From ab826041528a92a6e8b326bb4b4432cc00629505 Mon Sep 17 00:00:00 2001 From: tdayris Date: Mon, 21 Sep 2020 09:16:53 +0200 Subject: [PATCH 01/36] [fix] (template): Missing code in wrappers' doc. Error #187 --- docs/generate_docs.py | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/docs/generate_docs.py b/docs/generate_docs.py index c471d06d2f9..446fe83a9e6 100644 --- a/docs/generate_docs.py +++ b/docs/generate_docs.py @@ -34,10 +34,10 @@ TOOL_TEMPLATE = Template(f.read()) with open(os.path.join(BASE_DIR, "_templates", "wrapper.rst")) as f: - TEMPLATE = Template(f.read()) + TEMPLATE_WRAPPER = Template(f.read()) with open(os.path.join(BASE_DIR, "_templates", "meta_wrapper.rst")) as f: - TEMPLATE = Template(f.read()) + TEMPLATE_META = Template(f.read()) def get_tool_dir(tool): @@ -88,7 +88,7 @@ def render_wrapper(path, target): name = meta["name"].replace(" ", "_") + ".rst" os.makedirs(os.path.dirname(target), exist_ok=True) with open(target, "w") as readme: - rst = TEMPLATE.render( + rst = TEMPLATE_WRAPPER.render( snakefile=snakefile, wrapper=wrapper, wrapper_lang=wrapper_lang, @@ -113,7 +113,7 @@ def render_meta(path, target): with open(os.path.join(path, "test", "Snakefile")) as snakefile: snakefile = textwrap.indent(snakefile.read(), " ").replace("master", TAG) - + wrappers = [] for uw in used_wrappers: wrapper = os.path.join(WRAPPER_DIR, uw, "wrapper.py") @@ -124,11 +124,11 @@ def render_meta(path, target): with open(wrapper) as wrapper: wrapper = textwrap.indent(wrapper.read(), " ") wrappers.append((wrapper, wrapper_lang, uw)) - + name = meta["name"].replace(" ", "_") + ".rst" os.makedirs(os.path.dirname(target), exist_ok=True) with open(target, "w") as readme: - rst = TEMPLATE.render( + rst = TEMPLATE_META.render( snakefile=snakefile, wrappers=wrappers, usedwrappers=used_wrappers, From ac4ac819fee80f7ed27b6b801aed37b76f0a84ef Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Tue, 11 Oct 2022 17:48:16 +0200 Subject: [PATCH 02/36] perf: update utils/datavzrd/environment.yaml. (#566) --- utils/datavzrd/environment.yaml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml index 0c9a1431057..ca8153a60ba 100644 --- a/utils/datavzrd/environment.yaml +++ b/utils/datavzrd/environment.yaml @@ -1,5 +1,5 @@ channels: - - conda-forge - - nodefaults +- conda-forge +- nodefaults dependencies: - - datavzrd =2.0 +- datavzrd =2.3.2 From 88c479c7a645478129de28bd8ce9842cc63bc549 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Tue, 11 Oct 2022 17:48:58 +0200 Subject: [PATCH 03/36] perf: update bio/bcftools/call/environment.yaml. (#567) --- bio/bcftools/call/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bio/bcftools/call/environment.yaml b/bio/bcftools/call/environment.yaml index 538f1a87f1b..d89e6b9cadf 100644 --- a/bio/bcftools/call/environment.yaml +++ b/bio/bcftools/call/environment.yaml @@ -3,5 +3,5 @@ channels: - bioconda - nodefaults dependencies: - - bcftools =1.14 - - snakemake-wrapper-utils =0.4 + - bcftools =1.16 + - snakemake-wrapper-utils =0.5.0 From 8d92bb553869d722a7d1e9dda25c725b74de3450 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Tue, 11 Oct 2022 17:49:11 +0200 Subject: [PATCH 04/36] perf: update bio/bcftools/concat/environment.yaml. (#568) --- bio/bcftools/concat/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bio/bcftools/concat/environment.yaml b/bio/bcftools/concat/environment.yaml index 538f1a87f1b..d89e6b9cadf 100644 --- a/bio/bcftools/concat/environment.yaml +++ b/bio/bcftools/concat/environment.yaml @@ -3,5 +3,5 @@ channels: - bioconda - nodefaults dependencies: - - bcftools =1.14 - - snakemake-wrapper-utils =0.4 + - bcftools =1.16 + - snakemake-wrapper-utils =0.5.0 From 1c444dc57592877fed4307de7bbde466d4bc8aeb Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Tue, 11 Oct 2022 18:53:13 +0200 Subject: [PATCH 