddr(g, true);
-
-                            // This is a curious case where we must make
-                            // all of these statics inlineable. If a
-                            // global is not tagged as `#[inline(never)]`,
-                            // then LLVM won't coalesce globals unless they
-                            // have an internal linkage type. This means that
-                            // external crates cannot use this global.
-                            // This is a problem for things like inner
-                            // statics in generic functions, because the
-                            // function will be inlined into another
-                            // crate and then attempt to link to the
-                            // static in the original crate, only to
-                            // find that it's not there. On the other
-                            // side of inlining, the crates knows to
-                            // not declare this static as
-                            // available_externally (because it isn't)
-                            inlineable = true;
-                        }
-
                         if attr::contains_name(i.attrs.as_slice(),
                                                "thread_local") {
                             llvm::set_thread_local(g, true);
                         }
-
-                        if !inlineable {
-                            debug!("{} not inlined", sym);
-                            ccx.non_inlineable_statics().borrow_mut()
-                                                      .insert(id);
-                        }
-
                         ccx.item_symbols().borrow_mut().insert(i.id, sym);
                         g
                     }
                 }
 
+                ast::ItemConst(_, ref expr) => {
+                    let (v, _) = consts::const_expr(ccx, &**expr);
+                    ccx.const_values().borrow_mut().insert(id, v);
+                    v
+                }
+
                 ast::ItemFn(_, _, abi, _, _) => {
+                    let sym = sym();
                     let llfn = if abi == Rust {
                         register_fn(ccx, i.span, sym, i.id, ty)
                     } else {
@@ -2911,7 +2892,6 @@ pub fn crate_ctxt_to_encode_parms<'a, 'tcx>(cx: &'a SharedCrateContext<'tcx>,
         tcx: cx.tcx(),
         reexports2: cx.exp_map2(),
         item_symbols: cx.item_symbols(),
-        non_inlineable_statics: cx.non_inlineable_statics(),
         link_meta: cx.link_meta(),
         cstore: &cx.sess().cstore,
         encode_inlined_item: ie,
diff --git a/src/librustc/middle/trans/callee.rs b/src/librustc/middle/trans/callee.rs
index 7942a0211e4e6..bc562b39c98f7 100644
--- a/src/librustc/middle/trans/callee.rs
+++ b/src/librustc/middle/trans/callee.rs
@@ -196,6 +196,7 @@ fn trans<'blk, 'tcx>(bcx: Block<'blk, 'tcx>, expr: &ast::Expr)
                 }
             }
             def::DefStatic(..) |
+            def::DefConst(..) |
             def::DefLocal(..) |
             def::DefUpvar(..) => {
                 datum_callee(bcx, ref_expr)
diff --git a/src/librustc/middle/trans/cleanup.rs b/src/librustc/middle/trans/cleanup.rs
index 20fd0b0eb3d8f..392436d3a8069 100644
--- a/src/librustc/middle/trans/cleanup.rs
+++ b/src/librustc/middle/trans/cleanup.rs
@@ -49,9 +49,9 @@ pub struct CustomScopeIndex {
     index: uint
 }
 
-pub static EXIT_BREAK: uint = 0;
-pub static EXIT_LOOP: uint = 1;
-pub static EXIT_MAX: uint = 2;
+pub const EXIT_BREAK: uint = 0;
+pub const EXIT_LOOP: uint = 1;
+pub const EXIT_MAX: uint = 2;
 
 pub enum CleanupScopeKind<'blk, 'tcx: 'blk> {
     CustomScopeKind,
diff --git a/src/librustc/middle/trans/consts.rs b/src/librustc/middle/trans/consts.rs
index 5e4692bd0f617..ec357f7bfd7c6 100644
--- a/src/librustc/middle/trans/consts.rs
+++ b/src/librustc/middle/trans/consts.rs
@@ -33,7 +33,6 @@ use middle::ty;
 use util::ppaux::{Repr, ty_to_string};
 
 use std::c_str::ToCStr;
-use std::vec;
 use libc::c_uint;
 use syntax::{ast, ast_util};
 use syntax::ptr::P;
@@ -96,24 +95,20 @@ pub fn const_ptrcast(cx: &CrateContext, a: ValueRef, t: Type) -> ValueRef {
     }
 }
 
-// Helper function because we don't have tuple-swizzling.
-fn first_two<R, S, T>((a, b, _): (R, S, T)) -> (R, S) {
-    (a, b)
-}
-
 fn const_vec(cx: &CrateContext, e: &ast::Expr,
-             es: &[P<ast::Expr>], is_local: bool) -> (ValueRef, Type, bool) {
+             es: &[P<ast::Expr>]) -> (ValueRef, Type) {
     let vec_ty = ty::expr_ty(cx.tcx(), e);
     let unit_ty = ty::sequence_element_type(cx.tcx(), vec_ty);
     let llunitty = type_of::type_of(cx, unit_ty);
-    let (vs, inlineable) = vec::unzip(es.iter().map(|e| first_two(const_expr(cx, &**e, is_local))));
+    let vs = es.iter().map(|e| const_expr(cx, &**e).val0())
+                      .collect::<Vec<_>>();
     // If the vector contains enums, an LLVM array won't work.
     let v = if vs.iter().any(|vi| val_ty(*vi) != llunitty) {
         C_struct(cx, vs.as_slice(), false)
     } else {
         C_array(llunitty, vs.as_slice())
     };
-    (v, llunitty, inlineable.iter().fold(true, |a, &b| a && b))
+    (v, llunitty)
 }
 
 pub fn const_addr_of(cx: &CrateContext, cv: ValueRef, mutbl: ast::Mutability) -> ValueRef {
@@ -177,7 +172,7 @@ fn const_deref(cx: &CrateContext, v: ValueRef, t: ty::t, explicit: bool)
 }
 
 pub fn get_const_val(cx: &CrateContext,
-                     mut def_id: ast::DefId) -> (ValueRef, bool) {
+                     mut def_id: ast::DefId) -> ValueRef {
     let contains_key = cx.const_values().borrow().contains_key(&def_id.node);
     if !ast_util::is_local(def_id) || !contains_key {
         if !ast_util::is_local(def_id) {
@@ -185,21 +180,17 @@ pub fn get_const_val(cx: &CrateContext,
         }
 
         match cx.tcx().map.expect_item(def_id.node).node {
-            ast::ItemStatic(_, ast::MutImmutable, _) => {
-                trans_const(cx, ast::MutImmutable, def_id.node);
-            }
+            ast::ItemConst(..) => { base::get_item_val(cx, def_id.node); }
             _ => {}
         }
     }
 
-    (cx.const_values().borrow().get_copy(&def_id.node),
-     !cx.non_inlineable_statics().borrow().contains(&def_id.node))
+    cx.const_values().borrow().get_copy(&def_id.node)
 }
 
-pub fn const_expr(cx: &CrateContext, e: &ast::Expr, is_local: bool) -> (ValueRef, bool, ty::t) {
-    let (llconst, inlineable) = const_expr_unadjusted(cx, e, is_local);
+pub fn const_expr(cx: &CrateContext, e: &ast::Expr) -> (ValueRef, ty::t) {
+    let llconst = const_expr_unadjusted(cx, e);
     let mut llconst = llconst;
-    let mut inlineable = inlineable;
     let ety = ty::expr_ty(cx.tcx(), e);
     let mut ety_adjusted = ty::expr_ty_adjusted(cx.tcx(), e);
     let opt_adj = cx.tcx().adjustments.borrow().find_copy(&e.id);
@@ -213,7 +204,7 @@ pub fn const_expr(cx: &CrateContext, e: &ast::Expr, is_local: bool) -> (ValueRef
                                                                    ety_adjusted,
                                                                    def,
                                                                    llconst,
-                                                                   is_local);
+                                                                   true);
                     llconst = C_struct(cx, [wrapper, C_null(Type::i8p(cx))], false)
                 }
                 ty::AdjustAddEnv(store) => {
@@ -250,7 +241,6 @@ pub fn const_expr(cx: &CrateContext, e: &ast::Expr, is_local: bool) -> (ValueRef
                                     // Don't copy data to do a deref+ref
                                     // (i.e., skip the last auto-deref).
                                     if adj.autoderefs == 0 {
-                                        inlineable = false;
                                         llconst = const_addr_of(cx, llconst, ast::MutImmutable);
                                     }
                                 }
@@ -271,7 +261,6 @@ pub fn const_expr(cx: &CrateContext, e: &ast::Expr, is_local: bool) -> (ValueRef
 
                                     match ty::get(ty).sty {
                                         ty::ty_vec(unit_ty, Some(len)) => {
-                                            inlineable = false;
                                             let llunitty = type_of::type_of(cx, unit_ty);
                                             let llptr = const_ptrcast(cx, llconst, llunitty);
                                             assert_eq!(abi::slice_elt_base, 0);
@@ -314,29 +303,25 @@ pub fn const_expr(cx: &CrateContext, e: &ast::Expr, is_local: bool) -> (ValueRef
                          e.repr(cx.tcx()), ty_to_string(cx.tcx(), ety),
                          csize, tsize).as_slice());
     }
-    (llconst, inlineable, ety_adjusted)
+    (llconst, ety_adjusted)
 }
 
 // the bool returned is whether this expression can be inlined into other crates
 // if it's assigned to a static.
-fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
-                         is_local: bool) -> (ValueRef, bool) {
+fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr) -> ValueRef {
     let map_list = |exprs: &[P<ast::Expr>]| {
-        exprs.iter().map(|e| first_two(const_expr(cx, &**e, is_local)))
-             .fold((Vec::new(), true),
-                   |(l, all_inlineable), (val, inlineable)| {
-                (l.append_one(val), all_inlineable && inlineable)
-             })
+        exprs.iter().map(|e| const_expr(cx, &**e).val0())
+             .fold(Vec::new(), |l, val| l.append_one(val))
     };
     unsafe {
         let _icx = push_ctxt("const_expr");
         return match e.node {
           ast::ExprLit(ref lit) => {
-              (consts::const_lit(cx, e, &**lit), true)
+              consts::const_lit(cx, e, &**lit)
           }
           ast::ExprBinary(b, ref e1, ref e2) => {
-            let (te1, _, _) = const_expr(cx, &**e1, is_local);
-            let (te2, _, _) = const_expr(cx, &**e2, is_local);
+            let (te1, _) = const_expr(cx, &**e1);
+            let (te2, _) = const_expr(cx, &**e2);
 
             let te2 = base::cast_shift_const_rhs(b, te1, te2);
 
@@ -345,7 +330,7 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
             let ty = ty::expr_ty(cx.tcx(), &**e1);
             let is_float = ty::type_is_fp(ty);
             let signed = ty::type_is_signed(ty);
-            return (match b {
+            return match b {
               ast::BiAdd   => {
                 if is_float { llvm::LLVMConstFAdd(te1, te2) }
                 else        { llvm::LLVMConstAdd(te1, te2) }
@@ -414,13 +399,13 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                       else      { ConstICmp(IntUGT, te1, te2) }
                   }
               },
-            }, true)
+            }
           },
           ast::ExprUnary(u, ref e) => {
-            let (te, _, _) = const_expr(cx, &**e, is_local);
+            let (te, _) = const_expr(cx, &**e);
             let ty = ty::expr_ty(cx.tcx(), &**e);
             let is_float = ty::type_is_fp(ty);
-            return (match u {
+            return match u {
               ast::UnUniq | ast::UnDeref => {
                 let (dv, _dt) = const_deref(cx, te, ty, true);
                 dv
@@ -430,26 +415,26 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                 if is_float { llvm::LLVMConstFNeg(te) }
                 else        { llvm::LLVMConstNeg(te) }
               }
-            }, true)
+            }
           }
           ast::ExprField(ref base, field, _) => {
-              let (bv, inlineable, bt) = const_expr(cx, &**base, is_local);
+              let (bv, bt) = const_expr(cx, &**base);
               let brepr = adt::represent_type(cx, bt);
               expr::with_field_tys(cx.tcx(), bt, None, |discr, field_tys| {
                   let ix = ty::field_idx_strict(cx.tcx(), field.node.name, field_tys);
-                  (adt::const_get_field(cx, &*brepr, bv, discr, ix), inlineable)
+                  adt::const_get_field(cx, &*brepr, bv, discr, ix)
               })
           }
           ast::ExprTupField(ref base, idx, _) => {
-              let (bv, inlineable, bt) = const_expr(cx, &**base, is_local);
+              let (bv, bt) = const_expr(cx, &**base);
               let brepr = adt::represent_type(cx, bt);
               expr::with_field_tys(cx.tcx(), bt, None, |discr, _| {
-                  (adt::const_get_field(cx, &*brepr, bv, discr, idx.node), inlineable)
+                  adt::const_get_field(cx, &*brepr, bv, discr, idx.node)
               })
           }
 
           ast::ExprIndex(ref base, ref index) => {
-              let (bv, inlineable, bt) = const_expr(cx, &**base, is_local);
+              let (bv, bt) = const_expr(cx, &**base);
               let iv = match const_eval::eval_const_expr(cx.tcx(), &**index) {
                   const_eval::const_int(i) => i as u64,
                   const_eval::const_uint(u) => u,
@@ -500,13 +485,13 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                   cx.sess().span_err(e.span,
                                      "const index-expr is out of bounds");
               }
-              (const_get_elt(cx, arr, [iv as c_uint]), inlineable)
+              const_get_elt(cx, arr, [iv as c_uint])
           }
           ast::ExprCast(ref base, _) => {
             let ety = ty::expr_ty(cx.tcx(), e);
             let llty = type_of::type_of(cx, ety);
-            let (v, inlineable, basety) = const_expr(cx, &**base, is_local);
-            return (match (expr::cast_type_kind(cx.tcx(), basety),
+            let (v, basety) = const_expr(cx, &**base);
+            return match (expr::cast_type_kind(cx.tcx(), basety),
                            expr::cast_type_kind(cx.tcx(), ety)) {
 
               (expr::cast_integral, expr::cast_integral) => {
@@ -554,17 +539,38 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                 cx.sess().impossible_case(e.span,
                                           "bad combination of types for cast")
               }
-            }, inlineable)
+            }
           }
           ast::ExprAddrOf(mutbl, ref sub) => {
-              let (e, _, _) = const_expr(cx, &**sub, is_local);
-              (const_addr_of(cx, e, mutbl), false)
+              // If this is the address of some static, then we need to return
+              // the actual address of the static itself (short circuit the rest
+              // of const eval).
+              let mut cur = sub;
+              loop {
+                  match cur.node {
+                      ast::ExprParen(ref sub) => cur = sub,
+                      _ => break,
+                  }
+              }
+              let opt_def = cx.tcx().def_map.borrow().find_copy(&cur.id);
+              match opt_def {
+                  Some(def::DefStatic(def_id, _)) => {
+                      let ty = ty::expr_ty(cx.tcx(), e);
+                      return get_static_val(cx, def_id, ty);
+                  }
+                  _ => {}
+              }
+
+              // If this isn't the address of a static, then keep going through
+              // normal constant evaluation.
+              let (e, _) = const_expr(cx, &**sub);
+              const_addr_of(cx, e, mutbl)
           }
           ast::ExprTup(ref es) => {
               let ety = ty::expr_ty(cx.tcx(), e);
               let repr = adt::represent_type(cx, ety);
-              let (vals, inlineable) = map_list(es.as_slice());
-              (adt::trans_const(cx, &*repr, 0, vals.as_slice()), inlineable)
+              let vals = map_list(es.as_slice());
+              adt::trans_const(cx, &*repr, 0, vals.as_slice())
           }
           ast::ExprStruct(_, ref fs, ref base_opt) => {
               let ety = ty::expr_ty(cx.tcx(), e);
@@ -572,36 +578,34 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
               let tcx = cx.tcx();
 
               let base_val = match *base_opt {
-                Some(ref base) => Some(const_expr(cx, &**base, is_local)),
+                Some(ref base) => Some(const_expr(cx, &**base)),
                 None => None
               };
 
               expr::with_field_tys(tcx, ety, Some(e.id), |discr, field_tys| {
-                  let (cs, inlineable) = vec::unzip(field_tys.iter().enumerate()
-                      .map(|(ix, &field_ty)| {
+                  let cs = field_tys.iter().enumerate()
+                                    .map(|(ix, &field_ty)| {
                       match fs.iter().find(|f| field_ty.ident.name == f.ident.node.name) {
-                          Some(ref f) => first_two(const_expr(cx, &*f.expr, is_local)),
+                          Some(ref f) => const_expr(cx, &*f.expr).val0(),
                           None => {
                               match base_val {
-                                Some((bv, inlineable, _)) => {
-                                    (adt::const_get_field(cx, &*repr, bv, discr, ix),
-                                     inlineable)
-                                }
-                                None => cx.sess().span_bug(e.span, "missing struct field")
+                                  Some((bv, _)) => {
+                                      adt::const_get_field(cx, &*repr, bv,
+                                                           discr, ix)
+                                  }
+                                  None => {
+                                      cx.sess().span_bug(e.span,
+                                                         "missing struct field")
+                                  }
                               }
                           }
                       }
-                  }));
-                  (adt::trans_const(cx, &*repr, discr, cs.as_slice()),
-                   inlineable.iter().fold(true, |a, &b| a && b))
+                  }).collect::<Vec<_>>();
+                  adt::trans_const(cx, &*repr, discr, cs.as_slice())
               })
           }
           ast::ExprVec(ref es) => {
-            let (v, _, inlineable) = const_vec(cx,
-                                               e,
-                                               es.as_slice(),
-                                               is_local);
-            (v, inlineable)
+            const_vec(cx, e, es.as_slice()).val0()
           }
           ast::ExprRepeat(ref elem, ref count) => {
             let vec_ty = ty::expr_ty(cx.tcx(), e);
@@ -612,13 +616,12 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                 const_eval::const_uint(i) => i as uint,
                 _ => cx.sess().span_bug(count.span, "count must be integral const expression.")
             };
-            let vs = Vec::from_elem(n, const_expr(cx, &**elem, is_local).val0());
-            let v = if vs.iter().any(|vi| val_ty(*vi) != llunitty) {
+            let vs = Vec::from_elem(n, const_expr(cx, &**elem).val0());
+            if vs.iter().any(|vi| val_ty(*vi) != llunitty) {
                 C_struct(cx, vs.as_slice(), false)
             } else {
                 C_array(llunitty, vs.as_slice())
-            };
-            (v, true)
+            }
           }
           ast::ExprPath(ref pth) => {
             // Assert that there are no type parameters in this path.
@@ -629,13 +632,13 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                 Some(def::DefFn(def_id, _fn_style, _)) => {
                     if !ast_util::is_local(def_id) {
                         let ty = csearch::get_type(cx.tcx(), def_id).ty;
-                        (base::trans_external_path(cx, def_id, ty), true)
+                        base::trans_external_path(cx, def_id, ty)
                     } else {
                         assert!(ast_util::is_local(def_id));
-                        (base::get_item_val(cx, def_id.node), true)
+                        base::get_item_val(cx, def_id.node)
                     }
                 }
-                Some(def::DefStatic(def_id, false)) => {
+                Some(def::DefConst(def_id)) => {
                     get_const_val(cx, def_id)
                 }
                 Some(def::DefVariant(enum_did, variant_did, _)) => {
@@ -644,15 +647,16 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                     let vinfo = ty::enum_variant_with_id(cx.tcx(),
                                                          enum_did,
                                                          variant_did);
-                    (adt::trans_const(cx, &*repr, vinfo.disr_val, []), true)
+                    adt::trans_const(cx, &*repr, vinfo.disr_val, [])
                 }
                 Some(def::DefStruct(_)) => {
                     let ety = ty::expr_ty(cx.tcx(), e);
                     let llty = type_of::type_of(cx, ety);
-                    (C_null(llty), true)
+                    C_null(llty)
                 }
                 _ => {
-                    cx.sess().span_bug(e.span, "expected a const, fn, struct, or variant def")
+                    cx.sess().span_bug(e.span, "expected a const, fn, struct, \
+                                                or variant def")
                 }
             }
           }
@@ -662,9 +666,8 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                   Some(def::DefStruct(_)) => {
                       let ety = ty::expr_ty(cx.tcx(), e);
                       let repr = adt::represent_type(cx, ety);
-                      let (arg_vals, inlineable) = map_list(args.as_slice());
-                      (adt::trans_const(cx, &*repr, 0, arg_vals.as_slice()),
-                       inlineable)
+                      let arg_vals = map_list(args.as_slice());
+                      adt::trans_const(cx, &*repr, 0, arg_vals.as_slice())
                   }
                   Some(def::DefVariant(enum_did, variant_did, _)) => {
                       let ety = ty::expr_ty(cx.tcx(), e);
@@ -672,20 +675,20 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
                       let vinfo = ty::enum_variant_with_id(cx.tcx(),
                                                            enum_did,
                                                            variant_did);
-                      let (arg_vals, inlineable) = map_list(args.as_slice());
-                      (adt::trans_const(cx,
-                                        &*repr,
-                                        vinfo.disr_val,
-                                        arg_vals.as_slice()), inlineable)
+                      let arg_vals = map_list(args.as_slice());
+                      adt::trans_const(cx,
+                                       &*repr,
+                                       vinfo.disr_val,
+                                       arg_vals.as_slice())
                   }
                   _ => cx.sess().span_bug(e.span, "expected a struct or variant def")
               }
           }
-          ast::ExprParen(ref e) => first_two(const_expr(cx, &**e, is_local)),
+          ast::ExprParen(ref e) => const_expr(cx, &**e).val0(),
           ast::ExprBlock(ref block) => {
             match block.expr {
-                Some(ref expr) => first_two(const_expr(cx, &**expr, is_local)),
-                None => (C_nil(cx), true)
+                Some(ref expr) => const_expr(cx, &**expr).val0(),
+                None => C_nil(cx)
             }
           }
           _ => cx.sess().span_bug(e.span,
@@ -694,13 +697,13 @@ fn const_expr_unadjusted(cx: &CrateContext, e: &ast::Expr,
     }
 }
 
-pub fn trans_const(ccx: &CrateContext, m: ast::Mutability, id: ast::NodeId) {
+pub fn trans_static(ccx: &CrateContext, m: ast::Mutability, id: ast::NodeId) {
     unsafe {
-        let _icx = push_ctxt("trans_const");
+        let _icx = push_ctxt("trans_static");
         let g = base::get_item_val(ccx, id);
         // At this point, get_item_val has already translated the
         // constant's initializer to determine its LLVM type.
-        let v = ccx.const_values().borrow().get_copy(&id);
+        let v = ccx.static_values().borrow().get_copy(&id);
         // boolean SSA values are i1, but they have to be stored in i8 slots,
         // otherwise some LLVM optimization passes don't work as expected
         let v = if llvm::LLVMTypeOf(v) == Type::i1(ccx).to_ref() {
@@ -710,17 +713,20 @@ pub fn trans_const(ccx: &CrateContext, m: ast::Mutability, id: ast::NodeId) {
         };
         llvm::LLVMSetInitializer(g, v);
 
-        // `get_item_val` left `g` with external linkage, but we just set an
-        // initializer for it.  But we don't know yet if `g` should really be
-        // defined in this compilation unit, so we set its linkage to
-        // `AvailableExternallyLinkage`.  (It's still a definition, but acts
-        // like a declaration for most purposes.)  If `g` really should be
-        // declared here, then `trans_item` will fix up the linkage later on.
-        llvm::SetLinkage(g, llvm::AvailableExternallyLinkage);
-
+        // As an optimization, all shared statics which do not have interior
+        // mutability are placed into read-only memory.
         if m != ast::MutMutable {
-            llvm::LLVMSetGlobalConstant(g, True);
+            let node_ty = ty::node_id_to_type(ccx.tcx(), id);
+            let tcontents = ty::type_contents(ccx.tcx(), node_ty);
+            if !tcontents.interior_unsafe() {
+                llvm::LLVMSetGlobalConstant(g, True);
+            }
         }
         debuginfo::create_global_var_metadata(ccx, id, g);
     }
 }
+
+fn get_static_val(ccx: &CrateContext, did: ast::DefId, ty: ty::t) -> ValueRef {
+    if ast_util::is_local(did) { return base::get_item_val(ccx, did.node) }
+    base::trans_external_path(ccx, did, ty)
+}
diff --git a/src/librustc/middle/trans/context.rs b/src/librustc/middle/trans/context.rs
index 5c8c6a24b4fa5..ee5ba61a295cf 100644
--- a/src/librustc/middle/trans/context.rs
+++ b/src/librustc/middle/trans/context.rs
@@ -66,10 +66,6 @@ pub struct SharedCrateContext<'tcx> {
     reachable: NodeSet,
     item_symbols: RefCell<NodeMap<String>>,
     link_meta: LinkMeta,
-    /// A set of static items which cannot be inlined into other crates. This
-    /// will prevent in IIItem() structures from being encoded into the metadata
-    /// that is generated
-    non_inlineable_statics: RefCell<NodeSet>,
     symbol_hasher: RefCell<Sha256>,
     tcx: ty::ctxt<'tcx>,
     stats: Stats,
@@ -121,6 +117,9 @@ pub struct LocalCrateContext {
     /// Cache of emitted const values
     const_values: RefCell<NodeMap<ValueRef>>,
 
+    /// Cache of emitted static values
+    static_values: RefCell<NodeMap<ValueRef>>,
+
     /// Cache of external const values
     extern_const_values: RefCell<DefIdMap<ValueRef>>,
 
@@ -259,7 +258,6 @@ impl<'tcx> SharedCrateContext<'tcx> {
             reachable: reachable,
             item_symbols: RefCell::new(NodeMap::new()),
             link_meta: link_meta,
-            non_inlineable_statics: RefCell::new(NodeSet::new()),
             symbol_hasher: RefCell::new(symbol_hasher),
             tcx: tcx,
             stats: Stats {
@@ -351,10 +349,6 @@ impl<'tcx> SharedCrateContext<'tcx> {
         &self.link_meta
     }
 
-    pub fn non_inlineable_statics<'a>(&'a self) -> &'a RefCell<NodeSet> {
-        &self.non_inlineable_statics
-    }
-
     pub fn symbol_hasher<'a>(&'a self) -> &'a RefCell<Sha256> {
         &self.symbol_hasher
     }
@@ -414,6 +408,7 @@ impl LocalCrateContext {
                 const_cstr_cache: RefCell::new(HashMap::new()),
                 const_globals: RefCell::new(HashMap::new()),
                 const_values: RefCell::new(NodeMap::new()),
+                static_values: RefCell::new(NodeMap::new()),
                 extern_const_values: RefCell::new(DefIdMap::new()),
                 impl_method_cache: RefCell::new(HashMap::new()),
                 closure_bare_wrapper_cache: RefCell::new(HashMap::new()),
@@ -610,10 +605,6 @@ impl<'b, 'tcx> CrateContext<'b, 'tcx> {
         &self.local.external_srcs
     }
 
-    pub fn non_inlineable_statics<'a>(&'a self) -> &'a RefCell<NodeSet> {
-        &self.shared.non_inlineable_statics
-    }
-
     pub fn monomorphized<'a>(&'a self) -> &'a RefCell<HashMap<MonoId, ValueRef>> {
         &self.local.monomorphized
     }
@@ -638,6 +629,10 @@ impl<'b, 'tcx> CrateContext<'b, 'tcx> {
         &self.local.const_values
     }
 
+    pub fn static_values<'a>(&'a self) -> &'a RefCell<NodeMap<ValueRef>> {
+        &self.local.static_values
+    }
+
     pub fn extern_const_values<'a>(&'a self) -> &'a RefCell<DefIdMap<ValueRef>> {
         &self.local.extern_const_values
     }
diff --git a/src/librustc/middle/trans/debuginfo.rs b/src/librustc/middle/trans/debuginfo.rs
index a2b7cb159d9dc..ec92f935c49be 100644
--- a/src/librustc/middle/trans/debuginfo.rs
+++ b/src/librustc/middle/trans/debuginfo.rs
@@ -776,6 +776,7 @@ pub fn create_global_var_metadata(cx: &CrateContext,
         ast_map::NodeItem(item) => {
             match item.node {
                 ast::ItemStatic(..) => (item.ident, item.span),
+                ast::ItemConst(..) => (item.ident, item.span),
                 _ => {
                     cx.sess()
                       .span_bug(item.span,
diff --git a/src/librustc/middle/trans/expr.rs b/src/librustc/middle/trans/expr.rs
index cd4ad85d0942c..19c9c5e0119d2 100644
--- a/src/librustc/middle/trans/expr.rs
+++ b/src/librustc/middle/trans/expr.rs
@@ -36,7 +36,6 @@
 use back::abi;
 use llvm;
 use llvm::{ValueRef};
-use metadata::csearch;
 use middle::def;
 use middle::mem_categorization::Typer;
 use middle::subst;
@@ -839,25 +838,20 @@ fn trans_def<'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
             trans_def_fn_unadjusted(bcx, ref_expr, def)
         }
         def::DefStatic(did, _) => {
-            // There are three things that may happen here:
+            // There are two things that may happen here:
             //  1) If the static item is defined in this crate, it will be
             //     translated using `get_item_val`, and we return a pointer to
             //     the result.
-            //  2) If the static item is defined in another crate, but is
-            //     marked inlineable, then it will be inlined into this crate
-            //     and then translated with `get_item_val`.  Again, we return a
-            //     pointer to the result.
-            //  3) If the static item is defined in another crate and is not
-            //     marked inlineable, then we add (or reuse) a declaration of
-            //     an external global, and return a pointer to that.
+            //  2) If the static item is defined in another crate then we add
+            //     (or reuse) a declaration of an external global, and return a
+            //     pointer to that.
             let const_ty = expr_ty(bcx, ref_expr);
 
-            fn get_val<'blk, 'tcx>(bcx: Block<'blk, 'tcx>, did: ast::DefId, const_ty: ty::t)
-                                   -> ValueRef {
+            fn get_val<'blk, 'tcx>(bcx: Block<'blk, 'tcx>, did: ast::DefId,
+                                   const_ty: ty::t) -> ValueRef {
                 // For external constants, we don't inline.
                 if did.krate == ast::LOCAL_CRATE {
-                    // Case 1 or 2.  (The inlining in case 2 produces a new
-                    // DefId in LOCAL_CRATE.)
+                    // Case 1.
 