05/36] perf: autobump bio/bcftools/index/environment.yaml (#570) * perf: update bio/bcftools/index/environment.yaml. * perf: update bio/bcftools/index/environment.yaml. * perf: update bio/bcftools/index/environment.yaml. --- bio/bcftools/index/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bio/bcftools/index/environment.yaml b/bio/bcftools/index/environment.yaml index 538f1a87f1b..d89e6b9cadf 100644 --- a/bio/bcftools/index/environment.yaml +++ b/bio/bcftools/index/environment.yaml @@ -3,5 +3,5 @@ channels: - bioconda - nodefaults dependencies: - - bcftools =1.14 - - snakemake-wrapper-utils =0.4 + - bcftools =1.16 + - snakemake-wrapper-utils =0.5.0 From 534f834b4267f3d6064625dca8efaa604daaac25 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 09:54:24 +0200 Subject: [PATCH 06/36] chore: release 1.15.1 (#569) Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com> --- CHANGELOG.md | 10 ++++++++++ 1 file changed, 10 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 3ee4a460036..7e630327cc0 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -1,5 +1,15 @@ # Changelog +### [1.15.1](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.0...v1.15.1) (2022-10-11) + + +### Performance Improvements + +* autobump bio/bcftools/index/environment.yaml ([#570](https://www.github.com/snakemake/snakemake-wrappers/issues/570)) ([bc77e03](https://www.github.com/snakemake/snakemake-wrappers/commit/bc77e037a0a086c1fede8cd54481426001460a13)) +* update bio/bcftools/call/environment.yaml. ([#567](https://www.github.com/snakemake/snakemake-wrappers/issues/567)) ([5c4356a](https://www.github.com/snakemake/snakemake-wrappers/commit/5c4356af4a2bcb288f4fe71169f97151df524d52)) +* update bio/bcftools/concat/environment.yaml. ([#568](https://www.github.com/snakemake/snakemake-wrappers/issues/568)) ([70685f1](https://www.github.com/snakemake/snakemake-wrappers/commit/70685f12db06ffe17f09aff7ecd258bcff27284a)) +* update utils/datavzrd/environment.yaml. ([#566](https://www.github.com/snakemake/snakemake-wrappers/issues/566)) ([a6f4ff8](https://www.github.com/snakemake/snakemake-wrappers/commit/a6f4ff88e1cf9949737de779b0cc8a56d749e374)) + ## [1.15.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.14.1...v1.15.0) (2022-10-11) From 7eb277c0f2cfeda2910deddd2d23ccc9791c3e0a Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 17:08:37 +0200 Subject: [PATCH 07/36] perf: update bio/bgzip/environment.yaml. (#577) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/bgzip/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/bgzip/environment.yaml b/bio/bgzip/environment.yaml index 7eed2f5823b..54ca0cec721 100644 --- a/bio/bgzip/environment.yaml +++ b/bio/bgzip/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - htslib ==1.12 + - htslib =1.16 From 63f8acbba81f926b63a36d6496ee668e60ed5099 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 17:09:03 +0200 Subject: [PATCH 08/36] perf: update bio/bellerophon/environment.yaml. (#576) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/bellerophon/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bio/bellerophon/environment.yaml b/bio/bellerophon/environment.yaml index 183b281d823..039e9257a30 100644 --- a/bio/bellerophon/environment.yaml +++ b/bio/bellerophon/environment.yaml @@ -4,5 +4,5 @@ channels: - nodefaults dependencies: - bellerophon =1.0 - - samtools =1.15 - - snakemake-wrapper-utils =0.4 + - samtools =1.16.1 + - snakemake-wrapper-utils =0.5.0 From 963bedf2fe0c66fa3241aaf079318d4aa005d5bd Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 17:16:50 +0200 Subject: [PATCH 09/36] perf: update bio/assembly-stats/environment.yaml. (#575) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/assembly-stats/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/assembly-stats/environment.yaml b/bio/assembly-stats/environment.yaml