                     // The LLVM global has the type of its initializer,
                     // which may not be equal to the enum's type for
@@ -866,36 +860,41 @@ fn trans_def<'blk, 'tcx>(bcx: Block<'blk, 'tcx>,
                     let pty = type_of::type_of(bcx.ccx(), const_ty).ptr_to();
                     PointerCast(bcx, val, pty)
                 } else {
-                    // Case 3.
-                    match bcx.ccx().extern_const_values().borrow().find(&did) {
-                        None => {}  // Continue.
-                        Some(llval) => {
-                            return *llval;
-                        }
-                    }
-
-                    unsafe {
-                        let llty = type_of::type_of(bcx.ccx(), const_ty);
-                        let symbol = csearch::get_symbol(
-                            &bcx.ccx().sess().cstore,
-                            did);
-                        let llval = symbol.as_slice().with_c_str(|buf| {
-                                llvm::LLVMAddGlobal(bcx.ccx().llmod(),
-                                                    llty.to_ref(),
-                                                    buf)
-                            });
-                        bcx.ccx().extern_const_values().borrow_mut()
-                           .insert(did, llval);
-                        llval
-                    }
+                    // Case 2.
+                    base::get_extern_const(bcx.ccx(), did, const_ty)
                 }
             }
-            // The DefId produced by `maybe_instantiate_inline`
-            // may be in the LOCAL_CRATE or not.
-            let did = inline::maybe_instantiate_inline(bcx.ccx(), did);
             let val = get_val(bcx, did, const_ty);
             DatumBlock::new(bcx, Datum::new(val, const_ty, LvalueExpr))
         }
+        def::DefConst(did) => {
+            // First, inline any external constants into the local crate so we
+            // can be sure to get the LLVM value corresponding to it.
+            let did = inline::maybe_instantiate_inline(bcx.ccx(), did);
+            if did.krate != ast::LOCAL_CRATE {
+                bcx.tcx().sess.span_bug(ref_expr.span,
+                                        "cross crate constant could not \
+                                         be inlined");
+            }
+            let val = base::get_item_val(bcx.ccx(), did.node);
+
+            // Next, we need to crate a ByRef rvalue datum to return. We can't
+            // use the normal .to_ref_datum() function because the type of
+            // `val` is not actually the same as `const_ty`.
+            //
+            // To get around this, we make a custom alloca slot with the
+            // appropriate type (const_ty), and then we cast it to a pointer of
+            // typeof(val), store the value, and then hand this slot over to
+            // the datum infrastructure.
+            let const_ty = expr_ty(bcx, ref_expr);
+            let llty = type_of::type_of(bcx.ccx(), const_ty);
+            let slot = alloca(bcx, llty, "const");
+            let pty = Type::from_ref(unsafe { llvm::LLVMTypeOf(val) }).ptr_to();
+            Store(bcx, val, PointerCast(bcx, slot, pty));
+
+            let datum = Datum::new(slot, const_ty, Rvalue::new(ByRef));
+            DatumBlock::new(bcx, datum.to_expr_datum())
+        }
         _ => {
             DatumBlock::new(bcx, trans_local_var(bcx, def).to_expr_datum())
         }
diff --git a/src/librustc/middle/trans/inline.rs b/src/librustc/middle/trans/inline.rs
index e5c8d4d0ab343..048402782a6d9 100644
--- a/src/librustc/middle/trans/inline.rs
+++ b/src/librustc/middle/trans/inline.rs
@@ -17,7 +17,6 @@ use middle::ty;
 
 use syntax::ast;
 use syntax::ast_util::{local_def, PostExpansionMethod};
-use syntax::ast_util;
 
 fn instantiate_inline(ccx: &CrateContext, fn_id: ast::DefId)
     -> Option<ast::DefId> {
@@ -76,21 +75,7 @@ fn instantiate_inline(ccx: &CrateContext, fn_id: ast::DefId)
                         }
                     }
                 }
-                ast::ItemStatic(_, mutbl, _) => {
-                    if !ast_util::static_has_significant_address(mutbl, item.attrs.as_slice()) {
-                        // Inlined static items use internal linkage when
-                        // possible, so that LLVM will coalesce globals with
-                        // identical initializers.  (It only does this for
-                        // globals with unnamed_addr and either internal or
-                        // private linkage.)
-                        Some(InternalLinkage)
-                    } else {
-                        // The address is significant, so we can't create an
-                        // internal copy of the static.  (The copy would have a
-                        // different address from the original.)
-                        Some(AvailableExternallyLinkage)
-                    }
-                }
+                ast::ItemConst(..) => None,
                 _ => unreachable!(),
             };
 
diff --git a/src/librustc/middle/ty.rs b/src/librustc/middle/ty.rs
index 10bc1da3acb54..cea74c6573d54 100644
--- a/src/librustc/middle/ty.rs
+++ b/src/librustc/middle/ty.rs
@@ -68,7 +68,7 @@ use std::collections::enum_set::{EnumSet, CLike};
 
 pub type Disr = u64;
 
-pub static INITIAL_DISCRIMINANT_VALUE: Disr = 0;
+pub const INITIAL_DISCRIMINANT_VALUE: Disr = 0;
 
 // Data types
 
@@ -918,7 +918,7 @@ mod primitives {
         flags: super::has_ty_err as uint,
     };
 
-    pub static LAST_PRIMITIVE_ID: uint = 18;
+    pub const LAST_PRIMITIVE_ID: uint = 18;
 }
 
 // NB: If you change this, you'll probably want to change the corresponding
@@ -1374,6 +1374,7 @@ impl ParameterEnvironment {
                     ast::ItemEnum(..) |
                     ast::ItemStruct(..) |
                     ast::ItemImpl(..) |
+                    ast::ItemConst(..) |
                     ast::ItemStatic(..) => {
                         let def_id = ast_util::local_def(id);
                         let pty = ty::lookup_item_type(cx, def_id);
@@ -2199,7 +2200,7 @@ macro_rules! def_type_content_sets(
             use middle::ty::TypeContents;
             $(
                 #[allow(non_uppercase_statics)]
-                pub static $name: TypeContents = TypeContents { bits: $bits };
+                pub const $name: TypeContents = TypeContents { bits: $bits };
              )+
         }
     }
@@ -3576,6 +3577,8 @@ pub fn expr_kind(tcx: &ctxt, expr: &ast::Expr) -> ExprKind {
                 def::DefUpvar(..) |
                 def::DefLocal(..) => LvalueExpr,
 
+                def::DefConst(..) => RvalueDatumExpr,
+
                 def => {
                     tcx.sess.span_bug(
                         expr.span,
diff --git a/src/librustc/middle/typeck/astconv.rs b/src/librustc/middle/typeck/astconv.rs
index 4d21090dd2c2a..efd0a2a0e48b2 100644
--- a/src/librustc/middle/typeck/astconv.rs
+++ b/src/librustc/middle/typeck/astconv.rs
@@ -440,8 +440,8 @@ pub fn ast_path_to_ty_relaxed<'tcx, AC: AstConv<'tcx>,
     }
 }
 
-pub static NO_REGIONS: uint = 1;
-pub static NO_TPS: uint = 2;
+pub const NO_REGIONS: uint = 1;
+pub const NO_TPS: uint = 2;
 
 fn check_path_args(tcx: &ty::ctxt,
                    path: &ast::Path,
diff --git a/src/librustc/middle/typeck/check/mod.rs b/src/librustc/middle/typeck/check/mod.rs
index 4af71bfda8b35..68bb3fcf94544 100644
--- a/src/librustc/middle/typeck/check/mod.rs
+++ b/src/librustc/middle/typeck/check/mod.rs
@@ -677,7 +677,8 @@ pub fn check_item(ccx: &CrateCtxt, it: &ast::Item) {
     let _indenter = indenter();
 
     match it.node {
-      ast::ItemStatic(_, _, ref e) => check_const(ccx, it.span, &**e, it.id),
+      ast::ItemStatic(_, _, ref e) |
+      ast::ItemConst(_, ref e) => check_const(ccx, it.span, &**e, it.id),
       ast::ItemEnum(ref enum_definition, _) => {
         check_enum_variants(ccx,
                             it.span,
@@ -5083,7 +5084,7 @@ pub fn polytype_for_def(fcx: &FnCtxt,
       }
       def::DefFn(id, _, _) | def::DefStaticMethod(id, _, _) |
       def::DefStatic(id, _) | def::DefVariant(_, id, _) |
-      def::DefStruct(id) => {
+      def::DefStruct(id) | def::DefConst(id) => {
         return ty::lookup_item_type(fcx.ccx.tcx, id);
       }
       def::DefTrait(_) |
@@ -5211,6 +5212,7 @@ pub fn instantiate_path(fcx: &FnCtxt,
 
         // Case 2. Reference to a top-level value.
         def::DefFn(..) |
+        def::DefConst(..) |
         def::DefStatic(..) => {
             segment_spaces = Vec::from_elem(path.segments.len() - 1, None);
             segment_spaces.push(Some(subst::FnSpace));
diff --git a/src/librustc/middle/typeck/check/wf.rs b/src/librustc/middle/typeck/check/wf.rs
index 587aa072fa863..4c3cec1aff42f 100644
--- a/src/librustc/middle/typeck/check/wf.rs
+++ b/src/librustc/middle/typeck/check/wf.rs
@@ -69,6 +69,9 @@ impl<'ccx, 'tcx> CheckTypeWellFormedVisitor<'ccx, 'tcx> {
             ast::ItemStatic(..) => {
                 self.check_item_type(item);
             }
+            ast::ItemConst(..) => {
+                self.check_item_type(item);
+            }
             ast::ItemStruct(ref struct_def, _) => {
                 self.check_type_defn(item, |fcx| {
                     vec![struct_variant(fcx, &**struct_def)]
diff --git a/src/librustc/middle/typeck/collect.rs b/src/librustc/middle/typeck/collect.rs
index 40c52fd36b9c1..0b5c86fea7123 100644
--- a/src/librustc/middle/typeck/collect.rs
+++ b/src/librustc/middle/typeck/collect.rs
@@ -1550,7 +1550,7 @@ pub fn ty_of_item(ccx: &CrateCtxt, it: &ast::Item)
         _ => {}
     }
     match it.node {
-        ast::ItemStatic(ref t, _, _) => {
+        ast::ItemStatic(ref t, _, _) | ast::ItemConst(ref t, _) => {
             let typ = ccx.to_ty(&ExplicitRscope, &**t);
             let pty = no_params(typ);
 
diff --git a/src/librustc/middle/typeck/infer/resolve.rs b/src/librustc/middle/typeck/infer/resolve.rs
index 13659d4b77e1c..87f3fd987871c 100644
--- a/src/librustc/middle/typeck/infer/resolve.rs
+++ b/src/librustc/middle/typeck/infer/resolve.rs
@@ -57,21 +57,21 @@ use middle::typeck::infer::{unresolved_int_ty,unresolved_float_ty,unresolved_ty}
 use syntax::codemap::Span;
 use util::ppaux::{Repr, ty_to_string};
 
-pub static resolve_nested_tvar: uint = 0b0000000001;
-pub static resolve_rvar: uint        = 0b0000000010;
-pub static resolve_ivar: uint        = 0b0000000100;
-pub static resolve_fvar: uint        = 0b0000001000;
-pub static resolve_all: uint         = 0b0000001111;
-pub static force_tvar: uint          = 0b0000100000;
-pub static force_rvar: uint          = 0b0001000000;
-pub static force_ivar: uint          = 0b0010000000;
-pub static force_fvar: uint          = 0b0100000000;
-pub static force_all: uint           = 0b0111100000;
+pub const resolve_nested_tvar: uint = 0b0000000001;
+pub const resolve_rvar: uint        = 0b0000000010;
+pub const resolve_ivar: uint        = 0b0000000100;
+pub const resolve_fvar: uint        = 0b0000001000;
+pub const resolve_all: uint         = 0b0000001111;
+pub const force_tvar: uint          = 0b0000100000;
+pub const force_rvar: uint          = 0b0001000000;
+pub const force_ivar: uint          = 0b0010000000;
+pub const force_fvar: uint          = 0b0100000000;
+pub const force_all: uint           = 0b0111100000;
 
-pub static not_regions: uint         = !(force_rvar | resolve_rvar);
+pub const not_regions: uint         = !(force_rvar | resolve_rvar);
 
-pub static try_resolve_tvar_shallow: uint = 0;
-pub static resolve_and_force_all_but_regions: uint =
+pub const try_resolve_tvar_shallow: uint = 0;
+pub const resolve_and_force_all_but_regions: uint =
     (resolve_all | force_all) & not_regions;
 
 pub struct ResolveState<'a, 'tcx: 'a> {
diff --git a/src/librustc/middle/typeck/infer/test.rs b/src/librustc/middle/typeck/infer/test.rs
index 29cd2e77e8b1f..6ef2143b624f8 100644
--- a/src/librustc/middle/typeck/infer/test.rs
+++ b/src/librustc/middle/typeck/infer/test.rs
@@ -197,7 +197,7 @@ impl<'a, 'tcx> Env<'a, 'tcx> {
             }
 
             return match it.node {
-                ast::ItemStatic(..) | ast::ItemFn(..) |
+                ast::ItemConst(..) | ast::ItemStatic(..) | ast::ItemFn(..) |
                 ast::ItemForeignMod(..) | ast::ItemTy(..) => {
                     None
                 }
diff --git a/src/librustc/middle/typeck/variance.rs b/src/librustc/middle/typeck/variance.rs
index 9317ba2c7fa93..60a7aa7790442 100644
--- a/src/librustc/middle/typeck/variance.rs
+++ b/src/librustc/middle/typeck/variance.rs
@@ -384,6 +384,7 @@ impl<'a, 'tcx, 'v> Visitor<'v> for TermsContext<'a, 'tcx> {
 
             ast::ItemImpl(..) |
             ast::ItemStatic(..) |
+            ast::ItemConst(..) |
             ast::ItemFn(..) |
             ast::ItemMod(..) |
             ast::ItemForeignMod(..) |
@@ -528,6 +529,7 @@ impl<'a, 'tcx, 'v> Visitor<'v> for ConstraintContext<'a, 'tcx> {
             }
 
             ast::ItemStatic(..) |
+            ast::ItemConst(..) |
             ast::ItemFn(..) |
             ast::ItemMod(..) |
             ast::ItemForeignMod(..) |
diff --git a/src/librustc_back/abi.rs b/src/librustc_back/abi.rs
index 1e69ce003c557..bf525db7661b0 100644
--- a/src/librustc_back/abi.rs
+++ b/src/librustc_back/abi.rs
@@ -10,20 +10,20 @@
 
 #![allow(non_uppercase_statics)]
 
-pub static box_field_refcnt: uint = 0u;
-pub static box_field_drop_glue: uint = 1u;
-pub static box_field_body: uint = 4u;
+pub const box_field_refcnt: uint = 0u;
+pub const box_field_drop_glue: uint = 1u;
+pub const box_field_body: uint = 4u;
 
-pub static tydesc_field_visit_glue: uint = 3u;
+pub const tydesc_field_visit_glue: uint = 3u;
 
 // The two halves of a closure: code and environment.
-pub static fn_field_code: uint = 0u;
-pub static fn_field_box: uint = 1u;
+pub const fn_field_code: uint = 0u;
+pub const fn_field_box: uint = 1u;
 
 // The two fields of a trait object/trait instance: vtable and box.
 // The vtable contains the type descriptor as first element.
-pub static trt_field_box: uint = 0u;
-pub static trt_field_vtable: uint = 1u;
+pub const trt_field_box: uint = 0u;
+pub const trt_field_vtable: uint = 1u;
 
-pub static slice_elt_base: uint = 0u;
-pub static slice_elt_len: uint = 1u;
+pub const slice_elt_base: uint = 0u;
+pub const slice_elt_len: uint = 1u;
diff --git a/src/librustc_llvm/lib.rs b/src/librustc_llvm/lib.rs
index ad2b6891dc99e..aa6023326d6c1 100644
--- a/src/librustc_llvm/lib.rs
+++ b/src/librustc_llvm/lib.rs
@@ -43,8 +43,8 @@ pub mod diagnostic;
 pub type Opcode = u32;
 pub type Bool = c_uint;
 
-pub static True: Bool = 1 as Bool;
-pub static False: Bool = 0 as Bool;
+pub const True: Bool = 1 as Bool;
+pub const False: Bool = 0 as Bool;
 
 // Consts for the LLVM CallConv type, pre-cast to uint.
 
@@ -93,32 +93,32 @@ pub enum DiagnosticSeverity {
 
 bitflags! {
     flags Attribute : u32 {
-        static ZExtAttribute = 1 << 0,
-        static SExtAttribute = 1 << 1,
-        static NoReturnAttribute = 1 << 2,
-        static InRegAttribute = 1 << 3,
-        static StructRetAttribute = 1 << 4,
-        static NoUnwindAttribute = 1 << 5,
-        static NoAliasAttribute = 1 << 6,
-        static ByValAttribute = 1 << 7,
-        static NestAttribute = 1 << 8,
-        static ReadNoneAttribute = 1 << 9,
-        static ReadOnlyAttribute = 1 << 10,
-        static NoInlineAttribute = 1 << 11,
-        static AlwaysInlineAttribute = 1 << 12,
-        static OptimizeForSizeAttribute = 1 << 13,
-        static StackProtectAttribute = 1 << 14,
-        static StackProtectReqAttribute = 1 << 15,
-        static AlignmentAttribute = 31 << 16,
-        static NoCaptureAttribute = 1 << 21,
-        static NoRedZoneAttribute = 1 << 22,
-        static NoImplicitFloatAttribute = 1 << 23,
-        static NakedAttribute = 1 << 24,
-        static InlineHintAttribute = 1 << 25,
-        static StackAttribute = 7 << 26,
-        static ReturnsTwiceAttribute = 1 << 29,
-        static UWTableAttribute = 1 << 30,
-        static NonLazyBindAttribute = 1 << 31,
+        const ZExtAttribute = 1 << 0,
+        const SExtAttribute = 1 << 1,
+        const NoReturnAttribute = 1 << 2,
+        const InRegAttribute = 1 << 3,
+        const StructRetAttribute = 1 << 4,
+        const NoUnwindAttribute = 1 << 5,
+        const NoAliasAttribute = 1 << 6,
+        const ByValAttribute = 1 << 7,
+        const NestAttribute = 1 << 8,
+        const ReadNoneAttribute = 1 << 9,
+        const ReadOnlyAttribute = 1 << 10,
+        const NoInlineAttribute = 1 << 11,
+        const AlwaysInlineAttribute = 1 << 12,
+        const OptimizeForSizeAttribute = 1 << 13,
+        const StackProtectAttribute = 1 << 14,
+        const StackProtectReqAttribute = 1 << 15,
+        const AlignmentAttribute = 31 << 16,
+        const NoCaptureAttribute = 1 << 21,
+        const NoRedZoneAttribute = 1 << 22,
+        const NoImplicitFloatAttribute = 1 << 23,
+        const NakedAttribute = 1 << 24,
+        const InlineHintAttribute = 1 << 25,
+        const StackAttribute = 7 << 26,
+        const ReturnsTwiceAttribute = 1 << 29,
+        const UWTableAttribute = 1 << 30,
+        const NonLazyBindAttribute = 1 << 31,
     }
 }
 
diff --git a/src/librustdoc/clean/mod.rs b/src/librustdoc/clean/mod.rs
index 5c78bb976f1e3..7e9bb2844a7c7 100644
--- a/src/librustdoc/clean/mod.rs
+++ b/src/librustdoc/clean/mod.rs
@@ -300,6 +300,7 @@ pub enum ItemEnum {
     ModuleItem(Module),
     TypedefItem(Typedef),
     StaticItem(Static),
+    ConstantItem(Constant),
     TraitItem(Trait),
     ImplItem(Impl),
     /// `use` and `extern crate`
@@ -347,6 +348,7 @@ impl Clean<Item> for doctree::Module {
             self.mods.clean(cx),
             self.typedefs.clean(cx),
             self.statics.clean(cx),
+            self.constants.clean(cx),
             self.traits.clean(cx),
             self.impls.clean(cx),
             self.view_items.clean(cx).into_iter()
@@ -1741,6 +1743,29 @@ impl Clean<Item> for doctree::Static {
     }
 }
 
+#[deriving(Clone, Encodable, Decodable)]
+pub struct Constant {
+    pub type_: Type,
+    pub expr: String,
+}
+
+impl Clean<Item> for doctree::Constant {
+    fn clean(&self, cx: &DocContext) -> Item {
+        Item {
+            name: Some(self.name.clean(cx)),
+            attrs: self.attrs.clean(cx),
+            source: self.whence.clean(cx),
+            def_id: ast_util::local_def(self.id),
+            visibility: self.vis.clean(cx),
+            stability: self.stab.clean(cx),
+            inner: ConstantItem(Constant {
+                type_: self.type_.clean(cx),
+                expr: self.expr.span.to_src(cx),
+            }),
+        }
+    }
+}
+
 #[deriving(Show, Clone, Encodable, Decodable, PartialEq)]
 pub enum Mutability {
     Mutable,
diff --git a/src/librustdoc/doctree.rs b/src/librustdoc/doctree.rs
index 72964609049bf..b173f0f16e30d 100644
--- a/src/librustdoc/doctree.rs
+++ b/src/librustdoc/doctree.rs
@@ -30,6 +30,7 @@ pub struct Module {
     pub id: NodeId,
     pub typedefs: Vec<Typedef>,
     pub statics: Vec<Static>,
+    pub constants: Vec<Constant>,
     pub traits: Vec<Trait>,
     pub vis: ast::Visibility,
     pub stab: Option<attr::Stability>,
@@ -56,6 +57,7 @@ impl Module {
             mods       : Vec::new(),
             typedefs   : Vec::new(),
             statics    : Vec::new(),
+            constants  : Vec::new(),
             traits     : Vec::new(),
             impls      : Vec::new(),
             view_items : Vec::new(),
@@ -151,6 +153,17 @@ pub struct Static {
     pub whence: Span,
 }
 
+pub struct Constant {
+    pub type_: P<ast::Ty>,
+    pub expr: P<ast::Expr>,
+    pub name: Ident,
+    pub attrs: Vec<ast::Attribute>,
+    pub vis: ast::Visibility,
+    pub stab: Option<attr::Stability>,
+    pub id: ast::NodeId,
+    pub whence: Span,
+}
+
 pub struct Trait {
     pub name: Ident,
     pub items: Vec<ast::TraitItem>, //should be TraitItem
diff --git a/src/librustdoc/flock.rs b/src/librustdoc/flock.rs
index d1cc37497dc44..ef921a84cfb8e 100644
--- a/src/librustdoc/flock.rs
+++ b/src/librustdoc/flock.rs
@@ -38,10 +38,10 @@ mod imp {
             pub l_sysid: libc::c_int,
         }
 
-        pub static F_WRLCK: libc::c_short = 1;
-        pub static F_UNLCK: libc::c_short = 2;
-        pub static F_SETLK: libc::c_int = 6;
-        pub static F_SETLKW: libc::c_int = 7;
+        pub const F_WRLCK: libc::c_short = 1;
+        pub const F_UNLCK: libc::c_short = 2;
+        pub const F_SETLK: libc::c_int = 6;
+        pub const F_SETLKW: libc::c_int = 7;
     }
 