index b66f0990645..6fc2437545d 100644 --- a/bio/assembly-stats/environment.yaml +++ b/bio/assembly-stats/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - assembly-stats=1.0 + - assembly-stats =1.0.1 From ff74710cd1b7c9299a75cae5e53caf29f7da45dc Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 17:17:15 +0200 Subject: [PATCH 10/36] perf: update bio/adapterremoval/environment.yaml. (#573) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/adapterremoval/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/adapterremoval/environment.yaml b/bio/adapterremoval/environment.yaml index 103f6d80c8d..90c6cc76188 100644 --- a/bio/adapterremoval/environment.yaml +++ b/bio/adapterremoval/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - adapterremoval =2.3 + - adapterremoval =2.3.3 From bb60c16a434ef1e5ee10e16dfb00f698fcae1933 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Wed, 12 Oct 2022 22:43:01 +0200 Subject: [PATCH 11/36] chore: autobump conda envs (#571) * Add autobump action * fix paths * dbg * dbg branch * add checkout * dbg * trigger rerun * entity regex and add label * dbg * Update autobump.yml * Update autobump.yml --- .github/workflows/autobump.yml | 26 ++++++++++++++++++++++++++ .github/workflows/main.yml | 17 ++++++++--------- 2 files changed, 34 insertions(+), 9 deletions(-) create mode 100644 .github/workflows/autobump.yml diff --git a/.github/workflows/autobump.yml b/.github/workflows/autobump.yml new file mode 100644 index 00000000000..c283cc31ba7 --- /dev/null +++ b/.github/workflows/autobump.yml @@ -0,0 +1,26 @@ +name: Tests + +# TODO replace by nightly cron job +on: + schedule: + - cron: "0 0 * * 5" + +jobs: + autobump: + runs-on: ubuntu-latest + steps: + - uses: actions/checkout@v3 + + - uses: tibdex/github-app-token@v1 + id: generate-token + with: + app_id: ${{ secrets.SNAKEDEPLOY_BOT_APP_ID }} + private_key: ${{ secrets.SNAKEDEPLOY_BOT_PRIVATE_KEY }} + + - name: Update conda envs + uses: snakemake/snakedeploy-github-action@v1 + env: + GITHUB_TOKEN: ${{ steps.generate-token.outputs.token }} + with: + subcommand: update-conda-envs + args: "*/*/environment.yaml */*/*/environment.yaml --create-prs --entity-regex '(?P.+)/environment.yaml' --pr-add-label" diff --git a/.github/workflows/main.yml b/.github/workflows/main.yml index d98c071f643..9bf2756a55f 100644 --- a/.github/workflows/main.yml +++ b/.github/workflows/main.yml @@ -5,9 +5,8 @@ on: branches: - master pull_request: - branches_ignore: [] - schedule: - - cron: '0 0 * * 0' + branches: + - "*" jobs: docs: @@ -37,12 +36,12 @@ jobs: - name: Setup Snakemake environment run: | - # ensure that mamba is happy to write into the cache - sudo chown -R runner:docker /usr/share/miniconda/pkgs/cache - conda install -c conda-forge mamba --quiet - export PATH="/usr/share/miniconda/bin:$PATH" - mamba create -c bioconda -c conda-forge --quiet -y --name snakemake snakemake-minimal pytest - conda config --set channel_priority strict + # ensure that mamba is happy to write into the cache + sudo chown -R runner:docker /usr/share/miniconda/pkgs/cache + conda install -c conda-forge mamba --quiet + export PATH="/usr/share/miniconda/bin:$PATH" + mamba create -c bioconda -c conda-forge --quiet -y --name snakemake snakemake-minimal pytest + conda config --set channel_priority strict - name: Fetch master if: github.ref != 'refs/heads/master' From d9a7a6a07ab3ddd05bddd6eacfbbaf8df508f545 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:43:40 +0200 Subject: [PATCH 12/36] perf: update bio/delly/environment.yaml. (#584) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/delly/environment.yaml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/bio/delly/environment.yaml b/bio/delly/environment.yaml index 317555d323e..36236c9c4e5 100644 --- a/bio/delly/environment.yaml +++ b/bio/delly/environment.yaml @@ -3,6 +3,6 @@ channels: - bioconda - nodefaults dependencies: - - delly =1.1 - - bcftools =1.15 - - snakemake-wrapper-utils =0.5 + - delly =1.1.5 + - bcftools =1.16 + - snakemake-wrapper-utils =0.5.0 From e0220d24499a1ebf1171275f99b128ee5afe8273 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:44:10 +0200 Subject: [PATCH 13/36] perf: update bio/busco/environment.yaml. (#581) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/busco/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/busco/environment.yaml b/bio/busco/environment.yaml index cfe994795f7..87ce734f22b 100644 --- a/bio/busco/environment.yaml +++ b/bio/busco/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - busco =5.4 + - busco =5.4.3 From ae10993c0e9fe2d54b9fedb40d0cacd0aef0e0cd Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:44:32 +0200 Subject: [PATCH 14/36] perf: update bio/clustalo/environment.yaml. (#582) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/clustalo/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/clustalo/environment.yaml b/bio/clustalo/environment.yaml index a175ee25617..fb35b229793 100644 --- a/bio/clustalo/environment.yaml +++ b/bio/clustalo/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - clustalo ==1.2.4 + - clustalo =1.2.4 From 76c984548ecec43767c5a7f87dd1ecd9800ff981 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:47:32 +0200 Subject: [PATCH 15/36] perf: update bio/fastp/environment.yaml. (#585) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/fastp/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/fastp/environment.yaml b/bio/fastp/environment.yaml index 6917a8a91b7..ac25faab425 100644 --- a/bio/fastp/environment.yaml +++ b/bio/fastp/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - fastp =0.20 + - fastp =0.23.2 From 853a36dc2bd1ef297d3289785d21d6f1c4399354 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:48:04 +0200 Subject: [PATCH 16/36] perf: update bio/fastq_screen/environment.yaml. (#586) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/fastq_screen/environment.yaml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/bio/fastq_screen/environment.yaml b/bio/fastq_screen/environment.yaml index cd5d5b081f8..c718b52e1e9 100644 --- a/bio/fastq_screen/environment.yaml +++ b/bio/fastq_screen/environment.yaml @@ -3,6 +3,6 @@ channels: - bioconda - nodefaults dependencies: - - fastq-screen ==0.5.2 - - bowtie2 ==2.2.6 - - bowtie ==1.1.2 + - fastq-screen =0.15.2 + - bowtie2 =2.4.5 + - bowtie =1.3.1 From 576c54a8776d3007222d5f2a98c8be60a7faa195 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:48:28 +0200 Subject: [PATCH 17/36] perf: update bio/fasttree/environment.yaml. (#588) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/fasttree/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/fasttree/environment.yaml b/bio/fasttree/environment.yaml index 3df4697cf20..4ce2c611783 100644 --- a/bio/fasttree/environment.yaml +++ b/bio/fasttree/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - fasttree ==2.1.10 + - fasttree =2.1.11 From e473ff76012e3e67aff2ae6b4a4e841bf7a97e2b Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:48:47 +0200 Subject: [PATCH 18/36] perf: update bio/fastqc/environment.yaml. (#587) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/fastqc/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/fastqc/environment.yaml b/bio/fastqc/environment.yaml index 7e06869876b..6592b81aefa 100644 --- a/bio/fastqc/environment.yaml +++ b/bio/fastqc/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - fastqc ==0.11.9 + - fastqc =0.11.9 From 6f5f48f79ce8c1fcbc5547aa85f2f3c6d0a0f6f3 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:49:06 +0200 Subject: [PATCH 19/36] perf: update bio/filtlong/environment.yaml. (#589) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/filtlong/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/filtlong/environment.yaml