     #[cfg(target_os = "freebsd")]
@@ -57,10 +57,10 @@ mod imp {
             pub l_sysid: libc::c_int,
         }
 
-        pub static F_UNLCK: libc::c_short = 2;
-        pub static F_WRLCK: libc::c_short = 3;
-        pub static F_SETLK: libc::c_int = 12;
-        pub static F_SETLKW: libc::c_int = 13;
+        pub const F_UNLCK: libc::c_short = 2;
+        pub const F_WRLCK: libc::c_short = 3;
+        pub const F_SETLK: libc::c_int = 12;
+        pub const F_SETLKW: libc::c_int = 13;
     }
 
     #[cfg(target_os = "dragonfly")]
@@ -78,10 +78,10 @@ mod imp {
             pub l_sysid: libc::c_int,
         }
 
-        pub static F_UNLCK: libc::c_short = 2;
-        pub static F_WRLCK: libc::c_short = 3;
-        pub static F_SETLK: libc::c_int = 8;
-        pub static F_SETLKW: libc::c_int = 9;
+        pub const F_UNLCK: libc::c_short = 2;
+        pub const F_WRLCK: libc::c_short = 3;
+        pub const F_SETLK: libc::c_int = 8;
+        pub const F_SETLKW: libc::c_int = 9;
     }
 
     #[cfg(any(target_os = "macos", target_os = "ios"))]
@@ -99,10 +99,10 @@ mod imp {
             pub l_sysid: libc::c_int,
         }
 
-        pub static F_UNLCK: libc::c_short = 2;
-        pub static F_WRLCK: libc::c_short = 3;
-        pub static F_SETLK: libc::c_int = 8;
-        pub static F_SETLKW: libc::c_int = 9;
+        pub const F_UNLCK: libc::c_short = 2;
+        pub const F_WRLCK: libc::c_short = 3;
+        pub const F_SETLK: libc::c_int = 8;
+        pub const F_SETLKW: libc::c_int = 9;
     }
 
     pub struct Lock {
diff --git a/src/librustdoc/html/item_type.rs b/src/librustdoc/html/item_type.rs
index e18ab0bd14f59..0b35f8ddc6963 100644
--- a/src/librustdoc/html/item_type.rs
+++ b/src/librustdoc/html/item_type.rs
@@ -39,6 +39,7 @@ pub enum ItemType {
     Macro           = 15,
     Primitive       = 16,
     AssociatedType  = 17,
+    Constant        = 18,
 }
 
 impl ItemType {
@@ -62,6 +63,7 @@ impl ItemType {
             Macro           => "macro",
             Primitive       => "primitive",
             AssociatedType  => "associatedtype",
+            Constant        => "constant",
         }
     }
 }
@@ -86,6 +88,7 @@ pub fn shortty(item: &clean::Item) -> ItemType {
         clean::FunctionItem(..)        => Function,
         clean::TypedefItem(..)         => Typedef,
         clean::StaticItem(..)          => Static,
+        clean::ConstantItem(..)        => Constant,
         clean::TraitItem(..)           => Trait,
         clean::ImplItem(..)            => Impl,
         clean::ViewItemItem(..)        => ViewItem,
diff --git a/src/librustdoc/html/markdown.rs b/src/librustdoc/html/markdown.rs
index faf361f029059..a5c6f79ef6b17 100644
--- a/src/librustdoc/html/markdown.rs
+++ b/src/librustdoc/html/markdown.rs
@@ -48,16 +48,16 @@ pub struct Markdown<'a>(pub &'a str);
 /// table of contents.
 pub struct MarkdownWithToc<'a>(pub &'a str);
 
-static DEF_OUNIT: libc::size_t = 64;
-static HOEDOWN_EXT_NO_INTRA_EMPHASIS: libc::c_uint = 1 << 10;
-static HOEDOWN_EXT_TABLES: libc::c_uint = 1 << 0;
-static HOEDOWN_EXT_FENCED_CODE: libc::c_uint = 1 << 1;
-static HOEDOWN_EXT_AUTOLINK: libc::c_uint = 1 << 3;
-static HOEDOWN_EXT_STRIKETHROUGH: libc::c_uint = 1 << 4;
-static HOEDOWN_EXT_SUPERSCRIPT: libc::c_uint = 1 << 8;
-static HOEDOWN_EXT_FOOTNOTES: libc::c_uint = 1 << 2;
-
-static HOEDOWN_EXTENSIONS: libc::c_uint =
+const DEF_OUNIT: libc::size_t = 64;
+const HOEDOWN_EXT_NO_INTRA_EMPHASIS: libc::c_uint = 1 << 10;
+const HOEDOWN_EXT_TABLES: libc::c_uint = 1 << 0;
+const HOEDOWN_EXT_FENCED_CODE: libc::c_uint = 1 << 1;
+const HOEDOWN_EXT_AUTOLINK: libc::c_uint = 1 << 3;
+const HOEDOWN_EXT_STRIKETHROUGH: libc::c_uint = 1 << 4;
+const HOEDOWN_EXT_SUPERSCRIPT: libc::c_uint = 1 << 8;
+const HOEDOWN_EXT_FOOTNOTES: libc::c_uint = 1 << 2;
+
+const HOEDOWN_EXTENSIONS: libc::c_uint =
     HOEDOWN_EXT_NO_INTRA_EMPHASIS | HOEDOWN_EXT_TABLES |
     HOEDOWN_EXT_FENCED_CODE | HOEDOWN_EXT_AUTOLINK |
     HOEDOWN_EXT_STRIKETHROUGH | HOEDOWN_EXT_SUPERSCRIPT |
diff --git a/src/librustdoc/html/render.rs b/src/librustdoc/html/render.rs
index e9d65b0a40cf2..497bbd3a1cd6b 100644
--- a/src/librustdoc/html/render.rs
+++ b/src/librustdoc/html/render.rs
@@ -1471,6 +1471,8 @@ fn item_module(w: &mut fmt::Formatter, cx: &Context,
             (_, &clean::StructItem(..)) => Greater,
             (&clean::EnumItem(..), _) => Less,
             (_, &clean::EnumItem(..)) => Greater,
+            (&clean::ConstantItem(..), _) => Less,
+            (_, &clean::ConstantItem(..)) => Greater,
             (&clean::StaticItem(..), _) => Less,
             (_, &clean::StaticItem(..)) => Greater,
             (&clean::ForeignFunctionItem(..), _) => Less,
@@ -1507,6 +1509,7 @@ fn item_module(w: &mut fmt::Formatter, cx: &Context,
                 clean::FunctionItem(..)        => ("functions", "Functions"),
                 clean::TypedefItem(..)         => ("types", "Type Definitions"),
                 clean::StaticItem(..)          => ("statics", "Statics"),
+                clean::ConstantItem(..)        => ("constants", "Constants"),
                 clean::TraitItem(..)           => ("traits", "Traits"),
                 clean::ImplItem(..)            => ("impls", "Implementations"),
                 clean::ViewItemItem(..)        => ("reexports", "Reexports"),
@@ -1526,28 +1529,28 @@ fn item_module(w: &mut fmt::Formatter, cx: &Context,
                         id = short, name = name));
         }
 
-        match myitem.inner {
-            clean::StaticItem(ref s) | clean::ForeignStaticItem(ref s) => {
-                struct Initializer<'a>(&'a str, Item<'a>);
-                impl<'a> fmt::Show for Initializer<'a> {
-                    fn fmt(&self, f: &mut fmt::Formatter) -> fmt::Result {
-                        let Initializer(s, item) = *self;
-                        if s.len() == 0 { return Ok(()); }
-                        try!(write!(f, "<code> = </code>"));
-                        if s.contains("\n") {
-                            match item.href() {
-                                Some(url) => {
-                                    write!(f, "<a href='{}'>[definition]</a>",
-                                           url)
-                                }
-                                None => Ok(()),
-                            }
-                        } else {
-                            write!(f, "<code>{}</code>", s.as_slice())
+        struct Initializer<'a>(&'a str, Item<'a>);
+        impl<'a> fmt::Show for Initializer<'a> {
+            fn fmt(&self, f: &mut fmt::Formatter) -> fmt::Result {
+                let Initializer(s, item) = *self;
+                if s.len() == 0 { return Ok(()); }
+                try!(write!(f, "<code> = </code>"));
+                if s.contains("\n") {
+                    match item.href() {
+                        Some(url) => {
+                            write!(f, "<a href='{}'>[definition]</a>",
+                                   url)
                         }
+                        None => Ok(()),
                     }
+                } else {
+                    write!(f, "<code>{}</code>", s.as_slice())
                 }
+            }
+        }
 
+        match myitem.inner {
+            clean::StaticItem(ref s) | clean::ForeignStaticItem(ref s) => {
                 try!(write!(w, "
                     <tr>
                         <td>{}<code>{}static {}{}: {}</code>{}</td>
@@ -1562,6 +1565,20 @@ fn item_module(w: &mut fmt::Formatter, cx: &Context,
                 Initializer(s.expr.as_slice(), Item { cx: cx, item: myitem }),
                 Markdown(blank(myitem.doc_value()))));
             }
+            clean::ConstantItem(ref s) => {
+                try!(write!(w, "
+                    <tr>
+                        <td>{}<code>{}const {}: {}</code>{}</td>
+                        <td class='docblock'>{}&nbsp;</td>
+                    </tr>
+                ",
+                ConciseStability(&myitem.stability),
+                VisSpace(myitem.visibility),
+                *myitem.name.get_ref(),
+                s.type_,
+                Initializer(s.expr.as_slice(), Item { cx: cx, item: myitem }),
+                Markdown(blank(myitem.doc_value()))));
+            }
 
             clean::ViewItemItem(ref item) => {
                 match item.inner {
diff --git a/src/librustdoc/html/static/main.js b/src/librustdoc/html/static/main.js
index 6992a96659295..7c6f7ed3fe230 100644
--- a/src/librustdoc/html/static/main.js
+++ b/src/librustdoc/html/static/main.js
@@ -569,7 +569,9 @@
                          "ffi",
                          "ffs",
                          "macro",
-                         "primitive"];
+                         "primitive",
+                         "associatedtype",
+                         "constant"];
 
         function itemTypeFromName(typename) {
             for (var i = 0; i < itemTypes.length; ++i) {
diff --git a/src/librustdoc/passes.rs b/src/librustdoc/passes.rs
index 3c66a7c785094..1a9dd226f87df 100644
--- a/src/librustdoc/passes.rs
+++ b/src/librustdoc/passes.rs
@@ -134,7 +134,8 @@ impl<'a> fold::DocFolder for Stripper<'a> {
             clean::StructItem(..) | clean::EnumItem(..) |
             clean::TraitItem(..) | clean::FunctionItem(..) |
             clean::VariantItem(..) | clean::MethodItem(..) |
-            clean::ForeignFunctionItem(..) | clean::ForeignStaticItem(..) => {
+            clean::ForeignFunctionItem(..) | clean::ForeignStaticItem(..) |
+            clean::ConstantItem(..) => {
                 if ast_util::is_local(i.def_id) &&
                    !self.exported_items.contains(&i.def_id.node) {
                     return None;
diff --git a/src/librustdoc/visit_ast.rs b/src/librustdoc/visit_ast.rs
index d4a1a35790936..6456f4acd30c3 100644
--- a/src/librustdoc/visit_ast.rs
+++ b/src/librustdoc/visit_ast.rs
@@ -308,6 +308,19 @@ impl<'a, 'tcx> RustdocVisitor<'a, 'tcx> {
                 };
                 om.statics.push(s);
             },
+            ast::ItemConst(ref ty, ref exp) => {
+                let s = Constant {
+                    type_: ty.clone(),
+                    expr: exp.clone(),
+                    id: item.id,
+                    name: name,
+                    attrs: item.attrs.clone(),
+                    whence: item.span,
+                    vis: item.vis,
+                    stab: self.stability(item.id),
+                };
+                om.constants.push(s);
+            },
             ast::ItemTrait(ref gen, _, ref b, ref items) => {
                 let t = Trait {
                     name: name,
diff --git a/src/librustrt/c_str.rs b/src/librustrt/c_str.rs
index 934fb0ddd3ce4..a5ac70286fe81 100644
--- a/src/librustrt/c_str.rs
+++ b/src/librustrt/c_str.rs
@@ -414,7 +414,7 @@ impl ToCStr for String {
 }
 
 // The length of the stack allocated buffer for `vec.with_c_str()`
-static BUF_LEN: uint = 128;
+const BUF_LEN: uint = 128;
 
 impl<'a> ToCStr for &'a [u8] {
     fn to_c_str(&self) -> CString {
diff --git a/src/librustrt/lib.rs b/src/librustrt/lib.rs
index d3ea07291a423..26fc399968cd5 100644
--- a/src/librustrt/lib.rs
+++ b/src/librustrt/lib.rs
@@ -100,7 +100,7 @@ pub trait Runtime {
 
 /// The default error code of the rust runtime if the main task fails instead
 /// of exiting cleanly.
-pub static DEFAULT_ERROR_CODE: int = 101;
+pub const DEFAULT_ERROR_CODE: int = 101;
 
 /// One-time runtime initialization.
 ///
diff --git a/src/librustrt/libunwind.rs b/src/librustrt/libunwind.rs
index bb7a1227e0e47..6867cb2e76b34 100644
--- a/src/librustrt/libunwind.rs
+++ b/src/librustrt/libunwind.rs
@@ -57,19 +57,19 @@ pub type _Unwind_Exception_Class = u64;
 pub type _Unwind_Word = libc::uintptr_t;
 
 #[cfg(target_arch = "x86")]
-pub static unwinder_private_data_size: uint = 5;
+pub const unwinder_private_data_size: uint = 5;
 
 #[cfg(target_arch = "x86_64")]
-pub static unwinder_private_data_size: uint = 6;
+pub const unwinder_private_data_size: uint = 6;
 
 #[cfg(all(target_arch = "arm", not(target_os = "ios")))]
-pub static unwinder_private_data_size: uint = 20;
+pub const unwinder_private_data_size: uint = 20;
 
 #[cfg(all(target_arch = "arm", target_os = "ios"))]
-pub static unwinder_private_data_size: uint = 5;
+pub const unwinder_private_data_size: uint = 5;
 
 #[cfg(any(target_arch = "mips", target_arch = "mipsel"))]
-pub static unwinder_private_data_size: uint = 2;
+pub const unwinder_private_data_size: uint = 2;
 
 #[repr(C)]
 pub struct _Unwind_Exception {
diff --git a/src/librustrt/mutex.rs b/src/librustrt/mutex.rs
index 28b0256f2e6e3..bd47874d64720 100644
--- a/src/librustrt/mutex.rs
+++ b/src/librustrt/mutex.rs
@@ -88,7 +88,7 @@ pub struct LockGuard<'a> {
     lock: &'a StaticNativeMutex
 }
 
-pub static NATIVE_MUTEX_INIT: StaticNativeMutex = StaticNativeMutex {
+pub const NATIVE_MUTEX_INIT: StaticNativeMutex = StaticNativeMutex {
     inner: imp::MUTEX_INIT,
 };
 
@@ -353,9 +353,9 @@ mod imp {
         pub type pthread_mutex_t = *mut libc::c_void;
         pub type pthread_cond_t = *mut libc::c_void;
 
-        pub static PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t =
+        pub const PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t =
             0 as pthread_mutex_t;
-        pub static PTHREAD_COND_INITIALIZER: pthread_cond_t =
+        pub const PTHREAD_COND_INITIALIZER: pthread_cond_t =
             0 as pthread_cond_t;
     }
 
@@ -364,20 +364,20 @@ mod imp {
         use libc;
 
         #[cfg(target_arch = "x86_64")]
-        static __PTHREAD_MUTEX_SIZE__: uint = 56;
+        const __PTHREAD_MUTEX_SIZE__: uint = 56;
         #[cfg(target_arch = "x86_64")]
-        static __PTHREAD_COND_SIZE__: uint = 40;
+        const __PTHREAD_COND_SIZE__: uint = 40;
         #[cfg(target_arch = "x86")]
-        static __PTHREAD_MUTEX_SIZE__: uint = 40;
+        const __PTHREAD_MUTEX_SIZE__: uint = 40;
         #[cfg(target_arch = "x86")]
-        static __PTHREAD_COND_SIZE__: uint = 24;
+        const __PTHREAD_COND_SIZE__: uint = 24;
         #[cfg(target_arch = "arm")]
-        static __PTHREAD_MUTEX_SIZE__: uint = 40;
+        const __PTHREAD_MUTEX_SIZE__: uint = 40;
         #[cfg(target_arch = "arm")]
-        static __PTHREAD_COND_SIZE__: uint = 24;
+        const __PTHREAD_COND_SIZE__: uint = 24;
 
-        static _PTHREAD_MUTEX_SIG_INIT: libc::c_long = 0x32AAABA7;
-        static _PTHREAD_COND_SIG_INIT: libc::c_long = 0x3CB0B1BB;
+        const _PTHREAD_MUTEX_SIG_INIT: libc::c_long = 0x32AAABA7;
+        const _PTHREAD_COND_SIG_INIT: libc::c_long = 0x3CB0B1BB;
 
         #[repr(C)]
         pub struct pthread_mutex_t {
@@ -390,11 +390,11 @@ mod imp {
             __opaque: [u8, ..__PTHREAD_COND_SIZE__],
         }
 
-        pub static PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
+        pub const PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
             __sig: _PTHREAD_MUTEX_SIG_INIT,
             __opaque: [0, ..__PTHREAD_MUTEX_SIZE__],
         };
-        pub static PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
+        pub const PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
             __sig: _PTHREAD_COND_SIG_INIT,
             __opaque: [0, ..__PTHREAD_COND_SIZE__],
         };
@@ -406,25 +406,25 @@ mod imp {
 
         // minus 8 because we have an 'align' field
         #[cfg(target_arch = "x86_64")]
-        static __SIZEOF_PTHREAD_MUTEX_T: uint = 40 - 8;
+        const __SIZEOF_PTHREAD_MUTEX_T: uint = 40 - 8;
         #[cfg(target_arch = "x86")]
-        static __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
+        const __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
         #[cfg(target_arch = "arm")]
-        static __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
+        const __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
         #[cfg(target_arch = "mips")]
-        static __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
+        const __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
         #[cfg(target_arch = "mipsel")]
-        static __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
+        const __SIZEOF_PTHREAD_MUTEX_T: uint = 24 - 8;
         #[cfg(target_arch = "x86_64")]
-        static __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
+        const __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
         #[cfg(target_arch = "x86")]
-        static __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
+        const __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
         #[cfg(target_arch = "arm")]
-        static __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
+        const __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
         #[cfg(target_arch = "mips")]
-        static __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
+        const __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
         #[cfg(target_arch = "mipsel")]
-        static __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
+        const __SIZEOF_PTHREAD_COND_T: uint = 48 - 8;
 
         #[repr(C)]
         pub struct pthread_mutex_t {
@@ -437,11 +437,11 @@ mod imp {
             size: [u8, ..__SIZEOF_PTHREAD_COND_T],
         }
 
-        pub static PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
+        pub const PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
             __align: 0,
             size: [0, ..__SIZEOF_PTHREAD_MUTEX_T],
         };
-        pub static PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
+        pub const PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
             __align: 0,
             size: [0, ..__SIZEOF_PTHREAD_COND_T],
         };
@@ -455,10 +455,10 @@ mod imp {
         #[repr(C)]
         pub struct pthread_cond_t { value: libc::c_int }
 
-        pub static PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
+        pub const PTHREAD_MUTEX_INITIALIZER: pthread_mutex_t = pthread_mutex_t {
             value: 0,
         };
-        pub static PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
+        pub const PTHREAD_COND_INITIALIZER: pthread_cond_t = pthread_cond_t {
             value: 0,
         };
     }
@@ -468,7 +468,7 @@ mod imp {
         cond: UnsafeCell<pthread_cond_t>,
     }
 
-    pub static MUTEX_INIT: Mutex = Mutex {
+    pub const MUTEX_INIT: Mutex = Mutex {
         lock: UnsafeCell { value: PTHREAD_MUTEX_INITIALIZER },
         cond: UnsafeCell { value: PTHREAD_COND_INITIALIZER },
     };
@@ -523,11 +523,11 @@ mod imp {
     use libc;
 
     type LPCRITICAL_SECTION = *mut c_void;
-    static SPIN_COUNT: DWORD = 4000;
+    const SPIN_COUNT: DWORD = 4000;
     #[cfg(target_arch = "x86")]
-    static CRIT_SECTION_SIZE: uint = 24;
+    const CRIT_SECTION_SIZE: uint = 24;
     #[cfg(target_arch = "x86_64")]
-    static CRIT_SECTION_SIZE: uint = 40;
+    const CRIT_SECTION_SIZE: uint = 40;
 
     pub struct Mutex {
         // pointers for the lock/cond handles, atomically updated
@@ -535,7 +535,7 @@ mod imp {
         cond: atomic::AtomicUint,
     }
 
-    pub static MUTEX_INIT: Mutex = Mutex {
+    pub const MUTEX_INIT: Mutex = Mutex {
         lock: atomic::INIT_ATOMIC_UINT,
         cond: atomic::INIT_ATOMIC_UINT,
     };
diff --git a/src/librustrt/stack.rs b/src/librustrt/stack.rs
index 5c94ef61bfdb7..4034000e28f33 100644
--- a/src/librustrt/stack.rs
+++ b/src/librustrt/stack.rs
@@ -46,7 +46,7 @@
 // corresponding prolog, decision was taken to disable segmented
 // stack support on iOS.
 
-pub static RED_ZONE: uint = 20 * 1024;
+pub const RED_ZONE: uint = 20 * 1024;
 
 /// This function is invoked from rust's current __morestack function. Segmented
 /// stacks are currently not enabled as segmented stacks, but rather one giant
diff --git a/src/librustrt/unwind.rs b/src/librustrt/unwind.rs
index f07e8ecc335d7..2a2fa29eca0b2 100644
--- a/src/librustrt/unwind.rs
+++ b/src/librustrt/unwind.rs
@@ -91,7 +91,7 @@ pub type Callback = fn(msg: &Any + Send, file: &'static str, line: uint);
 // Variables used for invoking callbacks when a task starts to unwind.
 //
 // For more information, see below.
-static MAX_CALLBACKS: uint = 16;
+const MAX_CALLBACKS: uint = 16;
 static mut CALLBACKS: [atomic::AtomicUint, ..MAX_CALLBACKS] =
         [atomic::INIT_ATOMIC_UINT, atomic::INIT_ATOMIC_UINT,
          atomic::INIT_ATOMIC_UINT, atomic::INIT_ATOMIC_UINT,
diff --git a/src/librustrt/util.rs b/src/librustrt/util.rs
index ab1ef2fc5aa68..a94da33e54357 100644
--- a/src/librustrt/util.rs
+++ b/src/librustrt/util.rs
@@ -23,15 +23,15 @@ use libc;
 //
 // FIXME: Once the runtime matures remove the `true` below to turn off rtassert,
 //        etc.
-pub static ENFORCE_SANITY: bool = true || !cfg!(rtopt) || cfg!(rtdebug) ||
+pub const ENFORCE_SANITY: bool = true || !cfg!(rtopt) || cfg!(rtdebug) ||
                                   cfg!(rtassert);
 
 pub struct Stdio(libc::c_int);
 
 #[allow(non_uppercase_statics)]
-pub static Stdout: Stdio = Stdio(libc::STDOUT_FILENO);
+pub const Stdout: Stdio = Stdio(libc::STDOUT_FILENO);
 #[allow(non_uppercase_statics)]
-pub static Stderr: Stdio = Stdio(libc::STDERR_FILENO);
+pub const Stderr: Stdio = Stdio(libc::STDERR_FILENO);
 
 impl fmt::FormatWriter for Stdio {
     fn write(&mut self, data: &[u8]) -> fmt::Result {
diff --git a/src/libserialize/json.rs b/src/libserialize/json.rs
index a9ac5ec3ab4f6..5d9211caac1b1 100644
--- a/src/libserialize/json.rs
+++ b/src/libserialize/json.rs
@@ -360,18 +360,16 @@ fn escape_char(writer: &mut io::Writer, v: char) -> Result<(), io::IoError> {
 }
 
 fn spaces(wr: &mut io::Writer, mut n: uint) -> Result<(), io::IoError> {
-    #[allow(non_uppercase_statics)]
-    static len: uint = 16;
-    #[allow(non_uppercase_statics)]
-    static buf: [u8, ..len] = [b' ', ..len];
+    const LEN: uint = 16;
+    static BUF: [u8, ..LEN] = [b' ', ..LEN];
 
-    while n >= len {
-        try!(wr.write(buf));
-        n -= len;
+    while n >= LEN {
+        try!(wr.write(BUF));
+        n -= LEN;
     }
 
     if n > 0 {
-        wr.write(buf[..n])
+        wr.write(BUF[..n])
     } else {
         Ok(())
     }
diff --git a/src/libstd/bitflags.rs b/src/libstd/bitflags.rs
index 7966040ed7bc6..adb55f2cc8cff 100644
--- a/src/libstd/bitflags.rs
+++ b/src/libstd/bitflags.rs
@@ -24,12 +24,12 @@
 /// ```{.rust}
 /// bitflags! {
 ///     flags Flags: u32 {
-///         static FLAG_A       = 0x00000001,
-///         static FLAG_B       = 0x00000010,
-///         static FLAG_C       = 0x00000100,
-///         static FLAG_ABC     = FLAG_A.bits
-///                             | FLAG_B.bits
-///                             | FLAG_C.bits,
+///         const FLAG_A       = 0x00000001,
+///         const FLAG_B       = 0x00000010,
+///         const FLAG_C       = 0x00000100,
+///         const FLAG_ABC     = FLAG_A.bits
+///                            | FLAG_B.bits
+///                            | FLAG_C.bits,
 ///     }
 /// }
 ///
@@ -50,8 +50,8 @@
 ///
 /// bitflags! {
 ///     flags Flags: u32 {
-///         static FLAG_A   = 0x00000001,
-///         static FLAG_B   = 0x00000010,
+///         const FLAG_A   = 0x00000001,
+///         const FLAG_B   = 0x00000010,
 ///     }
 /// }
 ///
@@ -115,7 +115,7 @@
 #[macro_export]
 macro_rules! bitflags {
     ($(#[$attr:meta])* flags $BitFlags:ident: $T:ty {
-        $($(#[$Flag_attr:meta])* static $Flag:ident = $value:expr),+
+        $($(#[$Flag_attr:meta])* const $Flag:ident = $value:expr),+
     }) => {
         #[deriving(PartialEq, Eq, Clone, PartialOrd, Ord, Hash)]
         $(#[$attr])*
@@ -123,7 +123,7 @@ macro_rules! bitflags {
             bits: $T,
         }
 