b/bio/filtlong/environment.yaml index eb91090d49b..35b245cb7fc 100644 --- a/bio/filtlong/environment.yaml +++ b/bio/filtlong/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - filtlong =0.2 + - filtlong =0.2.1 From 5a1f5986710f8e1daa125b0959fe763362b99fb0 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:49:27 +0200 Subject: [PATCH 20/36] perf: update bio/freebayes/environment.yaml. (#590) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/freebayes/environment.yaml | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/bio/freebayes/environment.yaml b/bio/freebayes/environment.yaml index 8d7dd4b6e7d..17a442b2685 100644 --- a/bio/freebayes/environment.yaml +++ b/bio/freebayes/environment.yaml @@ -3,8 +3,8 @@ channels: - bioconda - nodefaults dependencies: - - freebayes =1.3.2 - - bcftools =1.11 - - parallel =20190522 - - bedtools >=2.29 - - sed =4.7 + - freebayes =1.3.6 + - bcftools =1.16 + - parallel =20220922 + - bedtools =2.30.0 + - sed =4.8 From f60db66ecd380614e74251cbbf60244a113d3c99 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:49:47 +0200 Subject: [PATCH 21/36] perf: update bio/genefuse/environment.yaml. (#591) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/genefuse/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/genefuse/environment.yaml b/bio/genefuse/environment.yaml index 3d74d5a4ad2..fb8ce202866 100644 --- a/bio/genefuse/environment.yaml +++ b/bio/genefuse/environment.yaml @@ -3,4 +3,4 @@ channels: - conda-forge - defaults dependencies: - - genefuse=0.6 + - genefuse =0.8.0 From cb6b6167b09c4fc271275129651c3a0f641956f7 Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:50:05 +0200 Subject: [PATCH 22/36] perf: update bio/genomepy/environment.yaml. (#592) Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> --- bio/genomepy/environment.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/genomepy/environment.yaml b/bio/genomepy/environment.yaml index 65b326bfc3d..9ebfc3d207a 100644 --- a/bio/genomepy/environment.yaml +++ b/bio/genomepy/environment.yaml @@ -3,4 +3,4 @@ channels: - bioconda - nodefaults dependencies: - - genomepy ==0.14 + - genomepy =0.14.0 From f618f0d24a99bc720febf72ae5b86a7999858bbf Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Wed, 12 Oct 2022 22:52:57 +0200 Subject: [PATCH 23/36] chore: release 1.15.2 (#578) Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com> --- CHANGELOG.md | 21 +++++++++++++++++++++ 1 file changed, 21 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 7e630327cc0..1b36ea309e4 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -1,5 +1,26 @@ # Changelog +### [1.15.2](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.1...v1.15.2) (2022-10-12) + + +### Performance Improvements + +* update bio/adapterremoval/environment.yaml. ([#573](https://www.github.com/snakemake/snakemake-wrappers/issues/573)) ([8cb0391](https://www.github.com/snakemake/snakemake-wrappers/commit/8cb03915ba46d0a7bf186b54882aa23c4b78f7ed)) +* update bio/assembly-stats/environment.yaml. ([#575](https://www.github.com/snakemake/snakemake-wrappers/issues/575)) ([2c12db0](https://www.github.com/snakemake/snakemake-wrappers/commit/2c12db04b2afae3e5ac1c56ee36baff66a8aff0e)) +* update bio/bellerophon/environment.yaml. ([#576](https://www.github.com/snakemake/snakemake-wrappers/issues/576)) ([fd06157](https://www.github.com/snakemake/snakemake-wrappers/commit/fd06157a4daec8fb6146bccb8925b00d025231e5)) +* update bio/bgzip/environment.yaml. ([#577](https://www.github.com/snakemake/snakemake-wrappers/issues/577)) ([36720ca](https://www.github.com/snakemake/snakemake-wrappers/commit/36720ca9a0d2c6093c7b8ebe26e0b78b5e90227b)) +* update bio/busco/environment.yaml. ([#581](https://www.github.com/snakemake/snakemake-wrappers/issues/581)) ([9825a5f](https://www.github.com/snakemake/snakemake-wrappers/commit/9825a5f882228f6a663408c21e9647ae31c00e53)) +* update bio/clustalo/environment.yaml. ([#582](https://www.github.com/snakemake/snakemake-wrappers/issues/582)) ([dc322c8](https://www.github.com/snakemake/snakemake-wrappers/commit/dc322c898466341a292b06354301f83f51c005cc)) +* update bio/delly/environment.yaml. ([#584](https://www.github.com/snakemake/snakemake-wrappers/issues/584)) ([0eb8ebc](https://www.github.com/snakemake/snakemake-wrappers/commit/0eb8ebc51a1f312836c4a3a7d3d2cfc16a4853c8)) +* update bio/fastp/environment.yaml. ([#585](https://www.github.com/snakemake/snakemake-wrappers/issues/585)) ([a573035](https://www.github.com/snakemake/snakemake-wrappers/commit/a573035813ba39d6bf47eb3bb9c5c68aecf074e0)) +* update bio/fastq_screen/environment.yaml. ([#586](https://www.github.com/snakemake/snakemake-wrappers/issues/586)) ([73a3d45](https://www.github.com/snakemake/snakemake-wrappers/commit/73a3d450ae1d7eff884eae89195758039aadd9c4)) +* update bio/fastqc/environment.yaml. ([#587](https://www.github.com/snakemake/snakemake-wrappers/issues/587)) ([9a0b30e](https://www.github.com/snakemake/snakemake-wrappers/commit/9a0b30e8131560d705c35d9a2eb68b986c743812)) +* update bio/fasttree/environment.yaml. ([#588](https://www.github.com/snakemake/snakemake-wrappers/issues/588)) ([b9b8a4e](https://www.github.com/snakemake/snakemake-wrappers/commit/b9b8a4e6ada4e3e2fcf6e266d7430ab51ab978eb)) +* update bio/filtlong/environment.yaml. ([#589](https://www.github.com/snakemake/snakemake-wrappers/issues/589)) ([3394085](https://www.github.com/snakemake/snakemake-wrappers/commit/33940856b332699f73410b5b49d6b387b817bd1b)) +* update bio/freebayes/environment.yaml. ([#590](https://www.github.com/snakemake/snakemake-wrappers/issues/590)) ([17c9581](https://www.github.com/snakemake/snakemake-wrappers/commit/17c95816b6158eb7c2db56bc1b7c257357359441)) +* update bio/genefuse/environment.yaml. ([#591](https://www.github.com/snakemake/snakemake-wrappers/issues/591)) ([63c620d](https://www.github.com/snakemake/snakemake-wrappers/commit/63c620d40435fc9306d0c5e63e06c79287e537c8)) +* update bio/genomepy/environment.yaml. ([#592](https://www.github.com/snakemake/snakemake-wrappers/issues/592)) ([4cfb29b](https://www.github.com/snakemake/snakemake-wrappers/commit/4cfb29b97770555af53b16523b14b033d0a1f2fb)) + ### [1.15.1](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.0...v1.15.1) (2022-10-11) From 141e09e7114641ecc94eb83bc394ee1f8e669af9 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Felix=20M=C3=B6lder?= Date: Thu, 13 Oct 2022 11:42:49 +0200 Subject: [PATCH 24/36] fix: set RG tag (#593) --- .../meta.yaml | 0 .../test/Snakefile | 1 + .../test/mapped/sampleA.marked.bam | Bin .../test/resources/genome.fa | 0 .../test/resources/genome.fa.amb | 0 .../test/resources/genome.fa.ann | 0 .../test/resources/genome.fa.bwt | Bin .../test/resources/genome.fa.pac | Bin .../test/resources/genome.fa.sa | Bin .../used_wrappers.yaml | 0 test.py | 2 +- 11 files changed, 2 insertions(+), 1 deletion(-) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/meta.yaml (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/Snakefile (98%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/mapped/sampleA.marked.bam (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.amb (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.ann (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.bwt (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.pac (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/test/resources/genome.fa.sa (100%) rename meta/bio/{rbt_calc_consensus => calc_consensus_reads}/used_wrappers.yaml (100%) diff --git a/meta/bio/rbt_calc_consensus/meta.yaml b/meta/bio/calc_consensus_reads/meta.yaml similarity index 100% rename from meta/bio/rbt_calc_consensus/meta.yaml rename to meta/bio/calc_consensus_reads/meta.yaml diff --git a/meta/bio/rbt_calc_consensus/test/Snakefile b/meta/bio/calc_consensus_reads/test/Snakefile similarity index 98% rename from meta/bio/rbt_calc_consensus/test/Snakefile rename to meta/bio/calc_consensus_reads/test/Snakefile index c67346e17e6..f1df2b95629 100644 --- a/meta/bio/rbt_calc_consensus/test/Snakefile +++ b/meta/bio/calc_consensus_reads/test/Snakefile @@ -29,6 +29,7 @@ rule map_consensus_reads: output: temp("results/consensus_mapped/{sample}.