-        $($(#[$Flag_attr])* pub static $Flag: $BitFlags = $BitFlags { bits: $value };)+
+        $($(#[$Flag_attr])* pub const $Flag: $BitFlags = $BitFlags { bits: $value };)+
 
         impl $BitFlags {
             /// Returns an empty set of flags.
@@ -235,12 +235,12 @@ macro_rules! bitflags {
         }
     };
     ($(#[$attr:meta])* flags $BitFlags:ident: $T:ty {
-        $($(#[$Flag_attr:meta])* static $Flag:ident = $value:expr),+,
+        $($(#[$Flag_attr:meta])* const $Flag:ident = $value:expr),+,
     }) => {
         bitflags! {
             $(#[$attr])*
             flags $BitFlags: $T {
-                $($(#[$Flag_attr])* static $Flag = $value),+
+                $($(#[$Flag_attr])* const $Flag = $value),+
             }
         }
     };
@@ -259,14 +259,14 @@ mod tests {
         #[doc = "> "]
         #[doc = "> - Richard Feynman"]
         flags Flags: u32 {
-            static FlagA       = 0x00000001,
+            const FlagA       = 0x00000001,
             #[doc = "<pcwalton> macros are way better at generating code than trans is"]
-            static FlagB       = 0x00000010,
-            static FlagC       = 0x00000100,
+            const FlagB       = 0x00000010,
+            const FlagC       = 0x00000100,
             #[doc = "* cmr bed"]
             #[doc = "* strcat table"]
             #[doc = "<strcat> wait what?"]
-            static FlagABC     = FlagA.bits
+            const FlagABC     = FlagA.bits
                                | FlagB.bits
                                | FlagC.bits,
         }
@@ -274,7 +274,7 @@ mod tests {
 
     bitflags! {
         flags AnotherSetOfFlags: uint {
-            static AnotherFlag = 1u,
+            const AnotherFlag = 1u,
         }
     }
 
diff --git a/src/libstd/collections/hashmap/map.rs b/src/libstd/collections/hashmap/map.rs
index 6b9c76e1568d2..ef40402105b54 100644
--- a/src/libstd/collections/hashmap/map.rs
+++ b/src/libstd/collections/hashmap/map.rs
@@ -41,8 +41,8 @@ use super::table::{
     SafeHash
 };
 
-static INITIAL_LOG2_CAP: uint = 5;
-pub static INITIAL_CAPACITY: uint = 1 << INITIAL_LOG2_CAP; // 2^5
+const INITIAL_LOG2_CAP: uint = 5;
+pub const INITIAL_CAPACITY: uint = 1 << INITIAL_LOG2_CAP; // 2^5
 
 /// The default behavior of HashMap implements a load factor of 90.9%.
 /// This behavior is characterized by the following conditions:
diff --git a/src/libstd/collections/hashmap/table.rs b/src/libstd/collections/hashmap/table.rs
index bad5ce3e47525..ee64a7931c062 100644
--- a/src/libstd/collections/hashmap/table.rs
+++ b/src/libstd/collections/hashmap/table.rs
@@ -24,7 +24,7 @@ use ptr::{RawPtr, copy_nonoverlapping_memory, zero_memory};
 use ptr;
 use rt::heap::{allocate, deallocate};
 
-static EMPTY_BUCKET: u64 = 0u64;
+const EMPTY_BUCKET: u64 = 0u64;
 
 /// The raw hashtable, providing safe-ish access to the unzipped and highly
 /// optimized arrays of hashes, keys, and values.
diff --git a/src/libstd/io/mod.rs b/src/libstd/io/mod.rs
index 280aff71e2327..d18b3cdf2e750 100644
--- a/src/libstd/io/mod.rs
+++ b/src/libstd/io/mod.rs
@@ -283,7 +283,7 @@ pub mod util;
 /// The default buffer size for various I/O operations
 // libuv recommends 64k buffers to maximize throughput
 // https://groups.google.com/forum/#!topic/libuv/oQO1HJAIDdA
-static DEFAULT_BUF_SIZE: uint = 1024 * 64;
+const DEFAULT_BUF_SIZE: uint = 1024 * 64;
 
 /// A convenient typedef of the return value of any I/O action.
 pub type IoResult<T> = Result<T, IoError>;
@@ -1803,93 +1803,93 @@ bitflags! {
     #[doc = "A set of permissions for a file or directory is represented"]
     #[doc = "by a set of flags which are or'd together."]
     flags FilePermission: u32 {
-        static USER_READ     = 0o400,
-        static USER_WRITE    = 0o200,
-        static USER_EXECUTE  = 0o100,
-        static GROUP_READ    = 0o040,
-        static GROUP_WRITE   = 0o020,
-        static GROUP_EXECUTE = 0o010,
-        static OTHER_READ    = 0o004,
-        static OTHER_WRITE   = 0o002,
-        static OTHER_EXECUTE = 0o001,
-
-        static USER_RWX  = USER_READ.bits | USER_WRITE.bits | USER_EXECUTE.bits,
-        static GROUP_RWX = GROUP_READ.bits | GROUP_WRITE.bits | GROUP_EXECUTE.bits,
-        static OTHER_RWX = OTHER_READ.bits | OTHER_WRITE.bits | OTHER_EXECUTE.bits,
+        const USER_READ     = 0o400,
+        const USER_WRITE    = 0o200,
+        const USER_EXECUTE  = 0o100,
+        const GROUP_READ    = 0o040,
+        const GROUP_WRITE   = 0o020,
+        const GROUP_EXECUTE = 0o010,
+        const OTHER_READ    = 0o004,
+        const OTHER_WRITE   = 0o002,
+        const OTHER_EXECUTE = 0o001,
+
+        const USER_RWX  = USER_READ.bits | USER_WRITE.bits | USER_EXECUTE.bits,
+        const GROUP_RWX = GROUP_READ.bits | GROUP_WRITE.bits | GROUP_EXECUTE.bits,
+        const OTHER_RWX = OTHER_READ.bits | OTHER_WRITE.bits | OTHER_EXECUTE.bits,
 
         #[doc = "Permissions for user owned files, equivalent to 0644 on"]
         #[doc = "unix-like systems."]
-        static USER_FILE = USER_READ.bits | USER_WRITE.bits | GROUP_READ.bits | OTHER_READ.bits,
+        const USER_FILE = USER_READ.bits | USER_WRITE.bits | GROUP_READ.bits | OTHER_READ.bits,
 
         #[doc = "Permissions for user owned directories, equivalent to 0755 on"]
         #[doc = "unix-like systems."]
-        static USER_DIR  = USER_RWX.bits | GROUP_READ.bits | GROUP_EXECUTE.bits |
+        const USER_DIR  = USER_RWX.bits | GROUP_READ.bits | GROUP_EXECUTE.bits |
                    OTHER_READ.bits | OTHER_EXECUTE.bits,
 
         #[doc = "Permissions for user owned executables, equivalent to 0755"]
         #[doc = "on unix-like systems."]
-        static USER_EXEC = USER_DIR.bits,
+        const USER_EXEC = USER_DIR.bits,
 
         #[doc = "All possible permissions enabled."]
-        static ALL_PERMISSIONS = USER_RWX.bits | GROUP_RWX.bits | OTHER_RWX.bits,
+        const ALL_PERMISSIONS = USER_RWX.bits | GROUP_RWX.bits | OTHER_RWX.bits,
 
         // Deprecated names
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_READ instead"]
-        static UserRead     = USER_READ.bits,
+        const UserRead     = USER_READ.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_WRITE instead"]
-        static UserWrite    = USER_WRITE.bits,
+        const UserWrite    = USER_WRITE.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_EXECUTE instead"]
-        static UserExecute  = USER_EXECUTE.bits,
+        const UserExecute  = USER_EXECUTE.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use GROUP_READ instead"]
-        static GroupRead    = GROUP_READ.bits,
+        const GroupRead    = GROUP_READ.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use GROUP_WRITE instead"]
-        static GroupWrite   = GROUP_WRITE.bits,
+        const GroupWrite   = GROUP_WRITE.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use GROUP_EXECUTE instead"]
-        static GroupExecute = GROUP_EXECUTE.bits,
+        const GroupExecute = GROUP_EXECUTE.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use OTHER_READ instead"]
-        static OtherRead    = OTHER_READ.bits,
+        const OtherRead    = OTHER_READ.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use OTHER_WRITE instead"]
-        static OtherWrite   = OTHER_WRITE.bits,
+        const OtherWrite   = OTHER_WRITE.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use OTHER_EXECUTE instead"]
-        static OtherExecute = OTHER_EXECUTE.bits,
+        const OtherExecute = OTHER_EXECUTE.bits,
 
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_RWX instead"]
-        static UserRWX  = USER_RWX.bits,
+        const UserRWX  = USER_RWX.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use GROUP_RWX instead"]
-        static GroupRWX = GROUP_RWX.bits,
+        const GroupRWX = GROUP_RWX.bits,
         #[allow(non_uppercase_statics)]
         #[deprecated = "use OTHER_RWX instead"]
-        static OtherRWX = OTHER_RWX.bits,
+        const OtherRWX = OTHER_RWX.bits,
 
         #[doc = "Deprecated: use `USER_FILE` instead."]
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_FILE instead"]
-        static UserFile = USER_FILE.bits,
+        const UserFile = USER_FILE.bits,
 
         #[doc = "Deprecated: use `USER_DIR` instead."]
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_DIR instead"]
-        static UserDir  = USER_DIR.bits,
+        const UserDir  = USER_DIR.bits,
         #[doc = "Deprecated: use `USER_EXEC` instead."]
         #[allow(non_uppercase_statics)]
         #[deprecated = "use USER_EXEC instead"]
-        static UserExec = USER_EXEC.bits,
+        const UserExec = USER_EXEC.bits,
 
         #[doc = "Deprecated: use `ALL_PERMISSIONS` instead"]
         #[allow(non_uppercase_statics)]
         #[deprecated = "use ALL_PERMISSIONS instead"]
-        static AllPermissions = ALL_PERMISSIONS.bits,
+        const AllPermissions = ALL_PERMISSIONS.bits,
     }
 }
 
diff --git a/src/libstd/io/process.rs b/src/libstd/io/process.rs
index ef336bc7b4f99..5de4bc10e1aec 100644
--- a/src/libstd/io/process.rs
+++ b/src/libstd/io/process.rs
@@ -32,16 +32,16 @@ use std::hash::sip::SipState;
 
 /// Signal a process to exit, without forcibly killing it. Corresponds to
 /// SIGTERM on unix platforms.
-#[cfg(windows)] pub static PleaseExitSignal: int = 15;
+#[cfg(windows)] pub const PleaseExitSignal: int = 15;
 /// Signal a process to exit immediately, forcibly killing it. Corresponds to
 /// SIGKILL on unix platforms.
-#[cfg(windows)] pub static MustDieSignal: int = 9;
+#[cfg(windows)] pub const MustDieSignal: int = 9;
 /// Signal a process to exit, without forcibly killing it. Corresponds to
 /// SIGTERM on unix platforms.
-#[cfg(not(windows))] pub static PleaseExitSignal: int = libc::SIGTERM as int;
+#[cfg(not(windows))] pub const PleaseExitSignal: int = libc::SIGTERM as int;
 /// Signal a process to exit immediately, forcibly killing it. Corresponds to
 /// SIGKILL on unix platforms.
-#[cfg(not(windows))] pub static MustDieSignal: int = libc::SIGKILL as int;
+#[cfg(not(windows))] pub const MustDieSignal: int = libc::SIGKILL as int;
 
 /// Representation of a running or exited child process.
 ///
diff --git a/src/libstd/os.rs b/src/libstd/os.rs
index bb642f1e48f71..60386ec0631b7 100644
--- a/src/libstd/os.rs
+++ b/src/libstd/os.rs
@@ -66,8 +66,8 @@ pub fn num_cpus() -> uint {
     }
 }
 
-pub static TMPBUF_SZ : uint = 1000u;
-static BUF_BYTES : uint = 2048u;
+pub const TMPBUF_SZ : uint = 1000u;
+const BUF_BYTES : uint = 2048u;
 
 /// Returns the current working directory as a Path.
 ///
@@ -1672,230 +1672,230 @@ impl MemoryMap {
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `linux`.
-    pub static SYSNAME: &'static str = "linux";
+    pub const SYSNAME: &'static str = "linux";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, `lib`.
-    pub static DLL_PREFIX: &'static str = "lib";
+    pub const DLL_PREFIX: &'static str = "lib";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.so`.
-    pub static DLL_SUFFIX: &'static str = ".so";
+    pub const DLL_SUFFIX: &'static str = ".so";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `so`.
-    pub static DLL_EXTENSION: &'static str = "so";
+    pub const DLL_EXTENSION: &'static str = "so";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "macos")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `macos`.
-    pub static SYSNAME: &'static str = "macos";
+    pub const SYSNAME: &'static str = "macos";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, `lib`.
-    pub static DLL_PREFIX: &'static str = "lib";
+    pub const DLL_PREFIX: &'static str = "lib";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.dylib`.
-    pub static DLL_SUFFIX: &'static str = ".dylib";
+    pub const DLL_SUFFIX: &'static str = ".dylib";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `dylib`.
-    pub static DLL_EXTENSION: &'static str = "dylib";
+    pub const DLL_EXTENSION: &'static str = "dylib";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "ios")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `ios`.
-    pub static SYSNAME: &'static str = "ios";
+    pub const SYSNAME: &'static str = "ios";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "freebsd")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `freebsd`.
-    pub static SYSNAME: &'static str = "freebsd";
+    pub const SYSNAME: &'static str = "freebsd";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, `lib`.
-    pub static DLL_PREFIX: &'static str = "lib";
+    pub const DLL_PREFIX: &'static str = "lib";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.so`.
-    pub static DLL_SUFFIX: &'static str = ".so";
+    pub const DLL_SUFFIX: &'static str = ".so";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `so`.
-    pub static DLL_EXTENSION: &'static str = "so";
+    pub const DLL_EXTENSION: &'static str = "so";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "dragonfly")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `dragonfly`.
-    pub static SYSNAME: &'static str = "dragonfly";
+    pub const SYSNAME: &'static str = "dragonfly";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, `lib`.
-    pub static DLL_PREFIX: &'static str = "lib";
+    pub const DLL_PREFIX: &'static str = "lib";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.so`.
-    pub static DLL_SUFFIX: &'static str = ".so";
+    pub const DLL_SUFFIX: &'static str = ".so";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `so`.
-    pub static DLL_EXTENSION: &'static str = "so";
+    pub const DLL_EXTENSION: &'static str = "so";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "android")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "unix";
+    pub const FAMILY: &'static str = "unix";
 
     /// A string describing the specific operating system in use: in this
     /// case, `android`.
-    pub static SYSNAME: &'static str = "android";
+    pub const SYSNAME: &'static str = "android";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, `lib`.
-    pub static DLL_PREFIX: &'static str = "lib";
+    pub const DLL_PREFIX: &'static str = "lib";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.so`.
-    pub static DLL_SUFFIX: &'static str = ".so";
+    pub const DLL_SUFFIX: &'static str = ".so";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `so`.
-    pub static DLL_EXTENSION: &'static str = "so";
+    pub const DLL_EXTENSION: &'static str = "so";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, the empty string.
-    pub static EXE_SUFFIX: &'static str = "";
+    pub const EXE_SUFFIX: &'static str = "";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, the empty string.
-    pub static EXE_EXTENSION: &'static str = "";
+    pub const EXE_EXTENSION: &'static str = "";
 }
 
 #[cfg(target_os = "windows")]
 pub mod consts {
     pub use os::arch_consts::ARCH;
 
-    pub static FAMILY: &'static str = "windows";
+    pub const FAMILY: &'static str = "windows";
 
     /// A string describing the specific operating system in use: in this
     /// case, `windows`.
-    pub static SYSNAME: &'static str = "windows";
+    pub const SYSNAME: &'static str = "windows";
 
     /// Specifies the filename prefix used for shared libraries on this
     /// platform: in this case, the empty string.
-    pub static DLL_PREFIX: &'static str = "";
+    pub const DLL_PREFIX: &'static str = "";
 
     /// Specifies the filename suffix used for shared libraries on this
     /// platform: in this case, `.dll`.
-    pub static DLL_SUFFIX: &'static str = ".dll";
+    pub const DLL_SUFFIX: &'static str = ".dll";
 
     /// Specifies the file extension used for shared libraries on this
     /// platform that goes after the dot: in this case, `dll`.
-    pub static DLL_EXTENSION: &'static str = "dll";
+    pub const DLL_EXTENSION: &'static str = "dll";
 
     /// Specifies the filename suffix used for executable binaries on this
     /// platform: in this case, `.exe`.
-    pub static EXE_SUFFIX: &'static str = ".exe";
+    pub const EXE_SUFFIX: &'static str = ".exe";
 
     /// Specifies the file extension, if any, used for executable binaries
     /// on this platform: in this case, `exe`.
-    pub static EXE_EXTENSION: &'static str = "exe";
+    pub const EXE_EXTENSION: &'static str = "exe";
 }
 
 #[cfg(target_arch = "x86")]
 mod arch_consts {
-    pub static ARCH: &'static str = "x86";
+    pub const ARCH: &'static str = "x86";
 }
 
 #[cfg(target_arch = "x86_64")]
 mod arch_consts {
-    pub static ARCH: &'static str = "x86_64";
+    pub const ARCH: &'static str = "x86_64";
 }
 
 #[cfg(target_arch = "arm")]
 mod arch_consts {
-    pub static ARCH: &'static str = "arm";
+    pub const ARCH: &'static str = "arm";
 }
 
 #[cfg(target_arch = "mips")]
 mod arch_consts {
-    pub static ARCH: &'static str = "mips";
+    pub const ARCH: &'static str = "mips";
 }
 
 #[cfg(target_arch = "mipsel")]
 mod arch_consts {
-    pub static ARCH: &'static str = "mipsel";
+    pub const ARCH: &'static str = "mipsel";
 }
 
 #[cfg(test)]
diff --git a/src/libstd/path/posix.rs b/src/libstd/path/posix.rs
index 196ac7507ea86..f7fb9adb1fb64 100644
--- a/src/libstd/path/posix.rs
+++ b/src/libstd/path/posix.rs
@@ -42,10 +42,10 @@ pub struct Path {
 }
 
 /// The standard path separator character
-pub static SEP: char = '/';
+pub const SEP: char = '/';
 
 /// The standard path separator byte
-pub static SEP_BYTE: u8 = SEP as u8;
+pub const SEP_BYTE: u8 = SEP as u8;
 
 /// Returns whether the given byte is a path separator
 #[inline]
diff --git a/src/libstd/path/windows.rs b/src/libstd/path/windows.rs
index ec3f87bc45a53..5bd738ed58bd3 100644
--- a/src/libstd/path/windows.rs
+++ b/src/libstd/path/windows.rs
@@ -958,14 +958,14 @@ pub fn make_non_verbatim(path: &Path) -> Option<Path> {
 }
 
 /// The standard path separator character
-pub static SEP: char = '\\';
+pub const SEP: char = '\\';
 /// The standard path separator byte
-pub static SEP_BYTE: u8 = SEP as u8;
+pub const SEP_BYTE: u8 = SEP as u8;
 
 /// The alternative path separator character
-pub static SEP2: char = '/';
+pub const SEP2: char = '/';
 /// The alternative path separator character
-pub static SEP2_BYTE: u8 = SEP2 as u8;
+pub const SEP2_BYTE: u8 = SEP2 as u8;
 
 /// Returns whether the given char is a path separator.
 /// Allows both the primary separator '\' and the alternative separator '/'.
diff --git a/src/libstd/rt/backtrace.rs b/src/libstd/rt/backtrace.rs
index e1925fc79d0dc..6cbbc0af3909e 100644
--- a/src/libstd/rt/backtrace.rs
+++ b/src/libstd/rt/backtrace.rs
@@ -45,8 +45,8 @@ pub fn log_enabled() -> bool {
     val == 2
 }
 
-#[cfg(target_word_size = "64")] static HEX_WIDTH: uint = 18;
-#[cfg(target_word_size = "32")] static HEX_WIDTH: uint = 10;
+#[cfg(target_word_size = "64")] const HEX_WIDTH: uint = 18;
+#[cfg(target_word_size = "32")] const HEX_WIDTH: uint = 10;
 
 // All rust symbols are in theory lists of "::"-separated identifiers. Some
 // assemblers, however, can't handle these characters in symbol names. To get
@@ -273,7 +273,7 @@ mod imp {
 
         try!(writeln!(w, "stack backtrace:"));
         // 100 lines should be enough
-        static SIZE: uint = 100;
+        const SIZE: uint = 100;
         let mut buf: [*mut libc::c_void, ..SIZE] = unsafe {mem::zeroed()};
         let cnt = unsafe { backtrace(buf.as_mut_ptr(), SIZE as libc::c_int) as uint};
 
@@ -697,10 +697,10 @@ mod imp {
                            *mut libc::c_void, *mut libc::c_void,
                            *mut libc::c_void, *mut libc::c_void) -> libc::BOOL;
 
-    static MAX_SYM_NAME: uint = 2000;
-    static IMAGE_FILE_MACHINE_I386: libc::DWORD = 0x014c;
-    static IMAGE_FILE_MACHINE_IA64: libc::DWORD = 0x0200;
-    static IMAGE_FILE_MACHINE_AMD64: libc::DWORD = 0x8664;
+    const MAX_SYM_NAME: uint = 2000;
+    const IMAGE_FILE_MACHINE_I386: libc::DWORD = 0x014c;
+    const IMAGE_FILE_MACHINE_IA64: libc::DWORD = 0x0200;
+    const IMAGE_FILE_MACHINE_AMD64: libc::DWORD = 0x8664;
 
     #[repr(C)]
     struct SYMBOL_INFO {
@@ -772,7 +772,7 @@ mod imp {
     mod arch {
         use libc;
 
-        static MAXIMUM_SUPPORTED_EXTENSION: uint = 512;
+        const MAXIMUM_SUPPORTED_EXTENSION: uint = 512;
 
         #[repr(C)]
         pub struct CONTEXT {
diff --git a/src/libstd/time/duration.rs b/src/libstd/time/duration.rs
index 85aed47265fc3..751eb00bfaecc 100644
--- a/src/libstd/time/duration.rs
+++ b/src/libstd/time/duration.rs
@@ -20,23 +20,23 @@ use num::{CheckedAdd, CheckedMul};
 use result::{Result, Ok, Err};
 
 /// The number of nanoseconds in a microsecond.
-static NANOS_PER_MICRO: i32 = 1000;
+const NANOS_PER_MICRO: i32 = 1000;
 /// The number of nanoseconds in a millisecond.
-static NANOS_PER_MILLI: i32 = 1000_000;
+const NANOS_PER_MILLI: i32 = 1000_000;
 /// The number of nanoseconds in seconds.
-static NANOS_PER_SEC: i32 = 1_000_000_000;
+const NANOS_PER_SEC: i32 = 1_000_000_000;
 /// The number of microseconds per second.
-static MICROS_PER_SEC: i64 = 1000_000;
+const MICROS_PER_SEC: i64 = 1000_000;
 /// The number of milliseconds per second.
-static MILLIS_PER_SEC: i64 = 1000;
+const MILLIS_PER_SEC: i64 = 1000;
 /// The number of seconds in a minute.
-static SECS_PER_MINUTE: i64 = 60;
+const SECS_PER_MINUTE: i64 = 60;
 /// The number of seconds in an hour.
-static SECS_PER_HOUR: i64 = 3600;
+const SECS_PER_HOUR: i64 = 3600;
 /// The number of (non-leap) seconds in days.
-static SECS_PER_DAY: i64 = 86400;
+const SECS_PER_DAY: i64 = 86400;
 /// The number of (non-leap) seconds in a week.
-static SECS_PER_WEEK: i64 = 604800;
+const SECS_PER_WEEK: i64 = 604800;
 
 macro_rules! try_opt(
     ($e:expr) => (match $e { Some(v) => v, None => return None })
@@ -52,13 +52,13 @@ pub struct Duration {
 }
 
 /// The minimum possible `Duration`: `i64::MIN` milliseconds.
-pub static MIN: Duration = Duration {
+pub const MIN: Duration = Duration {
     secs: i64::MIN / MILLIS_PER_SEC - 1,
     nanos: NANOS_PER_SEC + (i64::MIN % MILLIS_PER_SEC) as i32 * NANOS_PER_MILLI
 };
 
 /// The maximum possible `Duration`: `i64::MAX` milliseconds.
-pub static MAX: Duration = Duration {
+pub const MAX: Duration = Duration {
     secs: i64::MAX / MILLIS_PER_SEC,
     nanos: (i64::MAX % MILLIS_PER_SEC) as i32 * NANOS_PER_MILLI
 };
@@ -456,7 +456,7 @@ mod tests {
         assert_eq!(MIN.num_microseconds(), None);
 
         // overflow checks
-        static MICROS_PER_DAY: i64 = 86400_000_000;
+        const MICROS_PER_DAY: i64 = 86400_000_000;
         assert_eq!(Duration::days(i64::MAX / MICROS_PER_DAY).num_microseconds(),
                    Some(i64::MAX / MICROS_PER_DAY * MICROS_PER_DAY));
         assert_eq!(Duration::days(i64::MIN / MICROS_PER_DAY).num_microseconds(),
@@ -477,7 +477,7 @@ mod tests {
         assert_eq!(MIN.num_nanoseconds(), None);
 
         // overflow checks
-        static NANOS_PER_DAY: i64 = 86400_000_000_000;
+        const NANOS_PER_DAY: i64 = 86400_000_000_000;
         assert_eq!(Duration::days(i64::MAX / NANOS_PER_DAY).num_nanoseconds(),
                    Some(i64::MAX / NANOS_PER_DAY * NANOS_PER_DAY));
         assert_eq!(Duration::days(i64::MIN / NANOS_PER_DAY).num_nanoseconds(),
diff --git a/src/libsync/comm/oneshot.rs b/src/libsync/comm/oneshot.rs
index 5b3cf33ebf093..053b5dc4c8a74 100644
--- a/src/libsync/comm/oneshot.rs
+++ b/src/libsync/comm/oneshot.rs
@@ -43,9 +43,9 @@ use atomic;
 use comm::Receiver;
 
 // Various states you can find a port in.
-static EMPTY: uint = 0;
-static DATA: uint = 1;
-static DISCONNECTED: uint = 2;
+const EMPTY: uint = 0;
+const DATA: uint = 1;
+const DISCONNECTED: uint = 2;
 
 pub struct Packet<T> {
     // Internal state of the chan/port pair (stores the blocked task as well)
diff --git a/src/libsync/comm/shared.rs b/src/libsync/comm/shared.rs
index cb35bd8afb772..cfd045d08821a 100644
--- a/src/libsync/comm/shared.rs
+++ b/src/libsync/comm/shared.rs
@@ -31,12 +31,12 @@ use rustrt::thread::Thread;
 use atomic;
 use mpsc_queue as mpsc;
 
-static DISCONNECTED: int = int::MIN;
-static FUDGE: int = 1024;
+const DISCONNECTED: int = int::MIN;
+const FUDGE: int = 1024;
 #[cfg(test)]
-static MAX_STEALS: int = 5;
+const MAX_STEALS: int = 5;
 #[cfg(not(test))]
-static MAX_STEALS: int = 1 << 20;
+const MAX_STEALS: int = 1 << 20;
 
 pub struct Packet<T> {
     queue: mpsc::Queue<T>,
diff --git a/src/libsync/comm/stream.rs b/src/libsync/comm/stream.rs
index 36fe335128e4d..8e433c6a585f3 100644
--- a/src/libsync/comm/stream.rs
+++ b/src/libsync/comm/stream.rs
@@ -30,11 +30,11 @@ use atomic;
 use comm::Receiver;
 use spsc_queue as spsc;
 
-static DISCONNECTED: int = int::MIN;
+const DISCONNECTED: int = int::MIN;
 #[cfg(test)]
-static MAX_STEALS: int = 5;
+const MAX_STEALS: int = 5;
 #[cfg(not(test))]
-static MAX_STEALS: int = 1 << 20;
+const MAX_STEALS: int = 1 << 20;
 
 pub struct Packet<T> {
     queue: spsc::Queue<Message<T>>, // internal queue for all message
diff --git a/src/libsync/mutex.rs b/src/libsync/mutex.rs
index 12de615a81b79..c6413d0d09cc7 100644
--- a/src/libsync/mutex.rs
+++ b/src/libsync/mutex.rs
@@ -70,9 +70,9 @@ use rustrt::thread::Thread;
 
 use mpsc_intrusive as q;
 
-pub static LOCKED: uint = 1 << 0;
-pub static GREEN_BLOCKED: uint = 1 << 1;
-pub static NATIVE_BLOCKED: uint = 1 << 2;
+pub const LOCKED: uint = 1 << 0;
+pub const GREEN_BLOCKED: uint = 1 << 1;
+pub const NATIVE_BLOCKED: uint = 1 << 2;
 
 /// A mutual exclusion primitive useful for protecting shared data
 ///
@@ -163,7 +163,7 @@ pub struct Guard<'a> {
 
 /// Static initialization of a mutex. This constant can be used to initialize
 /// other mutex constants.
-pub static MUTEX_INIT: StaticMutex = StaticMutex {
+pub const MUTEX_INIT: StaticMutex = StaticMutex {
     lock: mutex::NATIVE_MUTEX_INIT,
     state: atomic::INIT_ATOMIC_UINT,
     flavor: UnsafeCell { value: Unlocked },
diff --git a/src/libsync/one.rs b/src/libsync/one.rs
index 4594345d2a3f6..c740c4f3d2e95 100644
--- a/src/libsync/one.rs
+++ b/src/libsync/one.rs
@@ -45,7 +45,7 @@ pub struct Once {
 }
 
 /// Initialization value for static `Once` values.
-pub static ONCE_INIT: Once = Once {
+pub const ONCE_INIT: Once = Once {
     mutex: MUTEX_INIT,
     cnt: atomic::INIT_ATOMIC_INT,
     lock_cnt: atomic::INIT_ATOMIC_INT,
diff --git a/src/libsyntax/abi.rs b/src/libsyntax/abi.rs
index 3a02d74edffb7..03325ad470668 100644
--- a/src/libsyntax/abi.rs
+++ b/src/libsyntax/abi.rs
@@ -48,9 +48,9 @@ pub enum Architecture {
 }
 
 #[allow(non_uppercase_statics)]
-static IntelBits: u32 = (1 << (X86 as uint)) | (1 << (X86_64 as uint));
+const IntelBits: u32 = (1 << (X86 as uint)) | (1 << (X86_64 as uint));
 #[allow(non_uppercase_statics)]
-static ArmBits: u32 = (1 << (Arm as uint));
+const ArmBits: u32 = (1 << (Arm as uint));
 
 pub struct AbiData {
     abi: Abi,
diff --git a/src/libsyntax/ast.rs b/src/libsyntax/ast.rs
index 0a87c0a344e52..274bb2e39e019 100644
--- a/src/libsyntax/ast.rs
+++ b/src/libsyntax/ast.rs
@@ -104,8 +104,8 @@ impl PartialEq for Ident {
 // this uint is a reference to a table stored in thread-local
 // storage.
 pub type SyntaxContext = u32;
-pub static EMPTY_CTXT : SyntaxContext = 0;
-pub static ILLEGAL_CTXT : SyntaxContext = 1;
+pub const EMPTY_CTXT : SyntaxContext = 0;
+pub const ILLEGAL_CTXT : SyntaxContext = 1;
 
 /// A name is a part of an identifier, representing a string or gensym. It's
 /// the result of interning.
@@ -198,13 +198,13 @@ pub struct DefId {
 
 /// Item definitions in the currently-compiled crate would have the CrateNum
 /// LOCAL_CRATE in their DefId.
-pub static LOCAL_CRATE: CrateNum = 0;
-pub static CRATE_NODE_ID: NodeId = 0;
+pub const LOCAL_CRATE: CrateNum = 0;
+pub const CRATE_NODE_ID: NodeId = 0;
 
 /// When parsing and doing expansions, we initially give all AST nodes this AST
 /// node value. Then later, in the renumber pass, we renumber them to have
 /// small, positive ids.
-pub static DUMMY_NODE_ID: NodeId = -1;
+pub const DUMMY_NODE_ID: NodeId = -1;
 
 /// The AST represents all type param bounds as types.
 /// typeck::collect::compute_bounds matches these against
@@ -1309,6 +1309,7 @@ pub struct Item {
 #[deriving(Clone, PartialEq, Eq, Encodable, Decodable, Hash, Show)]
 pub enum Item_ {
     ItemStatic(P<Ty>, Mutability, P<Expr>),
+    ItemConst(P<Ty>, P<Expr>),
     ItemFn(P<FnDecl>, FnStyle, Abi, Generics, P<Block>),
     ItemMod(Mod),
     ItemForeignMod(ForeignMod),
diff --git a/src/libsyntax/ast_map/mod.rs b/src/libsyntax/ast_map/mod.rs
index 257bfc632d882..2d0cea2fefc9d 100644
--- a/src/libsyntax/ast_map/mod.rs
+++ b/src/libsyntax/ast_map/mod.rs
@@ -1018,6 +1018,7 @@ fn node_id_to_string(map: &Map, id: NodeId) -> String {
             let path_str = map.path_to_str_with_ident(id, item.ident);
             let item_str = match item.node {
                 ItemStatic(..) => "static",
+                ItemConst(..) => "const",
                 ItemFn(..) => "fn",
                 ItemMod(..) => "mod",
                 ItemForeignMod(..) => "foreign mod",
diff --git a/src/libsyntax/ast_util.rs b/src/libsyntax/ast_util.rs
index f746e1f14822a..f51c2985f0bf4 100644
--- a/src/libsyntax/ast_util.rs
+++ b/src/libsyntax/ast_util.rs
@@ -12,8 +12,6 @@ use abi::Abi;
 use ast::*;
 use ast;
 use ast_util;
-use attr::{InlineNever, InlineNone};
-use attr;
 use codemap;
 use codemap::Span;
 use owned_slice::OwnedSlice;
@@ -706,18 +704,6 @@ pub fn lit_is_str(lit: &Lit) -> bool {
     }
 }
 
-/// Returns true if the static with the given mutability and attributes
-/// has a significant address and false otherwise.
-pub fn static_has_significant_address(mutbl: ast::Mutability,
-                                              attrs: &[ast::Attribute])
-                                              -> bool {
-    if mutbl == ast::MutMutable {
-        return true
-    }
-    let inline = attr::find_inline_attr(attrs);
-    inline == InlineNever || inline == InlineNone
-}
-
 /// Macro invocations are guaranteed not to occur after expansion is complete.
 /// Extracting fields of a method requires a dynamic check to make sure that it's
 /// not a macro invocation. This check is guaranteed to succeed, assuming
diff --git a/src/libsyntax/codemap.rs b/src/libsyntax/codemap.rs
index dda4107043106..5d96cc359c2ff 100644
--- a/src/libsyntax/codemap.rs
+++ b/src/libsyntax/codemap.rs
@@ -96,7 +96,7 @@ pub struct Span {
     pub expn_id: ExpnId
 }
 
-pub static DUMMY_SP: Span = Span { lo: BytePos(0), hi: BytePos(0), expn_id: NO_EXPANSION };
+pub const DUMMY_SP: Span = Span { lo: BytePos(0), hi: BytePos(0), expn_id: NO_EXPANSION };
 
 #[deriving(Clone, PartialEq, Eq, Encodable, Decodable, Hash, Show)]
 pub struct Spanned<T> {
@@ -227,7 +227,7 @@ pub struct ExpnInfo {
 #[deriving(PartialEq, Eq, Clone, Show, Hash, Encodable, Decodable)]
 pub struct ExpnId(u32);
 
-pub static NO_EXPANSION: ExpnId = ExpnId(-1);
+pub const NO_EXPANSION: ExpnId = ExpnId(-1);
 
 impl ExpnId {
     pub fn from_llvm_cookie(cookie: c_uint) -> ExpnId {
diff --git a/src/libsyntax/ext/build.rs b/src/libsyntax/ext/build.rs
index 1fdb6dd505f45..87983e1aea3a9 100644
--- a/src/libsyntax/ext/build.rs
+++ b/src/libsyntax/ext/build.rs
@@ -250,6 +250,13 @@ pub trait AstBuilder {
                    expr: P<ast::Expr>)
                    -> P<ast::Item>;
 
+    fn item_const(&self,
+                   span: Span,
+                   name: Ident,
+                   ty: P<ast::Ty>,
+                   expr: P<ast::Expr>)
+                   -> P<ast::Item>;
+
     fn item_ty_poly(&self,
                     span: Span,
                     name: Ident,
@@ -1033,6 +1040,15 @@ impl<'a> AstBuilder for ExtCtxt<'a> {
         self.item(span, name, Vec::new(), ast::ItemStatic(ty, mutbl, expr))
     }
 
+    fn item_const(&self,
+                  span: Span,
+                  name: Ident,
+                  ty: P<ast::Ty>,
+                  expr: P<ast::Expr>)
+                  -> P<ast::Item> {
+        self.item(span, name, Vec::new(), ast::ItemConst(ty, expr))
+    }
+
     fn item_ty_poly(&self, span: Span, name: Ident, ty: P<ast::Ty>,
                     generics: Generics) -> P<ast::Item> {
         self.item(span, name, Vec::new(), ast::ItemTy(ty, generics))
diff --git a/src/libsyntax/ext/bytes.rs b/src/libsyntax/ext/bytes.rs
index 3c9e40d850bac..a93295815e0ed 100644
--- a/src/libsyntax/ext/bytes.rs
+++ b/src/libsyntax/ext/bytes.rs
@@ -104,19 +104,14 @@ pub fn expand_syntax_ext<'cx>(cx: &'cx mut ExtCtxt,
         return DummyResult::expr(sp);
     }
 
-    let e = cx.expr_vec_slice(sp, bytes);
-    let ty = cx.ty(sp, ast::TyVec(cx.ty_ident(sp, cx.ident_of("u8"))));
-    let lifetime = cx.lifetime(sp, cx.ident_of("'static").name);
-    let item = cx.item_static(sp,
-                              cx.ident_of("BYTES"),
-                              cx.ty_rptr(sp,
-                                         ty,
-                                         Some(lifetime),
-                                         ast::MutImmutable),
-                              ast::MutImmutable,
-                              e);
-    let e = cx.expr_block(cx.block(sp,
-                                   vec!(cx.stmt_item(sp, item)),
-                                   Some(cx.expr_ident(sp, cx.ident_of("BYTES")))));
+    let len = bytes.len();
+    let e = cx.expr_vec(sp, bytes);
+    let ty = cx.ty(sp, ast::TyFixedLengthVec(cx.ty_ident(sp, cx.ident_of("u8")),
+                                             cx.expr_uint(sp, len)));
+    let item = cx.item_static(sp, cx.ident_of("BYTES"), ty, ast::MutImmutable, e);
+    let ret = cx.expr_ident(sp, cx.ident_of("BYTES"));
+    let ret = cx.expr_addr_of(sp, ret);
+    let e = cx.expr_block(cx.block(sp, vec![cx.stmt_item(sp, item)],
+                                   Some(ret)));
     MacExpr::new(e)
 }
diff --git a/src/libsyntax/fold.rs b/src/libsyntax/fold.rs
index 84de6c3b91339..32e226361e9d4 100644
--- a/src/libsyntax/fold.rs
+++ b/src/libsyntax/fold.rs
@@ -903,6 +903,9 @@ pub fn noop_fold_item_underscore<T: Folder>(i: Item_, folder: &mut T) -> Item_ {
         ItemStatic(t, m, e) => {
             ItemStatic(folder.fold_ty(t), m, folder.fold_expr(e))
         }
+        ItemConst(t, e) => {
+            ItemConst(folder.fold_ty(t), folder.fold_expr(e))
+        }
         ItemFn(decl, fn_style, abi, generics, body) => {
             ItemFn(
                 folder.fold_fn_decl(decl),
diff --git a/src/libsyntax/parse/parser.rs b/src/libsyntax/parse/parser.rs
index 9bfb593786ef1..e7f40cf072296 100644
--- a/src/libsyntax/parse/parser.rs
+++ b/src/libsyntax/parse/parser.rs
@@ -32,7 +32,7 @@ use ast::{FnUnboxedClosureKind, FnMutUnboxedClosureKind};
 use ast::{FnOnceUnboxedClosureKind};
 use ast::{ForeignItem, ForeignItemStatic, ForeignItemFn, ForeignMod};
 use ast::{Ident, NormalFn, Inherited, ImplItem, Item, Item_, ItemStatic};
-use ast::{ItemEnum, ItemFn, ItemForeignMod, ItemImpl};
+use ast::{ItemEnum, ItemFn, ItemForeignMod, ItemImpl, ItemConst};
 use ast::{ItemMac, ItemMod, ItemStruct, ItemTrait, ItemTy};
 use ast::{LifetimeDef, Lit, Lit_};
 use ast::{LitBool, LitChar, LitByte, LitBinary};
@@ -91,10 +91,10 @@ use std::iter;
 
 bitflags! {
     flags Restrictions: u8 {
-        static UNRESTRICTED                  = 0b0000,
-        static RESTRICTION_STMT_EXPR         = 0b0001,
-        static RESTRICTION_NO_BAR_OP         = 0b0010,
-        static RESTRICTION_NO_STRUCT_LITERAL = 0b0100
+        const UNRESTRICTED                  = 0b0000,
+        const RESTRICTION_STMT_EXPR         = 0b0001,
+        const RESTRICTION_NO_BAR_OP         = 0b0010,
+        const RESTRICTION_NO_STRUCT_LITERAL = 0b0100
     }
 }
 
@@ -4739,14 +4739,18 @@ impl<'a> Parser<'a> {
         }
     }
 
-    fn parse_item_const(&mut self, m: Mutability) -> ItemInfo {
+    fn parse_item_const(&mut self, m: Option<Mutability>) -> ItemInfo {
         let id = self.parse_ident();
         self.expect(&token::COLON);
         let ty = self.parse_ty(true);
         self.expect(&token::EQ);
         let e = self.parse_expr();
         self.commit_expr_expecting(&*e, token::SEMI);
-        (id, ItemStatic(ty, m, e), None)
+        let item = match m {
+            Some(m) => ItemStatic(ty, m, e),
+            None => ItemConst(ty, e),
+        };
+        (id, item, None)
     }
 
     /// Parse a `mod <foo> { ... }` or `mod <foo>;` item
@@ -5296,7 +5300,7 @@ impl<'a> Parser<'a> {
             // STATIC ITEM
             self.bump();
             let m = if self.eat_keyword(keywords::Mut) {MutMutable} else {MutImmutable};
-            let (ident, item_, extra_attrs) = self.parse_item_const(m);
+            let (ident, item_, extra_attrs) = self.parse_item_const(Some(m));
             let last_span = self.last_span;
             let item = self.mk_item(lo,
                                     last_span.hi,
@@ -5314,7 +5318,7 @@ impl<'a> Parser<'a> {
                 self.span_err(last_span, "const globals cannot be mutable, \
                                           did you mean to declare a static?");
             }
-            let (ident, item_, extra_attrs) = self.parse_item_const(MutImmutable);
+            let (ident, item_, extra_attrs) = self.parse_item_const(None);
             let last_span = self.last_span;
             let item = self.mk_item(lo,
                                     last_span.hi,
diff --git a/src/libsyntax/parse/token.rs b/src/libsyntax/parse/token.rs
index 7cc78891d91d1..fa6b0c5ad4ae7 100644
--- a/src/libsyntax/parse/token.rs
+++ b/src/libsyntax/parse/token.rs
@@ -385,13 +385,13 @@ macro_rules! declare_special_idents_and_keywords {(
         use ast::{Ident, Name};
         $(
             #[allow(non_uppercase_statics)]
-            pub static $si_static: Ident = Ident { name: Name($si_name), ctxt: 0 };
+            pub const $si_static: Ident = Ident { name: Name($si_name), ctxt: 0 };
          )*
     }
 
     pub mod special_names {
         use ast::Name;
-        $( #[allow(non_uppercase_statics)] pub static $si_static: Name =  Name($si_name); )*
+        $( #[allow(non_uppercase_statics)] pub const $si_static: Name =  Name($si_name); )*
     }
 
     /**
@@ -432,13 +432,13 @@ macro_rules! declare_special_idents_and_keywords {(
 }}
 
 // If the special idents get renumbered, remember to modify these two as appropriate
-pub static SELF_KEYWORD_NAME: Name = Name(SELF_KEYWORD_NAME_NUM);
-static STATIC_KEYWORD_NAME: Name = Name(STATIC_KEYWORD_NAME_NUM);
-static SUPER_KEYWORD_NAME: Name = Name(SUPER_KEYWORD_NAME_NUM);
+pub const SELF_KEYWORD_NAME: Name = Name(SELF_KEYWORD_NAME_NUM);
+const STATIC_KEYWORD_NAME: Name = Name(STATIC_KEYWORD_NAME_NUM);
+const SUPER_KEYWORD_NAME: Name = Name(SUPER_KEYWORD_NAME_NUM);
 
-pub static SELF_KEYWORD_NAME_NUM: u32 = 1;
-static STATIC_KEYWORD_NAME_NUM: u32 = 2;
-static SUPER_KEYWORD_NAME_NUM: u32 = 3;
+pub const SELF_KEYWORD_NAME_NUM: u32 = 1;
+const STATIC_KEYWORD_NAME_NUM: u32 = 2;
+const SUPER_KEYWORD_NAME_NUM: u32 = 3;
 
 // NB: leaving holes in the ident table is bad! a different ident will get
 // interned with the id from the hole, but it will be between the min and max
diff --git a/src/libsyntax/print/pprust.rs b/src/libsyntax/print/pprust.rs
index c3a3848019a5d..e1a2b2aeefeea 100644
--- a/src/libsyntax/print/pprust.rs
+++ b/src/libsyntax/print/pprust.rs
@@ -90,10 +90,10 @@ pub fn rust_printer_annotated<'a>(writer: Box<io::Writer+'static>,
 }
 
 #[allow(non_uppercase_statics)]
-pub static indent_unit: uint = 4u;
+pub const indent_unit: uint = 4u;
 
 #[allow(non_uppercase_statics)]
-pub static default_columns: uint = 78u;
+pub const default_columns: uint = 78u;
 
 /// Requires you to pass an input filename and reader so that
 /// it can scan the input text for comments and literals to
@@ -757,6 +757,20 @@ impl<'a> State<'a> {
                 try!(word(&mut self.s, ";"));
                 try!(self.end()); // end the outer cbox
             }
+            ast::ItemConst(ref ty, ref expr) => {
+                try!(self.head(visibility_qualified(item.vis,
+                                                    "const").as_slice()));
+                try!(self.print_ident(item.ident));
+                try!(self.word_space(":"));
+                try!(self.print_type(&**ty));
+                try!(space(&mut self.s));
+                try!(self.end()); // end the head-ibox
+
+                try!(self.word_space("="));
+                try!(self.print_expr(&**expr));
+                try!(word(&mut self.s, ";"));
+                try!(self.end()); // end the outer cbox
+            }
             ast::ItemFn(ref decl, fn_style, abi, ref typarams, ref body) => {
                 try!(self.print_fn(
                     &**decl,
diff --git a/src/libsyntax/test.rs b/src/libsyntax/test.rs
index 3f5b524a9b5b2..9fb5742bb9b15 100644
--- a/src/libsyntax/test.rs
+++ b/src/libsyntax/test.rs
@@ -493,11 +493,10 @@ fn mk_tests(cx: &TestCtxt) -> P<ast::Item> {
                                   Some(static_lt),
                                   ast::MutImmutable);
     // static TESTS: $static_type = &[...];
-    ecx.item_static(sp,
-                    ecx.ident_of("TESTS"),
-                    static_type,
-                    ast::MutImmutable,
-                    test_descs)
+    ecx.item_const(sp,
+                   ecx.ident_of("TESTS"),
+                   static_type,
+                   test_descs)
 }
 
 fn is_test_crate(krate: &ast::Crate) -> bool {
diff --git a/src/libsyntax/visit.rs b/src/libsyntax/visit.rs
index 249f87d3102dd..5c7b144f4ab6e 100644
--- a/src/libsyntax/visit.rs
+++ b/src/libsyntax/visit.rs
@@ -211,7 +211,8 @@ pub fn walk_trait_ref_helper<'v,V>(visitor: &mut V, trait_ref: &'v TraitRef)
 pub fn walk_item<'v, V: Visitor<'v>>(visitor: &mut V, item: &'v Item) {
     visitor.visit_ident(item.span, item.ident);
     match item.node {
-        ItemStatic(ref typ, _, ref expr) => {
+        ItemStatic(ref typ, _, ref expr) |
+        ItemConst(ref typ, ref expr) => {
             visitor.visit_ty(&**typ);
             visitor.visit_expr(&**expr);
         }
diff --git a/src/libterm/lib.rs b/src/libterm/lib.rs
index b05e0a4bff398..6a62484f55b4f 100644
--- a/src/libterm/lib.rs
+++ b/src/libterm/lib.rs
@@ -155,23 +155,23 @@ pub mod color {
     /// Number for a terminal color
     pub type Color = u16;
 
-    pub static BLACK:   Color = 0u16;
-    pub static RED:     Color = 1u16;
-    pub static GREEN:   Color = 2u16;
-    pub static YELLOW:  Color = 3u16;
-    pub static BLUE:    Color = 4u16;
-    pub static MAGENTA: Color = 5u16;
-    pub static CYAN:    Color = 6u16;
-    pub static WHITE:   Color = 7u16;
-
-    pub static BRIGHT_BLACK:   Color = 8u16;
-    pub static BRIGHT_RED:     Color = 9u16;
-    pub static BRIGHT_GREEN:   Color = 10u16;
-    pub static BRIGHT_YELLOW:  Color = 11u16;
-    pub static BRIGHT_BLUE:    Color = 12u16;
-    pub static BRIGHT_MAGENTA: Color = 13u16;
-    pub static BRIGHT_CYAN:    Color = 14u16;
-    pub static BRIGHT_WHITE:   Color = 15u16;
+    pub const BLACK:   Color = 0u16;
+    pub const RED:     Color = 1u16;
+    pub const GREEN:   Color = 2u16;
+    pub const YELLOW:  Color = 3u16;
+    pub const BLUE:    Color = 4u16;
+    pub const MAGENTA: Color = 5u16;
+    pub const CYAN:    Color = 6u16;
+    pub const WHITE:   Color = 7u16;
+
+    pub const BRIGHT_BLACK:   Color = 8u16;
+    pub const BRIGHT_RED:     Color = 9u16;
+    pub const BRIGHT_GREEN:   Color = 10u16;
+    pub const BRIGHT_YELLOW:  Color = 11u16;
+    pub const BRIGHT_BLUE:    Color = 12u16;
+    pub const BRIGHT_MAGENTA: Color = 13u16;
+    pub const BRIGHT_CYAN:    Color = 14u16;
+    pub const BRIGHT_WHITE:   Color = 15u16;
 }
 
 /// Terminal attributes
diff --git a/src/libunicode/normalize.rs b/src/libunicode/normalize.rs
index a60e95c38272b..76a9476d1fc8d 100644
--- a/src/libunicode/normalize.rs
+++ b/src/libunicode/normalize.rs
@@ -100,15 +100,15 @@ pub fn compose(a: char, b: char) -> Option<char> {
 }
 
 // Constants from Unicode 6.3.0 Section 3.12 Conjoining Jamo Behavior
-static S_BASE: u32 = 0xAC00;
-static L_BASE: u32 = 0x1100;
-static V_BASE: u32 = 0x1161;
-static T_BASE: u32 = 0x11A7;
-static L_COUNT: u32 = 19;
-static V_COUNT: u32 = 21;
-static T_COUNT: u32 = 28;
-static N_COUNT: u32 = (V_COUNT * T_COUNT);
-static S_COUNT: u32 = (L_COUNT * N_COUNT);
+const S_BASE: u32 = 0xAC00;
+const L_BASE: u32 = 0x1100;
+const V_BASE: u32 = 0x1161;
+const T_BASE: u32 = 0x11A7;
+const L_COUNT: u32 = 19;
+const V_COUNT: u32 = 21;
+const T_COUNT: u32 = 28;
+const N_COUNT: u32 = (V_COUNT * T_COUNT);
+const S_COUNT: u32 = (L_COUNT * N_COUNT);
 
 // Decompose a precomposed Hangul syllable
 #[inline(always)]
diff --git a/src/libunicode/tables.rs b/src/libunicode/tables.rs
index 135b267262cc6..e359883295f42 100644
--- a/src/libunicode/tables.rs
+++ b/src/libunicode/tables.rs
@@ -3636,108 +3636,109 @@ pub mod property {
 }
 
 pub mod regex {
-    pub static UNICODE_CLASSES: &'static [(&'static str, &'static [(char, char)])] = &[
-        ("Alphabetic", super::derived_property::Alphabetic_table), ("Arabic",
-        super::script::Arabic_table), ("Armenian", super::script::Armenian_table), ("Avestan",
-        super::script::Avestan_table), ("Balinese", super::script::Balinese_table), ("Bamum",
-        super::script::Bamum_table), ("Bassa_Vah", super::script::Bassa_Vah_table), ("Batak",
-        super::script::Batak_table), ("Bengali", super::script::Bengali_table), ("Bopomofo",
-        super::script::Bopomofo_table), ("Brahmi", super::script::Brahmi_table), ("Braille",
-        super::script::Braille_table), ("Buginese", super::script::Buginese_table), ("Buhid",
-        super::script::Buhid_table), ("C", super::general_category::C_table),
-        ("Canadian_Aboriginal", super::script::Canadian_Aboriginal_table), ("Carian",
-        super::script::Carian_table), ("Caucasian_Albanian",
-        super::script::Caucasian_Albanian_table), ("Cc", super::general_category::Cc_table), ("Cf",
-        super::general_category::Cf_table), ("Chakma", super::script::Chakma_table), ("Cham",
-        super::script::Cham_table), ("Cherokee", super::script::Cherokee_table), ("Cn",
-        super::general_category::Cn_table), ("Co", super::general_category::Co_table), ("Common",
-        super::script::Common_table), ("Coptic", super::script::Coptic_table), ("Cuneiform",
-        super::script::Cuneiform_table), ("Cypriot", super::script::Cypriot_table), ("Cyrillic",
-        super::script::Cyrillic_table), ("Default_Ignorable_Code_Point",
-        super::derived_property::Default_Ignorable_Code_Point_table), ("Deseret",
-        super::script::Deseret_table), ("Devanagari", super::script::Devanagari_table), ("Duployan",
-        super::script::Duployan_table), ("Egyptian_Hieroglyphs",
-        super::script::Egyptian_Hieroglyphs_table), ("Elbasan", super::script::Elbasan_table),
-        ("Ethiopic", super::script::Ethiopic_table), ("Georgian", super::script::Georgian_table),
-        ("Glagolitic", super::script::Glagolitic_table), ("Gothic", super::script::Gothic_table),
-        ("Grantha", super::script::Grantha_table), ("Greek", super::script::Greek_table),
-        ("Gujarati", super::script::Gujarati_table), ("Gurmukhi", super::script::Gurmukhi_table),
-        ("Han", super::script::Han_table), ("Hangul", super::script::Hangul_table), ("Hanunoo",
-        super::script::Hanunoo_table), ("Hebrew", super::script::Hebrew_table), ("Hiragana",
-        super::script::Hiragana_table), ("Imperial_Aramaic", super::script::Imperial_Aramaic_table),
-        ("Inherited", super::script::Inherited_table), ("Inscriptional_Pahlavi",
-        super::script::Inscriptional_Pahlavi_table), ("Inscriptional_Parthian",
-        super::script::Inscriptional_Parthian_table), ("Javanese", super::script::Javanese_table),
-        ("Join_Control", super::property::Join_Control_table), ("Kaithi",
-        super::script::Kaithi_table), ("Kannada", super::script::Kannada_table), ("Katakana",
-        super::script::Katakana_table), ("Kayah_Li", super::script::Kayah_Li_table), ("Kharoshthi",
-        super::script::Kharoshthi_table), ("Khmer", super::script::Khmer_table), ("Khojki",
-        super::script::Khojki_table), ("Khudawadi", super::script::Khudawadi_table), ("L",
-        super::general_category::L_table), ("LC", super::general_category::LC_table), ("Lao",
-        super::script::Lao_table), ("Latin", super::script::Latin_table), ("Lepcha",
-        super::script::Lepcha_table), ("Limbu", super::script::Limbu_table), ("Linear_A",
-        super::script::Linear_A_table), ("Linear_B", super::script::Linear_B_table), ("Lisu",
-        super::script::Lisu_table), ("Ll", super::general_category::Ll_table), ("Lm",
-        super::general_category::Lm_table), ("Lo", super::general_category::Lo_table), ("Lowercase",
-        super::derived_property::Lowercase_table), ("Lt", super::general_category::Lt_table), ("Lu",
-        super::general_category::Lu_table), ("Lycian", super::script::Lycian_table), ("Lydian",
-        super::script::Lydian_table), ("M", super::general_category::M_table), ("Mahajani",
-        super::script::Mahajani_table), ("Malayalam", super::script::Malayalam_table), ("Mandaic",
-        super::script::Mandaic_table), ("Manichaean", super::script::Manichaean_table), ("Mc",
-        super::general_category::Mc_table), ("Me", super::general_category::Me_table),
-        ("Meetei_Mayek", super::script::Meetei_Mayek_table), ("Mende_Kikakui",
-        super::script::Mende_Kikakui_table), ("Meroitic_Cursive",
-        super::script::Meroitic_Cursive_table), ("Meroitic_Hieroglyphs",
-        super::script::Meroitic_Hieroglyphs_table), ("Miao", super::script::Miao_table), ("Mn",
-        super::general_category::Mn_table), ("Modi", super::script::Modi_table), ("Mongolian",
-        super::script::Mongolian_table), ("Mro", super::script::Mro_table), ("Myanmar",
-        super::script::Myanmar_table), ("N", super::general_category::N_table), ("Nabataean",
-        super::script::Nabataean_table), ("Nd", super::general_category::Nd_table), ("New_Tai_Lue",
-        super::script::New_Tai_Lue_table), ("Nko", super::script::Nko_table), ("Nl",
-        super::general_category::Nl_table), ("No", super::general_category::No_table),
-        ("Noncharacter_Code_Point", super::property::Noncharacter_Code_Point_table), ("Ogham",
-        super::script::Ogham_table), ("Ol_Chiki", super::script::Ol_Chiki_table), ("Old_Italic",
-        super::script::Old_Italic_table), ("Old_North_Arabian",
-        super::script::Old_North_Arabian_table), ("Old_Permic", super::script::Old_Permic_table),
-        ("Old_Persian", super::script::Old_Persian_table), ("Old_South_Arabian",
-        super::script::Old_South_Arabian_table), ("Old_Turkic", super::script::Old_Turkic_table),
-        ("Oriya", super::script::Oriya_table), ("Osmanya", super::script::Osmanya_table), ("P",
-        super::general_category::P_table), ("Pahawh_Hmong", super::script::Pahawh_Hmong_table),
-        ("Palmyrene", super::script::Palmyrene_table), ("Pau_Cin_Hau",
-        super::script::Pau_Cin_Hau_table), ("Pc", super::general_category::Pc_table), ("Pd",
-        super::general_category::Pd_table), ("Pe", super::general_category::Pe_table), ("Pf",
-        super::general_category::Pf_table), ("Phags_Pa", super::script::Phags_Pa_table),
-        ("Phoenician", super::script::Phoenician_table), ("Pi", super::general_category::Pi_table),
-        ("Po", super::general_category::Po_table), ("Ps", super::general_category::Ps_table),
-        ("Psalter_Pahlavi", super::script::Psalter_Pahlavi_table), ("Rejang",
-        super::script::Rejang_table), ("Runic", super::script::Runic_table), ("S",
-        super::general_category::S_table), ("Samaritan", super::script::Samaritan_table),
-        ("Saurashtra", super::script::Saurashtra_table), ("Sc", super::general_category::Sc_table),
-        ("Sharada", super::script::Sharada_table), ("Shavian", super::script::Shavian_table),
-        ("Siddham", super::script::Siddham_table), ("Sinhala", super::script::Sinhala_table), ("Sk",
-        super::general_category::Sk_table), ("Sm", super::general_category::Sm_table), ("So",
-        super::general_category::So_table), ("Sora_Sompeng", super::script::Sora_Sompeng_table),
-        ("Sundanese", super::script::Sundanese_table), ("Syloti_Nagri",
-        super::script::Syloti_Nagri_table), ("Syriac", super::script::Syriac_table), ("Tagalog",
-        super::script::Tagalog_table), ("Tagbanwa", super::script::Tagbanwa_table), ("Tai_Le",
-        super::script::Tai_Le_table), ("Tai_Tham", super::script::Tai_Tham_table), ("Tai_Viet",
-        super::script::Tai_Viet_table), ("Takri", super::script::Takri_table), ("Tamil",
-        super::script::Tamil_table), ("Telugu", super::script::Telugu_table), ("Thaana",
-        super::script::Thaana_table), ("Thai", super::script::Thai_table), ("Tibetan",
-        super::script::Tibetan_table), ("Tifinagh", super::script::Tifinagh_table), ("Tirhuta",
-        super::script::Tirhuta_table), ("Ugaritic", super::script::Ugaritic_table), ("Uppercase",
-        super::derived_property::Uppercase_table), ("Vai", super::script::Vai_table),
-        ("Warang_Citi", super::script::Warang_Citi_table), ("White_Space",
-        super::property::White_Space_table), ("XID_Continue",
-        super::derived_property::XID_Continue_table), ("XID_Start",
-        super::derived_property::XID_Start_table), ("Yi", super::script::Yi_table), ("Z",
-        super::general_category::Z_table), ("Zl", super::general_category::Zl_table), ("Zp",
-        super::general_category::Zp_table), ("Zs", super::general_category::Zs_table)
-    ];
-
-    pub static PERLD: &'static [(char, char)] = super::general_category::Nd_table;
-
-    pub static PERLS: &'static [(char, char)] = super::property::White_Space_table;
+    pub static UNICODE_CLASSES: &'static [(&'static str, &'static &'static [(char, char)])] = &[
+        ("Alphabetic", &super::derived_property::Alphabetic_table), ("Arabic",
+        &super::script::Arabic_table), ("Armenian", &super::script::Armenian_table), ("Avestan",
+        &super::script::Avestan_table), ("Balinese", &super::script::Balinese_table), ("Bamum",
+        &super::script::Bamum_table), ("Bassa_Vah", &super::script::Bassa_Vah_table), ("Batak",
+        &super::script::Batak_table), ("Bengali", &super::script::Bengali_table), ("Bopomofo",
+        &super::script::Bopomofo_table), ("Brahmi", &super::script::Brahmi_table), ("Braille",
+        &super::script::Braille_table), ("Buginese", &super::script::Buginese_table), ("Buhid",
+        &super::script::Buhid_table), ("C", &super::general_category::C_table),
+        ("Canadian_Aboriginal", &super::script::Canadian_Aboriginal_table), ("Carian",
+        &super::script::Carian_table), ("Caucasian_Albanian",
+        &super::script::Caucasian_Albanian_table), ("Cc", &super::general_category::Cc_table),
+        ("Cf", &super::general_category::Cf_table), ("Chakma", &super::script::Chakma_table),
+        ("Cham", &super::script::Cham_table), ("Cherokee", &super::script::Cherokee_table), ("Cn",
+        &super::general_category::Cn_table), ("Co", &super::general_category::Co_table), ("Common",
+        &super::script::Common_table), ("Coptic", &super::script::Coptic_table), ("Cuneiform",
+        &super::script::Cuneiform_table), ("Cypriot", &super::script::Cypriot_table), ("Cyrillic",
+        &super::script::Cyrillic_table), ("Default_Ignorable_Code_Point",
+        &super::derived_property::Default_Ignorable_Code_Point_table), ("Deseret",
+        &super::script::Deseret_table), ("Devanagari", &super::script::Devanagari_table),
+        ("Duployan", &super::script::Duployan_table), ("Egyptian_Hieroglyphs",
+        &super::script::Egyptian_Hieroglyphs_table), ("Elbasan", &super::script::Elbasan_table),
+        ("Ethiopic", &super::script::Ethiopic_table), ("Georgian", &super::script::Georgian_table),
+        ("Glagolitic", &super::script::Glagolitic_table), ("Gothic", &super::script::Gothic_table),
+        ("Grantha", &super::script::Grantha_table), ("Greek", &super::script::Greek_table),
+        ("Gujarati", &super::script::Gujarati_table), ("Gurmukhi", &super::script::Gurmukhi_table),
+        ("Han", &super::script::Han_table), ("Hangul", &super::script::Hangul_table), ("Hanunoo",
+        &super::script::Hanunoo_table), ("Hebrew", &super::script::Hebrew_table), ("Hiragana",
+        &super::script::Hiragana_table), ("Imperial_Aramaic",
+        &super::script::Imperial_Aramaic_table), ("Inherited", &super::script::Inherited_table),
+        ("Inscriptional_Pahlavi", &super::script::Inscriptional_Pahlavi_table),
+        ("Inscriptional_Parthian", &super::script::Inscriptional_Parthian_table), ("Javanese",
+        &super::script::Javanese_table), ("Join_Control", &super::property::Join_Control_table),
+        ("Kaithi", &super::script::Kaithi_table), ("Kannada", &super::script::Kannada_table),
+        ("Katakana", &super::script::Katakana_table), ("Kayah_Li", &super::script::Kayah_Li_table),
+        ("Kharoshthi", &super::script::Kharoshthi_table), ("Khmer", &super::script::Khmer_table),
+        ("Khojki", &super::script::Khojki_table), ("Khudawadi", &super::script::Khudawadi_table),
+        ("L", &super::general_category::L_table), ("LC", &super::general_category::LC_table),
+        ("Lao", &super::script::Lao_table), ("Latin", &super::script::Latin_table), ("Lepcha",
+        &super::script::Lepcha_table), ("Limbu", &super::script::Limbu_table), ("Linear_A",
+        &super::script::Linear_A_table), ("Linear_B", &super::script::Linear_B_table), ("Lisu",
+        &super::script::Lisu_table), ("Ll", &super::general_category::Ll_table), ("Lm",
+        &super::general_category::Lm_table), ("Lo", &super::general_category::Lo_table),
+        ("Lowercase", &super::derived_property::Lowercase_table), ("Lt",
+        &super::general_category::Lt_table), ("Lu", &super::general_category::Lu_table), ("Lycian",
+        &super::script::Lycian_table), ("Lydian", &super::script::Lydian_table), ("M",
+        &super::general_category::M_table), ("Mahajani", &super::script::Mahajani_table),
+        ("Malayalam", &super::script::Malayalam_table), ("Mandaic", &super::script::Mandaic_table),
+        ("Manichaean", &super::script::Manichaean_table), ("Mc",
+        &super::general_category::Mc_table), ("Me", &super::general_category::Me_table),
+        ("Meetei_Mayek", &super::script::Meetei_Mayek_table), ("Mende_Kikakui",
+        &super::script::Mende_Kikakui_table), ("Meroitic_Cursive",
+        &super::script::Meroitic_Cursive_table), ("Meroitic_Hieroglyphs",
+        &super::script::Meroitic_Hieroglyphs_table), ("Miao", &super::script::Miao_table), ("Mn",
+        &super::general_category::Mn_table), ("Modi", &super::script::Modi_table), ("Mongolian",
+        &super::script::Mongolian_table), ("Mro", &super::script::Mro_table), ("Myanmar",
+        &super::script::Myanmar_table), ("N", &super::general_category::N_table), ("Nabataean",
+        &super::script::Nabataean_table), ("Nd", &super::general_category::Nd_table),
+        ("New_Tai_Lue", &super::script::New_Tai_Lue_table), ("Nko", &super::script::Nko_table),
+        ("Nl", &super::general_category::Nl_table), ("No", &super::general_category::No_table),
+        ("Noncharacter_Code_Point", &super::property::Noncharacter_Code_Point_table), ("Ogham",
+        &super::script::Ogham_table), ("Ol_Chiki", &super::script::Ol_Chiki_table), ("Old_Italic",
+        &super::script::Old_Italic_table), ("Old_North_Arabian",
+        &super::script::Old_North_Arabian_table), ("Old_Permic", &super::script::Old_Permic_table),
+        ("Old_Persian", &super::script::Old_Persian_table), ("Old_South_Arabian",
+        &super::script::Old_South_Arabian_table), ("Old_Turkic", &super::script::Old_Turkic_table),
+        ("Oriya", &super::script::Oriya_table), ("Osmanya", &super::script::Osmanya_table), ("P",
+        &super::general_category::P_table), ("Pahawh_Hmong", &super::script::Pahawh_Hmong_table),
+        ("Palmyrene", &super::script::Palmyrene_table), ("Pau_Cin_Hau",
+        &super::script::Pau_Cin_Hau_table), ("Pc", &super::general_category::Pc_table), ("Pd",
+        &super::general_category::Pd_table), ("Pe", &super::general_category::Pe_table), ("Pf",
+        &super::general_category::Pf_table), ("Phags_Pa", &super::script::Phags_Pa_table),
+        ("Phoenician", &super::script::Phoenician_table), ("Pi",
+        &super::general_category::Pi_table), ("Po", &super::general_category::Po_table), ("Ps",
+        &super::general_category::Ps_table), ("Psalter_Pahlavi",
+        &super::script::Psalter_Pahlavi_table), ("Rejang", &super::script::Rejang_table), ("Runic",
+        &super::script::Runic_table), ("S", &super::general_category::S_table), ("Samaritan",
+        &super::script::Samaritan_table), ("Saurashtra", &super::script::Saurashtra_table), ("Sc",
+        &super::general_category::Sc_table), ("Sharada", &super::script::Sharada_table), ("Shavian",
+        &super::script::Shavian_table), ("Siddham", &super::script::Siddham_table), ("Sinhala",
+        &super::script::Sinhala_table), ("Sk", &super::general_category::Sk_table), ("Sm",
+        &super::general_category::Sm_table), ("So", &super::general_category::So_table),
+        ("Sora_Sompeng", &super::script::Sora_Sompeng_table), ("Sundanese",
+        &super::script::Sundanese_table), ("Syloti_Nagri", &super::script::Syloti_Nagri_table),
+        ("Syriac", &super::script::Syriac_table), ("Tagalog", &super::script::Tagalog_table),
+        ("Tagbanwa", &super::script::Tagbanwa_table), ("Tai_Le", &super::script::Tai_Le_table),
+        ("Tai_Tham", &super::script::Tai_Tham_table), ("Tai_Viet", &super::script::Tai_Viet_table),
+        ("Takri", &super::script::Takri_table), ("Tamil", &super::script::Tamil_table), ("Telugu",
+        &super::script::Telugu_table), ("Thaana", &super::script::Thaana_table), ("Thai",
+        &super::script::Thai_table), ("Tibetan", &super::script::Tibetan_table), ("Tifinagh",
+        &super::script::Tifinagh_table), ("Tirhuta", &super::script::Tirhuta_table), ("Ugaritic",
+        &super::script::Ugaritic_table), ("Uppercase", &super::derived_property::Uppercase_table),
+        ("Vai", &super::script::Vai_table), ("Warang_Citi", &super::script::Warang_Citi_table),
+        ("White_Space", &super::property::White_Space_table), ("XID_Continue",
+        &super::derived_property::XID_Continue_table), ("XID_Start",
+        &super::derived_property::XID_Start_table), ("Yi", &super::script::Yi_table), ("Z",
+        &super::general_category::Z_table), ("Zl", &super::general_category::Zl_table), ("Zp",
+        &super::general_category::Zp_table), ("Zs", &super::general_category::Zs_table)
+    ];
+
+    pub static PERLD: &'static &'static [(char, char)] = &super::general_category::Nd_table;
+
+    pub static PERLS: &'static &'static [(char, char)] = &super::property::White_Space_table;
 
     pub static PERLW: &'static [(char, char)] = &[
         ('\x30', '\x39'), ('\x41', '\x5a'), ('\x5f', '\x5f'), ('\x61', '\x7a'), ('\xaa', '\xaa'),
diff --git a/src/test/auxiliary/cci_const.rs b/src/test/auxiliary/cci_const.rs
index 17029b9d3778a..945004ede6de8 100644
--- a/src/test/auxiliary/cci_const.rs
+++ b/src/test/auxiliary/cci_const.rs
@@ -11,6 +11,6 @@
 pub extern fn bar() {
 }
 
-pub static foopy: &'static str = "hi there";
-pub static uint_val: uint = 12;
-pub static uint_expr: uint = (1 << uint_val) - 1;
+pub const foopy: &'static str = "hi there";
+pub const uint_val: uint = 12;
+pub const uint_expr: uint = (1 << uint_val) - 1;
diff --git a/src/test/auxiliary/iss.rs b/src/test/auxiliary/iss.rs
index 75728c075d1eb..3a9d76406e10a 100644
--- a/src/test/auxiliary/iss.rs
+++ b/src/test/auxiliary/iss.rs
@@ -17,7 +17,7 @@ pub struct C<'a> {
 }
 
 fn no_op() { }
-pub static D : C<'static> = C {
+pub const D : C<'static> = C {
     k: no_op
 };
 
diff --git a/src/test/auxiliary/issue-13620-1.rs b/src/test/auxiliary/issue-13620-1.rs
index ddd1012017f78..e373421fabfac 100644
--- a/src/test/auxiliary/issue-13620-1.rs
+++ b/src/test/auxiliary/issue-13620-1.rs
@@ -14,6 +14,6 @@ pub struct Foo {
 
 extern fn the_foo() {}
 
-pub static FOO: Foo = Foo {
+pub const FOO: Foo = Foo {
     foo: the_foo
 };
diff --git a/src/test/auxiliary/issue-17718-const-privacy.rs b/src/test/auxiliary/issue-17718-const-privacy.rs
new file mode 100644
index 0000000000000..3657d39ff77e4
--- /dev/null
+++ b/src/test/auxiliary/issue-17718-const-privacy.rs
@@ -0,0 +1,18 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+pub use foo::FOO2;
+
+pub const FOO: uint = 3;
+const BAR: uint = 3;
+
+mod foo {
+    pub const FOO2: uint = 3;
+}
diff --git a/src/test/auxiliary/issue-17718.rs b/src/test/auxiliary/issue-17718.rs
new file mode 100644
index 0000000000000..f0b431b1db932
--- /dev/null
+++ b/src/test/auxiliary/issue-17718.rs
@@ -0,0 +1,22 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::sync::atomic;
+
+pub const C1: uint = 1;
+pub const C2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+pub const C3: fn() = foo;
+pub const C4: uint = C1 * C1 + C1 / C1;
+pub const C5: &'static uint = &C4;
+
+pub static S1: uint = 3;
+pub static S2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+
+fn foo() {}
diff --git a/src/test/auxiliary/issue13213aux.rs b/src/test/auxiliary/issue13213aux.rs
index ad8c823b99179..5bd52ef501068 100644
--- a/src/test/auxiliary/issue13213aux.rs
+++ b/src/test/auxiliary/issue13213aux.rs
@@ -21,7 +21,7 @@ mod private {
     pub struct P {
         p: i32,
     }
-    pub static THREE: P = P { p: 3 };
+    pub const THREE: P = P { p: 3 };
 }
 
 pub static A: S = S { p: private::THREE };
diff --git a/src/test/bench/shootout-fasta-redux.rs b/src/test/bench/shootout-fasta-redux.rs
index b8af76ce17cec..e151369ff38ac 100644
--- a/src/test/bench/shootout-fasta-redux.rs
+++ b/src/test/bench/shootout-fasta-redux.rs
@@ -45,16 +45,16 @@ use std::io::{stdout, IoResult};
 use std::os;
 use std::slice::bytes::copy_memory;
 
-static LINE_LEN: uint = 60;
-static LOOKUP_SIZE: uint = 4 * 1024;
-static LOOKUP_SCALE: f32 = (LOOKUP_SIZE - 1) as f32;
+const LINE_LEN: uint = 60;
+const LOOKUP_SIZE: uint = 4 * 1024;
+const LOOKUP_SCALE: f32 = (LOOKUP_SIZE - 1) as f32;
 
 // Random number generator constants
-static IM: u32 = 139968;
-static IA: u32 = 3877;
-static IC: u32 = 29573;
+const IM: u32 = 139968;
+const IA: u32 = 3877;
+const IC: u32 = 29573;
 
-static ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
+const ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
                             GGAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGA\
                             GACCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAA\
                             AATACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAAT\
@@ -62,7 +62,7 @@ static ALU: &'static str = "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTG\
                             CCGGGAGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTG\
                             CACTCCAGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
 
-static NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 };
+const NULL_AMINO_ACID: AminoAcid = AminoAcid { c: ' ' as u8, p: 0.0 };
 
 static IUB: [AminoAcid, ..15] = [
     AminoAcid { c: 'a' as u8, p: 0.27 },
diff --git a/src/test/bench/shootout-fasta.rs b/src/test/bench/shootout-fasta.rs
index 7565525bc8cc0..77311edba4e7a 100644
--- a/src/test/bench/shootout-fasta.rs
+++ b/src/test/bench/shootout-fasta.rs
@@ -45,8 +45,8 @@ use std::io::{BufferedWriter, File};
 use std::cmp::min;
 use std::os;
 
-static LINE_LENGTH: uint = 60;
-static IM: u32 = 139968;
+const LINE_LENGTH: uint = 60;
+const IM: u32 = 139968;
 
 struct MyRandom {
     last: u32
diff --git a/src/test/bench/shootout-mandelbrot.rs b/src/test/bench/shootout-mandelbrot.rs
index 28db9ed14a77b..66fe52d9ec7ed 100644
--- a/src/test/bench/shootout-mandelbrot.rs
+++ b/src/test/bench/shootout-mandelbrot.rs
@@ -49,9 +49,9 @@ use std::os;
 use std::simd::f64x2;
 use std::sync::{Arc, Future};
 
-static ITER: int = 50;
-static LIMIT: f64 = 2.0;
-static WORKERS: uint = 16;
+const ITER: int = 50;
+const LIMIT: f64 = 2.0;
+const WORKERS: uint = 16;
 
 #[inline(always)]
 fn mandelbrot<W: io::Writer>(w: uint, mut out: W) -> io::IoResult<()> {
@@ -144,7 +144,7 @@ fn mandelbrot<W: io::Writer>(w: uint, mut out: W) -> io::IoResult<()> {
 fn write_line(init_i: f64, vec_init_r: &[f64], res: &mut Vec<u8>) {
     let v_init_i : f64x2 = f64x2(init_i, init_i);
     let v_2 : f64x2 = f64x2(2.0, 2.0);
-    static LIMIT_SQUARED: f64 = LIMIT * LIMIT;
+    const LIMIT_SQUARED: f64 = LIMIT * LIMIT;
 
     for chunk_init_r in vec_init_r.chunks(8) {
         let mut cur_byte = 0xff;
diff --git a/src/test/bench/shootout-nbody.rs b/src/test/bench/shootout-nbody.rs
index 6a39d2fdbb1a3..a945e0f7796d1 100644
--- a/src/test/bench/shootout-nbody.rs
+++ b/src/test/bench/shootout-nbody.rs
@@ -38,10 +38,10 @@
 // ARISING IN ANY WAY OUT OF THE USE OF THIS SOFTWARE, EVEN IF ADVISED
 // OF THE POSSIBILITY OF SUCH DAMAGE.
 
-static PI: f64 = 3.141592653589793;
-static SOLAR_MASS: f64 = 4.0 * PI * PI;
-static YEAR: f64 = 365.24;
-static N_BODIES: uint = 5;
+const PI: f64 = 3.141592653589793;
+const SOLAR_MASS: f64 = 4.0 * PI * PI;
+const YEAR: f64 = 365.24;
+const N_BODIES: uint = 5;
 
 static BODIES: [Planet, ..N_BODIES] = [
     // Sun
diff --git a/src/test/compile-fail/check-static-immutable-mut-slices.rs b/src/test/compile-fail/check-static-immutable-mut-slices.rs
index 73ce488cbc669..2945a05024792 100644
--- a/src/test/compile-fail/check-static-immutable-mut-slices.rs
+++ b/src/test/compile-fail/check-static-immutable-mut-slices.rs
@@ -11,6 +11,6 @@
 // Checks that immutable static items can't have mutable slices
 
 static TEST: &'static mut [int] = &mut [];
-//~^ ERROR static items are not allowed to have mutable slices
+//~^ ERROR statics are not allowed to have mutable references
 
 pub fn main() { }
diff --git a/src/test/compile-fail/check-static-values-constraints.rs b/src/test/compile-fail/check-static-values-constraints.rs
index e29be22ca9acc..d23aa317247c0 100644
--- a/src/test/compile-fail/check-static-values-constraints.rs
+++ b/src/test/compile-fail/check-static-values-constraints.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-// Verifies all possible restrictions for static items values.
+// Verifies all possible restrictions for statics values.
 
 use std::kinds::marker;
 
@@ -21,7 +21,7 @@ impl Drop for WithDtor {
 // This enum will be used to test the following rules:
 // 1. Variants are safe for static
 // 2. Expr calls are allowed as long as they arguments are safe
-// 3. Expr calls with unsafe arguments for static items are rejected
+// 3. Expr calls with unsafe arguments for statics are rejected
 enum SafeEnum {
     Variant1,
     Variant2(int),
@@ -35,7 +35,7 @@ static STATIC2: SafeEnum = Variant2(0);
 
 // This one should fail
 static STATIC3: SafeEnum = Variant3(WithDtor);
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 
 // This enum will be used to test that variants
@@ -52,9 +52,9 @@ impl Drop for UnsafeEnum {
 
 
 static STATIC4: UnsafeEnum = Variant5;
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 static STATIC5: UnsafeEnum = Variant6(0);
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 
 struct SafeStruct {
@@ -68,7 +68,7 @@ static STATIC6: SafeStruct = SafeStruct{field1: Variant1, field2: Variant2(0)};
 
 // field2 has an unsafe value, hence this should fail
 static STATIC7: SafeStruct = SafeStruct{field1: Variant1, field2: Variant3(WithDtor)};
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 // Test variadic constructor for structs. The base struct should be examined
 // as well as every field present in the constructor.
@@ -79,7 +79,7 @@ static STATIC8: SafeStruct = SafeStruct{field1: Variant1,
 // This example should fail because field1 in the base struct is not safe
 static STATIC9: SafeStruct = SafeStruct{field1: Variant1,
                                         ..SafeStruct{field1: Variant3(WithDtor), field2: Variant1}};
-//~^ ERROR static items are not allowed to have destructors
+//~^ ERROR statics are not allowed to have destructors
 
 struct UnsafeStruct;
 
@@ -89,44 +89,48 @@ impl Drop for UnsafeStruct {
 
 // Types with destructors are not allowed for statics
 static STATIC10: UnsafeStruct = UnsafeStruct;
-//~^ ERROR static items are not allowed to have destructor
+//~^ ERROR statics are not allowed to have destructor
 
 struct MyOwned;
 
 static STATIC11: Box<MyOwned> = box MyOwned;
-//~^ ERROR static items are not allowed to have custom pointers
+//~^ ERROR statics are not allowed to have custom pointers
 
 // The following examples test that mutable structs are just forbidden
 // to have types with destructors
 // These should fail
 static mut STATIC12: UnsafeStruct = UnsafeStruct;
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
+//~^^ ERROR statics are not allowed to have destructors
 
 static mut STATIC13: SafeStruct = SafeStruct{field1: Variant1, field2: Variant3(WithDtor)};
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
+//~^^ ERROR: statics are not allowed to have destructors
 
 static mut STATIC14: SafeStruct = SafeStruct {
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
     field1: Variant1,
     field2: Variant4("str".to_string())
 };
 
-static STATIC15: &'static [Box<MyOwned>] = &[box MyOwned, box MyOwned];
-//~^ ERROR static items are not allowed to have custom pointers
-//~^^ ERROR static items are not allowed to have custom pointers
+static STATIC15: &'static [Box<MyOwned>] = &[
+    box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+    box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+];
 
-static STATIC16: (&'static Box<MyOwned>, &'static Box<MyOwned>) =
-    (&box MyOwned, &box MyOwned);
-//~^ ERROR static items are not allowed to have custom pointers
-//~^^ ERROR static items are not allowed to have custom pointers
+static STATIC16: (&'static Box<MyOwned>, &'static Box<MyOwned>) = (
+    &box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+    &box MyOwned, //~ ERROR statics are not allowed to have custom pointers
+);
 
 static mut STATIC17: SafeEnum = Variant1;
-//~^ ERROR mutable static items are not allowed to have destructors
+//~^ ERROR mutable statics are not allowed to have destructors
 
-static STATIC19: Box<int> = box 3;
-//~^ ERROR static items are not allowed to have custom pointers
+static STATIC19: Box<int> =
+    box 3;
+//~^ ERROR statics are not allowed to have custom pointers
 
 pub fn main() {
     let y = { static x: Box<int> = box 3; x };
-    //~^ ERROR static items are not allowed to have custom pointers
+    //~^ ERROR statics are not allowed to have custom pointers
 }
diff --git a/src/test/compile-fail/issue-15524.rs b/src/test/compile-fail/issue-15524.rs
index 1e7bd6fc623a8..6d9657ab28912 100644
--- a/src/test/compile-fail/issue-15524.rs
+++ b/src/test/compile-fail/issue-15524.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static N: int = 1;
+const N: int = 1;
 
 enum Foo {
     A = 1,
diff --git a/src/test/compile-fail/issue-16149.rs b/src/test/compile-fail/issue-16149.rs
index c52c53ec2e9ca..aa586e58f7084 100644
--- a/src/test/compile-fail/issue-16149.rs
+++ b/src/test/compile-fail/issue-16149.rs
@@ -15,7 +15,7 @@ extern {
 fn main() {
     let boolValue = match 42 {
         externalValue => true,
-        //~^ ERROR extern statics cannot be referenced in patterns
+        //~^ ERROR static variables cannot be referenced in a pattern
         _ => false
     };
 }
diff --git a/src/test/compile-fail/issue-17718-borrow-interior.rs b/src/test/compile-fail/issue-17718-borrow-interior.rs
new file mode 100644
index 0000000000000..1f763dbdc9fa6
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-borrow-interior.rs
@@ -0,0 +1,24 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+struct S { a: uint }
+static A: S  = S { a: 3 };
+static B: &'static uint = &A.a;
+//~^ ERROR: cannot refer to the interior of another static
+static C: &'static uint = &(A.a);
+//~^ ERROR: cannot refer to the interior of another static
+
+static D: [uint, ..1] = [1];
+static E: uint = D[0];
+//~^ ERROR: cannot refer to other statics by value
+static F: &'static uint = &D[0];
+//~^ ERROR: cannot refer to the interior of another static
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-bad-values.rs b/src/test/compile-fail/issue-17718-const-bad-values.rs
new file mode 100644
index 0000000000000..6425dbda5c6c9
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-bad-values.rs
@@ -0,0 +1,20 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const C1: &'static mut [uint] = &mut [];
+//~^ ERROR: constants are not allowed to have mutable references
+
+static mut S: uint = 3;
+const C2: &'static mut uint = &mut S;
+//~^ ERROR: constants cannot refer to other statics
+//~^^ ERROR: are not allowed to have mutable references
+
+fn main() {}
+
diff --git a/src/test/compile-fail/issue-17718-const-borrow.rs b/src/test/compile-fail/issue-17718-const-borrow.rs
new file mode 100644
index 0000000000000..21cc9a757cf19
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-borrow.rs
@@ -0,0 +1,24 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::cell::UnsafeCell;
+
+const A: UnsafeCell<uint> = UnsafeCell { value: 1 };
+const B: &'static UnsafeCell<uint> = &A;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+
+struct C { a: UnsafeCell<uint> }
+const D: C = C { a: UnsafeCell { value: 1 } };
+const E: &'static UnsafeCell<uint> = &D.a;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+const F: &'static C = &D;
+//~^ ERROR: cannot borrow a constant which contains interior mutability
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-destructors.rs b/src/test/compile-fail/issue-17718-const-destructors.rs
new file mode 100644
index 0000000000000..e888f917741ab
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-destructors.rs
@@ -0,0 +1,19 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+struct A;
+impl Drop for A {
+    fn drop(&mut self) {}
+}
+
+const FOO: A = A;
+//~^ ERROR: constants are not allowed to have destructors
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-naming.rs b/src/test/compile-fail/issue-17718-const-naming.rs
new file mode 100644
index 0000000000000..046f038847b7b
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-naming.rs
@@ -0,0 +1,16 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+#[deny(warnings)]
+
+const foo: int = 3;
+//~^ ERROR: should have an uppercase name such as
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-const-privacy.rs b/src/test/compile-fail/issue-17718-const-privacy.rs
new file mode 100644
index 0000000000000..d3be9f3dd3f77
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-const-privacy.rs
@@ -0,0 +1,26 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+// aux-build:issue-17718-const-privacy.rs
+
+extern crate "issue-17718-const-privacy" as other;
+
+use a::B; //~ ERROR: const `B` is private
+use other::{
+    FOO,
+    BAR, //~ ERROR: const `BAR` is private
+    FOO2,
+};
+
+mod a {
+    const B: uint = 3;
+}
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-constants-not-static.rs b/src/test/compile-fail/issue-17718-constants-not-static.rs
new file mode 100644
index 0000000000000..8c51b592054a5
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-constants-not-static.rs
@@ -0,0 +1,17 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const FOO: uint = 3;
+
+fn foo() -> &'static uint { &FOO }
+//~^ ERROR: borrowed value does not live long enough
+
+fn main() {
+}
diff --git a/src/test/compile-fail/issue-17718-extern-const.rs b/src/test/compile-fail/issue-17718-extern-const.rs
new file mode 100644
index 0000000000000..235d1222d81c0
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-extern-const.rs
@@ -0,0 +1,15 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+extern {
+    const FOO: uint; //~ ERROR: unexpected token: `const`
+}
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-patterns.rs b/src/test/compile-fail/issue-17718-patterns.rs
new file mode 100644
index 0000000000000..01dfb1b4af93c
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-patterns.rs
@@ -0,0 +1,22 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+static A1: uint = 1;
+static mut A2: uint = 1;
+const A3: uint = 1;
+
+fn main() {
+    match 1u {
+        A1 => {} //~ ERROR: static variables cannot be referenced in a pattern
+        A2 => {} //~ ERROR: static variables cannot be referenced in a pattern
+        A3 => {}
+        _ => {}
+    }
+}
diff --git a/src/test/compile-fail/issue-17718-recursive.rs b/src/test/compile-fail/issue-17718-recursive.rs
new file mode 100644
index 0000000000000..a13dfe639c12b
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-recursive.rs
@@ -0,0 +1,14 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+const A: uint = B; //~ ERROR: recursive constant
+const B: uint = A; //~ ERROR: recursive constant
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-references.rs b/src/test/compile-fail/issue-17718-references.rs
new file mode 100644
index 0000000000000..7b272e1610c7f
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-references.rs
@@ -0,0 +1,33 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+struct Struct { a: uint }
+
+const C: uint = 1;
+static S: uint = 1;
+
+const T1: &'static uint = &C;
+const T2: &'static uint = &S; //~ ERROR: constants cannot refer to other statics
+static T3: &'static uint = &C;
+static T4: &'static uint = &S;
+
+const T5: uint = C;
+const T6: uint = S; //~ ERROR: constants cannot refer to other statics
+//~^ cannot refer to other statics
+static T7: uint = C;
+static T8: uint = S; //~ ERROR: cannot refer to other statics by value
+
+const T9: Struct = Struct { a: C };
+const T10: Struct = Struct { a: S }; //~ ERROR: cannot refer to other statics by value
+//~^ ERROR: constants cannot refer to other statics
+static T11: Struct = Struct { a: C };
+static T12: Struct = Struct { a: S }; //~ ERROR: cannot refer to other statics by value
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-17718-static-move.rs b/src/test/compile-fail/issue-17718-static-move.rs
new file mode 100644
index 0000000000000..c57df9a3af4a4
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-static-move.rs
@@ -0,0 +1,19 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::kinds::marker;
+
+struct Foo { nc: marker::NoCopy }
+const INIT: Foo = Foo { nc: marker::NoCopy };
+static FOO: Foo = INIT;
+
+fn main() {
+    let _a = FOO; //~ ERROR: cannot move out of static item
+}
diff --git a/src/test/compile-fail/issue-17718-static-sync.rs b/src/test/compile-fail/issue-17718-static-sync.rs
new file mode 100644
index 0000000000000..2304b18adb63d
--- /dev/null
+++ b/src/test/compile-fail/issue-17718-static-sync.rs
@@ -0,0 +1,19 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+use std::kinds::marker;
+
+struct Foo { marker: marker::NoSync }
+
+static FOO: uint = 3;
+static BAR: Foo = Foo { marker: marker::NoSync };
+//~^ ERROR: shared static items must have a type which implements Sync
+
+fn main() {}
diff --git a/src/test/compile-fail/issue-4968.rs b/src/test/compile-fail/issue-4968.rs
index 220fb76411abb..a181215f4184d 100644
--- a/src/test/compile-fail/issue-4968.rs
+++ b/src/test/compile-fail/issue-4968.rs
@@ -10,7 +10,7 @@
 
 // Regression test for issue #4968
 
-static A: (int,int) = (4,2);
+const A: (int,int) = (4,2);
 fn main() {
     match 42 { A => () }
     //~^ ERROR mismatched types: expected `<generic integer #0>`, found `(int,int)`
diff --git a/src/test/compile-fail/issue-7364.rs b/src/test/compile-fail/issue-7364.rs
index e29b8bc04d80e..7f0d9ef3b11ec 100644
--- a/src/test/compile-fail/issue-7364.rs
+++ b/src/test/compile-fail/issue-7364.rs
@@ -13,6 +13,7 @@ use std::cell::RefCell;
 
 // Regresion test for issue 7364
 static boxed: Box<RefCell<int>> = box RefCell::new(0);
-//~^ ERROR static items are not allowed to have custom pointers
+//~^ ERROR statics are not allowed to have custom pointers
+//~^^ ERROR: shared static items must have a type which implements Sync
 
 fn main() { }
diff --git a/src/test/compile-fail/issue-9243.rs b/src/test/compile-fail/issue-9243.rs
index f1400c06ca23a..eb3618c9f0408 100644
--- a/src/test/compile-fail/issue-9243.rs
+++ b/src/test/compile-fail/issue-9243.rs
@@ -14,7 +14,7 @@ struct Test {
     mem: int,
 }
 
-pub static g_test: Test = Test {mem: 0}; //~ ERROR static items are not allowed to have destructors
+pub static g_test: Test = Test {mem: 0}; //~ ERROR statics are not allowed to have destructors
 
 impl Drop for Test {
     fn drop(&mut self) {}
diff --git a/src/test/compile-fail/lint-dead-code-1.rs b/src/test/compile-fail/lint-dead-code-1.rs
index 45380235a2a8b..a4320b8dc7751 100644
--- a/src/test/compile-fail/lint-dead-code-1.rs
+++ b/src/test/compile-fail/lint-dead-code-1.rs
@@ -13,14 +13,12 @@
 #![allow(non_camel_case_types)]
 #![allow(non_uppercase_statics)]
 #![deny(dead_code)]
-#![feature(lang_items)]
 
 #![crate_type="lib"]
 
-pub use foo2::Bar2;
+extern crate core;
 
-#[lang="sized"]
-pub trait Sized {}
+pub use foo2::Bar2;
 
 mod foo {
     pub struct Bar; //~ ERROR: struct is never used
@@ -32,10 +30,10 @@ mod foo2 {
 
 pub static pub_static: int = 0;
 static priv_static: int = 0; //~ ERROR: static item is never used
-static used_static: int = 0;
+const used_static: int = 0;
 pub static used_static2: int = used_static;
-static USED_STATIC: int = 0;
-static STATIC_USED_IN_ENUM_DISCRIMINANT: int = 10;
+const USED_STATIC: int = 0;
+const STATIC_USED_IN_ENUM_DISCRIMINANT: int = 10;
 
 pub type typ = *const UsedStruct4;
 pub struct PubStruct;
@@ -107,7 +105,3 @@ fn bar() { //~ ERROR: function is never used
 #[allow(dead_code)]
 fn g() { h(); }
 fn h() {}
-
-// Similarly, lang items are live
-#[lang="fail"]
-fn fail(_: *const u8, _: *const u8, _: uint) -> ! { loop {} }
diff --git a/src/test/compile-fail/match-arm-statics.rs b/src/test/compile-fail/match-arm-statics.rs
index 69cb626b75a46..cedc0098c00f5 100644
--- a/src/test/compile-fail/match-arm-statics.rs
+++ b/src/test/compile-fail/match-arm-statics.rs
@@ -17,7 +17,7 @@ enum Direction {
     West
 }
 
-static TRUE_TRUE: (bool, bool) = (true, true);
+const TRUE_TRUE: (bool, bool) = (true, true);
 
 fn nonexhaustive_1() {
     match (true, false) {
@@ -39,8 +39,8 @@ fn unreachable_1() {
     }
 }
 
-static NONE: Option<Direction> = None;
-static EAST: Direction = East;
+const NONE: Option<Direction> = None;
+const EAST: Direction = East;
 
 fn nonexhaustive_2() {
     match Some(Some(North)) {
@@ -66,13 +66,13 @@ fn unreachable_2() {
     }
 }
 
-static NEW_FALSE: NewBool = NewBool(false);
+const NEW_FALSE: NewBool = NewBool(false);
 struct Foo {
     bar: Option<Direction>,
     baz: NewBool
 }
 
-static STATIC_FOO: Foo = Foo { bar: None, baz: NEW_FALSE };
+const STATIC_FOO: Foo = Foo { bar: None, baz: NEW_FALSE };
 
 fn nonexhaustive_3() {
     match (Foo { bar: Some(North), baz: NewBool(true) }) {
diff --git a/src/test/compile-fail/match-static-const-lc.rs b/src/test/compile-fail/match-static-const-lc.rs
index a5dce6ecc6f3e..af7938948a70f 100644
--- a/src/test/compile-fail/match-static-const-lc.rs
+++ b/src/test/compile-fail/match-static-const-lc.rs
@@ -14,7 +14,7 @@
 #![deny(non_uppercase_statics)]
 
 #[allow(non_uppercase_statics)]
-pub static a : int = 97;
+pub const a : int = 97;
 
 fn f() {
     let r = match (0,0) {
@@ -27,7 +27,7 @@ fn f() {
 
 mod m {
     #[allow(non_uppercase_statics)]
-    pub static aha : int = 7;
+    pub const aha : int = 7;
 }
 
 fn g() {
@@ -41,7 +41,7 @@ fn g() {
 }
 
 mod n {
-    pub static OKAY : int = 8;
+    pub const OKAY : int = 8;
 }
 
 fn h() {
diff --git a/src/test/compile-fail/static-mut-not-constant.rs b/src/test/compile-fail/static-mut-not-constant.rs
index 927006adc9e26..84c72de5548a2 100644
--- a/src/test/compile-fail/static-mut-not-constant.rs
+++ b/src/test/compile-fail/static-mut-not-constant.rs
@@ -10,6 +10,7 @@
 
 
 static mut a: Box<int> = box 3;
-//~^ ERROR mutable static items are not allowed to have owned pointers
+//~^ ERROR statics are not allowed to have custom pointers
+//~^^ ERROR mutable statics are not allowed to have owned pointers
 
 fn main() {}
diff --git a/src/test/compile-fail/static-mut-not-pat.rs b/src/test/compile-fail/static-mut-not-pat.rs
index b3e93daccab8d..b3ffcb0b98967 100644
--- a/src/test/compile-fail/static-mut-not-pat.rs
+++ b/src/test/compile-fail/static-mut-not-pat.rs
@@ -20,7 +20,7 @@ fn main() {
     // instead of spitting out a custom error about some identifier collisions
     // (we should allow shadowing)
     match 4i {
-        a => {} //~ ERROR mutable static variables cannot be referenced in a pattern
+        a => {} //~ ERROR static variables cannot be referenced in a pattern
         _ => {}
     }
 }
@@ -32,7 +32,7 @@ enum Direction {
     South,
     West
 }
-static NEW_FALSE: NewBool = NewBool(false);
+const NEW_FALSE: NewBool = NewBool(false);
 struct Foo {
     bar: Option<Direction>,
     baz: NewBool
@@ -44,7 +44,7 @@ fn mutable_statics() {
     match (Foo { bar: Some(North), baz: NewBool(true) }) {
         Foo { bar: None, baz: NewBool(true) } => (),
         STATIC_MUT_FOO => (),
-        //~^ ERROR mutable static variables cannot be referenced in a pattern
+        //~^ ERROR static variables cannot be referenced in a pattern
         Foo { bar: Some(South), .. } => (),
         Foo { bar: Some(EAST), .. } => (),
         Foo { bar: Some(North), baz: NewBool(true) } => (),
diff --git a/src/test/compile-fail/std-uncopyable-atomics.rs b/src/test/compile-fail/std-uncopyable-atomics.rs
index 0e8c2f38afbed..c0122b8a2a97a 100644
--- a/src/test/compile-fail/std-uncopyable-atomics.rs
+++ b/src/test/compile-fail/std-uncopyable-atomics.rs
@@ -16,11 +16,11 @@ use std::sync::atomic::*;
 use std::ptr;
 
 fn main() {
-    let x = INIT_ATOMIC_BOOL; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_BOOL;
     let x = *&x; //~ ERROR: cannot move out of dereference
-    let x = INIT_ATOMIC_INT; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_INT;
     let x = *&x; //~ ERROR: cannot move out of dereference
-    let x = INIT_ATOMIC_UINT; //~ ERROR cannot move out of static item
+    let x = INIT_ATOMIC_UINT;
     let x = *&x; //~ ERROR: cannot move out of dereference
     let x: AtomicPtr<uint> = AtomicPtr::new(ptr::null_mut());
     let x = *&x; //~ ERROR: cannot move out of dereference
diff --git a/src/test/pretty/issue-4264.pp b/src/test/pretty/issue-4264.pp
index 2bc09d7e96e58..c5229f0f9f971 100644
--- a/src/test/pretty/issue-4264.pp
+++ b/src/test/pretty/issue-4264.pp
@@ -25,7 +25,7 @@
 pub fn foo(_: [int, ..(3 as uint)]) { }
 
 pub fn bar() {
-    static FOO: uint = ((5u as uint) - (4u as uint) as uint);
+    const FOO: uint = ((5u as uint) - (4u as uint) as uint);
     let _: [(), ..(FOO as uint)] = ([(() as ())] as [(), ..1]);
 
     let _: [(), ..(1u as uint)] = ([(() as ())] as [(), ..1]);
diff --git a/src/test/pretty/issue-4264.rs b/src/test/pretty/issue-4264.rs
index ad407f48a7ae3..ad0954e6eabc3 100644
--- a/src/test/pretty/issue-4264.rs
+++ b/src/test/pretty/issue-4264.rs
@@ -17,7 +17,7 @@
 pub fn foo(_: [int, ..3]) {}
 
 pub fn bar() {
-    static FOO: uint = 5u - 4u;
+    const FOO: uint = 5u - 4u;
     let _: [(), ..FOO] = [()];
 
     let _ : [(), ..1u] = [()];
diff --git a/src/test/run-make/sepcomp-cci-copies/Makefile b/src/test/run-make/sepcomp-cci-copies/Makefile
index fdb39f851970f..65db841b0c0ed 100644
--- a/src/test/run-make/sepcomp-cci-copies/Makefile
+++ b/src/test/run-make/sepcomp-cci-copies/Makefile
@@ -7,4 +7,3 @@ all:
 	$(RUSTC) cci_lib.rs
 	$(RUSTC) foo.rs --emit=ir -C codegen-units=3
 	[ "$$(cat "$(TMPDIR)"/foo.?.ll | grep -c define\ .*cci_fn)" -eq "2" ]
-	[ "$$(cat "$(TMPDIR)"/foo.?.ll | grep -c CCI_STATIC.*=.*constant)" -eq "2" ]
diff --git a/src/test/run-make/sepcomp-cci-copies/cci_lib.rs b/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
index 099101d6f2679..a7cd85db4a2d1 100644
--- a/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
+++ b/src/test/run-make/sepcomp-cci-copies/cci_lib.rs
@@ -14,6 +14,3 @@
 pub fn cci_fn() -> uint {
     1234
 }
-
-#[inline]
-pub static CCI_STATIC: uint = 2345;
diff --git a/src/test/run-make/sepcomp-cci-copies/foo.rs b/src/test/run-make/sepcomp-cci-copies/foo.rs
index c702e578c0965..b0642b64cdaac 100644
--- a/src/test/run-make/sepcomp-cci-copies/foo.rs
+++ b/src/test/run-make/sepcomp-cci-copies/foo.rs
@@ -9,10 +9,10 @@
 // except according to those terms.
 
 extern crate cci_lib;
-use cci_lib::{cci_fn, CCI_STATIC};
+use cci_lib::{cci_fn};
 
 fn call1() -> uint {
-    cci_fn() + CCI_STATIC
+    cci_fn()
 }
 
 mod a {
@@ -23,9 +23,8 @@ mod a {
 }
 
 mod b {
-    use cci_lib::CCI_STATIC;
     pub fn call3() -> uint {
-        CCI_STATIC
+        0
     }
 }
 
diff --git a/src/test/run-pass/bytes-macro-static.rs b/src/test/run-pass/bytes-macro-static.rs
index 7f4bbda8e30d8..2ce8c40c77183 100644
--- a/src/test/run-pass/bytes-macro-static.rs
+++ b/src/test/run-pass/bytes-macro-static.rs
@@ -11,7 +11,7 @@
 static FOO: &'static [u8] = bytes!("hello, world");
 
 pub fn main() {
-    let b = match true {
+    let b: &'static [u8] = match true {
         true => bytes!("test"),
         false => unreachable!()
     };
diff --git a/src/test/run-pass/cast-in-array-size.rs b/src/test/run-pass/cast-in-array-size.rs
index 13e5b89b84e04..aaffb013ad8c7 100644
--- a/src/test/run-pass/cast-in-array-size.rs
+++ b/src/test/run-pass/cast-in-array-size.rs
@@ -10,7 +10,7 @@
 
 
 // issues #10618 and #16382
-static SIZE: int = 25;
+const SIZE: int = 25;
 
 fn main() {
     let _a: [bool, ..1 as uint];
diff --git a/src/test/run-pass/check-static-slice.rs b/src/test/run-pass/check-static-slice.rs
index 17957dbcc1389..60daedec4c79f 100644
--- a/src/test/run-pass/check-static-slice.rs
+++ b/src/test/run-pass/check-static-slice.rs
@@ -11,12 +11,12 @@
 // Check that the various ways of getting to a reference to a vec (both sized
 // and unsized) work properly.
 
-static aa: [int, ..3] = [1, 2, 3];
-static ab: &'static [int, ..3] = &aa;
-static ac: &'static [int] = ab;
-static ad: &'static [int] = &aa;
-static ae: &'static [int, ..3] = &[1, 2, 3];
-static af: &'static [int] = &[1, 2, 3];
+const aa: [int, ..3] = [1, 2, 3];
+const ab: &'static [int, ..3] = &aa;
+const ac: &'static [int] = ab;
+const ad: &'static [int] = &aa;
+const ae: &'static [int, ..3] = &[1, 2, 3];
+const af: &'static [int] = &[1, 2, 3];
 
 static ca: int = aa[0];
 static cb: int = ab[1];
diff --git a/src/test/run-pass/const-cast.rs b/src/test/run-pass/const-cast.rs
index 87a4fd1153f82..5d8e31f934411 100644
--- a/src/test/run-pass/const-cast.rs
+++ b/src/test/run-pass/const-cast.rs
@@ -12,9 +12,9 @@ extern crate libc;
 
 extern fn foo() {}
 
-static x: extern "C" fn() = foo;
+const x: extern "C" fn() = foo;
 static y: *const libc::c_void = x as *const libc::c_void;
-static a: &'static int = &10;
+const a: &'static int = &10;
 static b: *const int = a as *const int;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-const.rs b/src/test/run-pass/const-const.rs
index bdb2b3d211043..ba2947f736790 100644
--- a/src/test/run-pass/const-const.rs
+++ b/src/test/run-pass/const-const.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static a: int = 1;
-static b: int = a + 2;
+const a: int = 1;
+const b: int = a + 2;
 
 pub fn main() {
     assert_eq!(b, 3);
diff --git a/src/test/run-pass/const-deref.rs b/src/test/run-pass/const-deref.rs
index 7c2771c3544f7..480fb50a1ffe5 100644
--- a/src/test/run-pass/const-deref.rs
+++ b/src/test/run-pass/const-deref.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static C: &'static int = &1000;
+const C: &'static int = &1000;
 static D: int = *C;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-enum-vec-index.rs b/src/test/run-pass/const-enum-vec-index.rs
index 5be21696bd1ed..2a00daa3c038c 100644
--- a/src/test/run-pass/const-enum-vec-index.rs
+++ b/src/test/run-pass/const-enum-vec-index.rs
@@ -9,10 +9,10 @@
 // except according to those terms.
 
 enum E { V1(int), V0 }
-static C: &'static [E] = &[V0, V1(0xDEADBEE)];
+const C: &'static [E] = &[V0, V1(0xDEADBEE)];
 static C0: E = C[0];
 static C1: E = C[1];
-static D: &'static [E, ..2] = &[V0, V1(0xDEADBEE)];
+const D: &'static [E, ..2] = &[V0, V1(0xDEADBEE)];
 static D0: E = C[0];
 static D1: E = C[1];
 
diff --git a/src/test/run-pass/const-expr-in-fixed-length-vec.rs b/src/test/run-pass/const-expr-in-fixed-length-vec.rs
index 0440a771e98f8..317a54e927f31 100644
--- a/src/test/run-pass/const-expr-in-fixed-length-vec.rs
+++ b/src/test/run-pass/const-expr-in-fixed-length-vec.rs
@@ -13,7 +13,7 @@
 
 pub fn main() {
 
-    static FOO: uint = 2;
+    const FOO: uint = 2;
     let _v: [int, ..FOO*3];
 
 }
diff --git a/src/test/run-pass/const-expr-in-vec-repeat.rs b/src/test/run-pass/const-expr-in-vec-repeat.rs
index 5dd9f829d0a2c..54386b33dd9da 100644
--- a/src/test/run-pass/const-expr-in-vec-repeat.rs
+++ b/src/test/run-pass/const-expr-in-vec-repeat.rs
@@ -12,7 +12,7 @@
 
 pub fn main() {
 
-    static FOO: uint = 2;
+    const FOO: uint = 2;
     let _v = [0i, ..FOO*3*2/2];
 
 }
diff --git a/src/test/run-pass/const-fields-and-indexing.rs b/src/test/run-pass/const-fields-and-indexing.rs
index ff44c76048fab..fc098ff93574b 100644
--- a/src/test/run-pass/const-fields-and-indexing.rs
+++ b/src/test/run-pass/const-fields-and-indexing.rs
@@ -10,20 +10,20 @@
 
 extern crate debug;
 
-static x : [int, ..4] = [1,2,3,4];
+const x : [int, ..4] = [1,2,3,4];
 static p : int = x[2];
-static y : &'static [int] = &[1,2,3,4];
+const y : &'static [int] = &[1,2,3,4];
 static q : int = y[2];
 
 struct S {a: int, b: int}
 
-static s : S = S {a: 10, b: 20};
+const s : S = S {a: 10, b: 20};
 static t : int = s.b;
 
 struct K {a: int, b: int, c: D}
 struct D { d: int, e: int }
 
-static k : K = K {a: 10, b: 20, c: D {d: 30, e: 40}};
+const k : K = K {a: 10, b: 20, c: D {d: 30, e: 40}};
 static m : int = k.c.e;
 
 pub fn main() {
diff --git a/src/test/run-pass/const-region-ptrs-noncopy.rs b/src/test/run-pass/const-region-ptrs-noncopy.rs
index 36fe021b97e14..5e417efb4b583 100644
--- a/src/test/run-pass/const-region-ptrs-noncopy.rs
+++ b/src/test/run-pass/const-region-ptrs-noncopy.rs
@@ -10,8 +10,8 @@
 
 type Big = [u64, ..8];
 struct Pair<'a> { a: int, b: &'a Big }
-static x: &'static Big = &([13, 14, 10, 13, 11, 14, 14, 15]);
-static y: &'static Pair<'static> = &Pair {a: 15, b: x};
+const x: &'static Big = &([13, 14, 10, 13, 11, 14, 14, 15]);
+const y: &'static Pair<'static> = &Pair {a: 15, b: x};
 
 pub fn main() {
     assert_eq!(x as *const Big, y.b as *const Big);
diff --git a/src/test/run-pass/const-region-ptrs.rs b/src/test/run-pass/const-region-ptrs.rs
index 113f13dc4bf40..e5d3f0ece0cf5 100644
--- a/src/test/run-pass/const-region-ptrs.rs
+++ b/src/test/run-pass/const-region-ptrs.rs
@@ -10,9 +10,9 @@
 
 struct Pair<'a> { a: int, b: &'a int }
 
-static x: &'static int = &10;
+const x: &'static int = &10;
 
-static y: &'static Pair<'static> = &Pair {a: 15, b: x};
+const y: &'static Pair<'static> = &Pair {a: 15, b: x};
 
 pub fn main() {
     println!("x = {}", *x);
diff --git a/src/test/run-pass/const-str-ptr.rs b/src/test/run-pass/const-str-ptr.rs
index 0fef3dd4aac24..7395a997a05c5 100644
--- a/src/test/run-pass/const-str-ptr.rs
+++ b/src/test/run-pass/const-str-ptr.rs
@@ -10,9 +10,9 @@
 
 use std::{str, string};
 
-static A: [u8, ..2] = ['h' as u8, 'i' as u8];
-static B: &'static [u8, ..2] = &A;
-static C: *const u8 = B as *const u8;
+const A: [u8, ..2] = ['h' as u8, 'i' as u8];
+const B: &'static [u8, ..2] = &A;
+const C: *const u8 = B as *const u8;
 
 pub fn main() {
     unsafe {
diff --git a/src/test/run-pass/const-struct.rs b/src/test/run-pass/const-struct.rs
index 0a83d007a06a1..f2db119156960 100644
--- a/src/test/run-pass/const-struct.rs
+++ b/src/test/run-pass/const-struct.rs
@@ -22,10 +22,10 @@ impl cmp::PartialEq for foo {
     fn ne(&self, other: &foo) -> bool { !(*self).eq(other) }
 }
 
-static x : foo = foo { a:1, b:2, c: 3 };
-static y : foo = foo { b:2, c:3, a: 1 };
-static z : &'static foo = &foo { a: 10, b: 22, c: 12 };
-static w : foo = foo { a:5, ..x };
+const x : foo = foo { a:1, b:2, c: 3 };
+const y : foo = foo { b:2, c:3, a: 1 };
+const z : &'static foo = &foo { a: 10, b: 22, c: 12 };
+const w : foo = foo { a:5, ..x };
 
 pub fn main() {
     assert_eq!(x.b, 2);
diff --git a/src/test/run-pass/consts-in-patterns.rs b/src/test/run-pass/consts-in-patterns.rs
index 2a15774fb17a8..87b7fcad38522 100644
--- a/src/test/run-pass/consts-in-patterns.rs
+++ b/src/test/run-pass/consts-in-patterns.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static FOO: int = 10;
-static BAR: int = 3;
+const FOO: int = 10;
+const BAR: int = 3;
 
 pub fn main() {
     let x: int = 3i;
diff --git a/src/test/run-pass/enum-vec-initializer.rs b/src/test/run-pass/enum-vec-initializer.rs
index b04f5e11042c8..d51562d2490de 100644
--- a/src/test/run-pass/enum-vec-initializer.rs
+++ b/src/test/run-pass/enum-vec-initializer.rs
@@ -12,13 +12,13 @@ enum Flopsy {
     Bunny = 2
 }
 
-static BAR:uint = Bunny as uint;
-static BAR2:uint = BAR;
+const BAR:uint = Bunny as uint;
+const BAR2:uint = BAR;
 
 pub fn main() {
     let _v = [0i, .. Bunny as uint];
     let _v = [0i, .. BAR];
     let _v = [0i, .. BAR2];
-    static BAR3:uint = BAR2;
+    const BAR3:uint = BAR2;
     let _v = [0i, .. BAR3];
 }
diff --git a/src/test/run-pass/issue-11940.rs b/src/test/run-pass/issue-11940.rs
index bbe7eff229b00..1540679b099b4 100644
--- a/src/test/run-pass/issue-11940.rs
+++ b/src/test/run-pass/issue-11940.rs
@@ -8,7 +8,7 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static TEST_STR: &'static str = "abcd";
+const TEST_STR: &'static str = "abcd";
 
 fn main() {
     let s = "abcd";
diff --git a/src/test/run-pass/issue-13763.rs b/src/test/run-pass/issue-13763.rs
index 242836dbe029f..8b2b732415ee0 100644
--- a/src/test/run-pass/issue-13763.rs
+++ b/src/test/run-pass/issue-13763.rs
@@ -10,7 +10,7 @@
 
 use std::u8;
 
-static NUM: uint = u8::BITS as uint;
+const NUM: uint = u8::BITS as uint;
 
 struct MyStruct { nums: [uint, ..8] }
 
diff --git a/src/test/run-pass/issue-17074.rs b/src/test/run-pass/issue-17074.rs
index e346148691d86..d35c3a587c5a5 100644
--- a/src/test/run-pass/issue-17074.rs
+++ b/src/test/run-pass/issue-17074.rs
@@ -8,8 +8,10 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static X: u64 = -1 as u16 as u64;
-static Y: u64 = -1 as u32 as u64;
+static X2: u64 = -1 as u16 as u64;
+static Y2: u64 = -1 as u32 as u64;
+const X: u64 = -1 as u16 as u64;
+const Y: u64 = -1 as u32 as u64;
 
 fn main() {
     assert_eq!(match 1 {
diff --git a/src/test/compile-fail/borrowck-forbid-static-unsafe-interior.rs b/src/test/run-pass/issue-17718-static-unsafe-interior.rs
similarity index 69%
rename from src/test/compile-fail/borrowck-forbid-static-unsafe-interior.rs
rename to src/test/run-pass/issue-17718-static-unsafe-interior.rs
index 01a6e33467ee4..8f76d95c54815 100644
--- a/src/test/compile-fail/borrowck-forbid-static-unsafe-interior.rs
+++ b/src/test/run-pass/issue-17718-static-unsafe-interior.rs
@@ -8,9 +8,6 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-// Verify that it is not possible to take the address of
-// static items with unsafe interior.
-
 use std::kinds::marker;
 use std::cell::UnsafeCell;
 
@@ -30,10 +27,10 @@ enum UnsafeEnum<T> {
 static STATIC1: UnsafeEnum<int> = VariantSafe;
 
 static STATIC2: UnsafeCell<int> = UnsafeCell { value: 1 };
-static STATIC3: MyUnsafe<int> = MyUnsafe{value: STATIC2};
+const CONST: UnsafeCell<int> = UnsafeCell { value: 1 };
+static STATIC3: MyUnsafe<int> = MyUnsafe{value: CONST};
 
 static STATIC4: &'static UnsafeCell<int> = &STATIC2;
-//~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
 struct Wrap<T> {
     value: T
@@ -41,14 +38,11 @@ struct Wrap<T> {
 
 static UNSAFE: UnsafeCell<int> = UnsafeCell{value: 1};
 static WRAPPED_UNSAFE: Wrap<&'static UnsafeCell<int>> = Wrap { value: &UNSAFE };
-//~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
 fn main() {
     let a = &STATIC1;
-    //~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 
     STATIC3.forbidden()
-    //~^ ERROR borrow of immutable static items with unsafe interior is not allowed
 }
 
 
diff --git a/src/test/run-pass/issue-17718.rs b/src/test/run-pass/issue-17718.rs
new file mode 100644
index 0000000000000..90a102222ba17
--- /dev/null
+++ b/src/test/run-pass/issue-17718.rs
@@ -0,0 +1,83 @@
+// Copyright 2014 The Rust Project Developers. See the COPYRIGHT
+// file at the top-level directory of this distribution and at
+// http://rust-lang.org/COPYRIGHT.
+//
+// Licensed under the Apache License, Version 2.0 <LICENSE-APACHE or
+// http://www.apache.org/licenses/LICENSE-2.0> or the MIT license
+// <LICENSE-MIT or http://opensource.org/licenses/MIT>, at your
+// option. This file may not be copied, modified, or distributed
+// except according to those terms.
+
+// aux-build:issue-17718.rs
+
+extern crate "issue-17718" as other;
+
+use std::sync::atomic;
+
+const C1: uint = 1;
+const C2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+const C3: fn() = foo;
+const C4: uint = C1 * C1 + C1 / C1;
+const C5: &'static uint = &C4;
+const C6: uint = {
+    const C: uint = 3;
+    C
+};
+
+static S1: uint = 3;
+static S2: atomic::AtomicUint = atomic::INIT_ATOMIC_UINT;
+
+mod test {
+    static A: uint = 4;
+    static B: &'static uint = &A;
+    static C: &'static uint = &(A);
+}
+
+fn foo() {}
+
+fn main() {
+    assert_eq!(C1, 1);
+    assert_eq!(C3(), ());
+    assert_eq!(C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(C4, 2);
+    assert_eq!(*C5, 2);
+    assert_eq!(C6, 3);
+    assert_eq!(S1, 3);
+    assert_eq!(S2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(S2.fetch_add(1, atomic::SeqCst), 1);
+
+    match 1 {
+        C1 => {}
+        _ => unreachable!(),
+    }
+
+    let _a = C1;
+    let _a = C2;
+    let _a = C3;
+    let _a = C4;
+    let _a = C5;
+    let _a = C6;
+    let _a = S1;
+
+    assert_eq!(other::C1, 1);
+    assert_eq!(other::C3(), ());
+    assert_eq!(other::C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::C2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::C4, 2);
+    assert_eq!(*other::C5, 2);
+    assert_eq!(other::S1, 3);
+    assert_eq!(other::S2.fetch_add(1, atomic::SeqCst), 0);
+    assert_eq!(other::S2.fetch_add(1, atomic::SeqCst), 1);
+
+    let _a = other::C1;
+    let _a = other::C2;
+    let _a = other::C3;
+    let _a = other::C4;
+    let _a = other::C5;
+
+    match 1 {
+        other::C1 => {}
+        _ => unreachable!(),
+    }
+}
diff --git a/src/test/run-pass/issue-2428.rs b/src/test/run-pass/issue-2428.rs
index 8c8b9d5df1359..b2ebbf3b148cf 100644
--- a/src/test/run-pass/issue-2428.rs
+++ b/src/test/run-pass/issue-2428.rs
@@ -10,7 +10,7 @@
 
 pub fn main() {
     let _foo = 100i;
-    static quux: int = 5;
+    const quux: int = 5;
 
     enum Stuff {
         Bar = quux
diff --git a/src/test/run-pass/issue-5353.rs b/src/test/run-pass/issue-5353.rs
index 2d729f8ced8d8..1f6493d961c5a 100644
--- a/src/test/run-pass/issue-5353.rs
+++ b/src/test/run-pass/issue-5353.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static INVALID_ENUM : u32 = 0;
-static INVALID_VALUE : u32 = 1;
+const INVALID_ENUM : u32 = 0;
+const INVALID_VALUE : u32 = 1;
 
 fn gl_err_str(err: u32) -> String
 {
diff --git a/src/test/run-pass/issue-7222.rs b/src/test/run-pass/issue-7222.rs
index b86b9a83e35bc..65ea895c2c85f 100644
--- a/src/test/run-pass/issue-7222.rs
+++ b/src/test/run-pass/issue-7222.rs
@@ -9,7 +9,7 @@
 // except according to those terms.
 
 pub fn main() {
-    static FOO: f64 = 10.0;
+    const FOO: f64 = 10.0;
 
     match 0.0 {
         0.0 ... FOO => (),
diff --git a/src/test/run-pass/issue-9942.rs b/src/test/run-pass/issue-9942.rs
index aa86f488906e6..b9410ffdb43ec 100644
--- a/src/test/run-pass/issue-9942.rs
+++ b/src/test/run-pass/issue-9942.rs
@@ -9,5 +9,5 @@
 // except according to those terms.
 
 pub fn main() {
-    static S: uint = 23 as uint; [0i, ..S]; ()
+    const S: uint = 23 as uint; [0i, ..S]; ()
 }
diff --git a/src/test/run-pass/match-arm-statics.rs b/src/test/run-pass/match-arm-statics.rs
index 6eb0a4dad1b6a..29972c0efd0db 100644
--- a/src/test/run-pass/match-arm-statics.rs
+++ b/src/test/run-pass/match-arm-statics.rs
@@ -29,19 +29,19 @@ enum EnumWithStructVariants {
     }
 }
 
-static TRUE_TRUE: (bool, bool) = (true, true);
-static NONE: Option<Direction> = None;
-static EAST: Direction = East;
-static NEW_FALSE: NewBool = NewBool(false);
-static STATIC_FOO: Foo = Foo { bar: Some(South), baz: NEW_FALSE };
-static VARIANT2_NORTH: EnumWithStructVariants = Variant2 { dir: North };
+const TRUE_TRUE: (bool, bool) = (true, true);
+const NONE: Option<Direction> = None;
+const EAST: Direction = East;
+const NEW_FALSE: NewBool = NewBool(false);
+const STATIC_FOO: Foo = Foo { bar: Some(South), baz: NEW_FALSE };
+const VARIANT2_NORTH: EnumWithStructVariants = Variant2 { dir: North };
 
 pub mod glfw {
     pub struct InputState(uint);
 
-    pub static RELEASE  : InputState = InputState(0);
-    pub static PRESS    : InputState = InputState(1);
-    pub static REPEAT   : InputState = InputState(2);
+    pub const RELEASE  : InputState = InputState(0);
+    pub const PRESS    : InputState = InputState(1);
+    pub const REPEAT   : InputState = InputState(2);
 }
 
 fn issue_6533() {
@@ -63,7 +63,7 @@ fn issue_6533() {
 }
 
 fn issue_13626() {
-    static VAL: [u8, ..1] = [0];
+    const VAL: [u8, ..1] = [0];
     match [1] {
         VAL => unreachable!(),
         _ => ()
@@ -72,8 +72,8 @@ fn issue_13626() {
 
 fn issue_14576() {
     type Foo = (i32, i32);
-    static ON: Foo = (1, 1);
-    static OFF: Foo = (0, 0);
+    const ON: Foo = (1, 1);
+    const OFF: Foo = (0, 0);
 
     match (1, 1) {
         OFF => unreachable!(),
@@ -82,14 +82,14 @@ fn issue_14576() {
     }
 
     enum C { D = 3, E = 4 }
-    static F : C = D;
+    const F : C = D;
 
     assert_eq!(match D { F => 1i, _ => 2, }, 1);
 }
 
 fn issue_13731() {
     enum A { AA(()) }
-    static B: A = AA(());
+    const B: A = AA(());
 
     match AA(()) {
         B => ()
@@ -102,8 +102,8 @@ fn issue_15393() {
         bits: uint
     }
 
-    static FOO: Flags = Flags { bits: 0x01 };
-    static BAR: Flags = Flags { bits: 0x02 };
+    const FOO: Flags = Flags { bits: 0x01 };
+    const BAR: Flags = Flags { bits: 0x02 };
     match (Flags { bits: 0x02 }) {
         FOO => unreachable!(),
         BAR => (),
diff --git a/src/test/run-pass/match-range-static.rs b/src/test/run-pass/match-range-static.rs
index 088756992453e..0feeea70221a4 100644
--- a/src/test/run-pass/match-range-static.rs
+++ b/src/test/run-pass/match-range-static.rs
@@ -8,8 +8,8 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static s: int = 1;
-static e: int = 42;
+const s: int = 1;
+const e: int = 42;
 
 pub fn main() {
     match 7 {
diff --git a/src/test/run-pass/match-static-const-rename.rs b/src/test/run-pass/match-static-const-rename.rs
index 9028e68da1fd9..f3fe93650af5e 100644
--- a/src/test/run-pass/match-static-const-rename.rs
+++ b/src/test/run-pass/match-static-const-rename.rs
@@ -18,7 +18,7 @@
 
 #![deny(non_uppercase_statics)]
 
-pub static A : int = 97;
+pub const A : int = 97;
 
 fn f() {
     let r = match (0,0) {
@@ -35,7 +35,7 @@ fn f() {
 
 mod m {
     #[allow(non_uppercase_statics)]
-    pub static aha : int = 7;
+    pub const aha : int = 7;
 }
 
 fn g() {
diff --git a/src/test/run-pass/resolve-issue-2428.rs b/src/test/run-pass/resolve-issue-2428.rs
index 57f6596d1d720..8aa12aa3e98ad 100644
--- a/src/test/run-pass/resolve-issue-2428.rs
+++ b/src/test/run-pass/resolve-issue-2428.rs
@@ -8,6 +8,6 @@
 // option. This file may not be copied, modified, or distributed
 // except according to those terms.
 
-static foo: int = 4 >> 1;
+const foo: int = 4 >> 1;
 enum bs { thing = foo }
 pub fn main() { assert!((thing as int == foo)); }
diff --git a/src/test/run-pass/sepcomp-statics.rs b/src/test/run-pass/sepcomp-statics.rs
index 26a652ae0ea4f..26a5c4d1c5026 100644
--- a/src/test/run-pass/sepcomp-statics.rs
+++ b/src/test/run-pass/sepcomp-statics.rs
@@ -14,7 +14,7 @@
 
 fn pad() -> uint { 0 }
 
-static ONE: uint = 1;
+const ONE: uint = 1;
 
 mod b {
     // Separate compilation always switches to the LLVM module with the fewest
@@ -28,7 +28,7 @@ mod b {
 mod a {
     fn pad() -> uint { 0 }
 
-    pub static TWO: uint = ::ONE + ::ONE;
+    pub const TWO: uint = ::ONE + ::ONE;
 }
 
 fn main() {
diff --git a/src/test/run-pass/syntax-extension-bytes.rs b/src/test/run-pass/syntax-extension-bytes.rs
index 8d5333e5b3fc5..1f92677fb6f89 100644
--- a/src/test/run-pass/syntax-extension-bytes.rs
+++ b/src/test/run-pass/syntax-extension-bytes.rs
@@ -11,15 +11,15 @@
 static static_vec: &'static [u8] = bytes!("abc", 0xFF, '!');
 
 pub fn main() {
-    let vec = bytes!("abc");
+    let vec: &'static [u8] = bytes!("abc");
     let expected: &[u8] = &[97_u8, 98_u8, 99_u8];
     assert_eq!(vec, expected);
 
-    let vec = bytes!("null", 0);
+    let vec: &'static [u8] = bytes!("null", 0);
     let expected: &[u8] = &[110_u8, 117_u8, 108_u8, 108_u8, 0_u8];
     assert_eq!(vec, expected);
 
-    let vec = bytes!(' ', " ", 32, 32u8);
+    let vec: &'static [u8] = bytes!(' ', " ", 32, 32u8);
     let expected: &[u8] = &[32_u8, 32_u8, 32_u8, 32_u8];
     assert_eq!(vec, expected);
 
diff --git a/src/test/run-pass/vector-sort-failure-safe.rs b/src/test/run-pass/vector-sort-failure-safe.rs
index 542f4dbdf2391..a8ab0e48ccf8a 100644
--- a/src/test/run-pass/vector-sort-failure-safe.rs
+++ b/src/test/run-pass/vector-sort-failure-safe.rs
@@ -11,7 +11,7 @@
 use std::task;
 use std::rand::{task_rng, Rng};
 
-static MAX_LEN: uint = 20;
+const MAX_LEN: uint = 20;
 static mut drop_counts: [uint, .. MAX_LEN] = [0, .. MAX_LEN];
 static mut clone_count: uint = 0;
 
diff --git a/src/test/run-pass/xcrate-unit-struct.rs b/src/test/run-pass/xcrate-unit-struct.rs
index f66caa5fbfc6e..7eb73968db5ef 100644
--- a/src/test/run-pass/xcrate-unit-struct.rs
+++ b/src/test/run-pass/xcrate-unit-struct.rs
@@ -11,7 +11,7 @@
 // aux-build:xcrate_unit_struct.rs
 extern crate xcrate_unit_struct;
 
-static s1: xcrate_unit_struct::Struct = xcrate_unit_struct::Struct;
+const s1: xcrate_unit_struct::Struct = xcrate_unit_struct::Struct;
 static s2: xcrate_unit_struct::Unit = xcrate_unit_struct::UnitVariant;
 static s3: xcrate_unit_struct::Unit =
                 xcrate_unit_struct::Argument(xcrate_unit_struct::Struct);