{read_type}.bam"), params: + extra=r"-R '@RG\tID:{sample}\tSM:{sample}'", index=lambda w, input: os.path.splitext(input.idx[0])[0], sort="samtools", sort_order="coordinate", diff --git a/meta/bio/rbt_calc_consensus/test/mapped/sampleA.marked.bam b/meta/bio/calc_consensus_reads/test/mapped/sampleA.marked.bam similarity index 100% rename from meta/bio/rbt_calc_consensus/test/mapped/sampleA.marked.bam rename to meta/bio/calc_consensus_reads/test/mapped/sampleA.marked.bam diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa b/meta/bio/calc_consensus_reads/test/resources/genome.fa similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa rename to meta/bio/calc_consensus_reads/test/resources/genome.fa diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.amb b/meta/bio/calc_consensus_reads/test/resources/genome.fa.amb similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.amb rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.amb diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.ann b/meta/bio/calc_consensus_reads/test/resources/genome.fa.ann similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.ann rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.ann diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.bwt b/meta/bio/calc_consensus_reads/test/resources/genome.fa.bwt similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.bwt rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.bwt diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.pac b/meta/bio/calc_consensus_reads/test/resources/genome.fa.pac similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.pac rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.pac diff --git a/meta/bio/rbt_calc_consensus/test/resources/genome.fa.sa b/meta/bio/calc_consensus_reads/test/resources/genome.fa.sa similarity index 100% rename from meta/bio/rbt_calc_consensus/test/resources/genome.fa.sa rename to meta/bio/calc_consensus_reads/test/resources/genome.fa.sa diff --git a/meta/bio/rbt_calc_consensus/used_wrappers.yaml b/meta/bio/calc_consensus_reads/used_wrappers.yaml similarity index 100% rename from meta/bio/rbt_calc_consensus/used_wrappers.yaml rename to meta/bio/calc_consensus_reads/used_wrappers.yaml diff --git a/test.py b/test.py index 5148b7e5d05..3b4304f8996 100644 --- a/test.py +++ b/test.py @@ -4851,6 +4851,6 @@ def test_collapse_reads_to_fragments_bam(): @skip_if_not_modified def test_calc_consensus_reads(): run( - "meta/bio/rbt_calc_consensus/", + "meta/bio/calc_consensus_reads/", ["snakemake", "--cores", "1", "--use-conda", "-F", "results/consensus/sampleA.bam"], ) \ No newline at end of file From 278f5086057b2c1c16e6f42c6c0830943483d24b Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Johannes=20K=C3=B6ster?= Date: Thu, 13 Oct 2022 11:45:20 +0200 Subject: [PATCH 25/36] Update conventional-prs.yml --- .github/workflows/conventional-prs.yml | 1 - 1 file changed, 1 deletion(-) diff --git a/.github/workflows/conventional-prs.yml b/.github/workflows/conventional-prs.yml index 9ee4613cc3f..c777f4b2de4 100644 --- a/.github/workflows/conventional-prs.yml +++ b/.github/workflows/conventional-prs.yml @@ -14,4 +14,3 @@ jobs: - uses: amannn/action-semantic-pull-request@v3.4.0 env: GITHUB_TOKEN: ${{ secrets.GITHUB_TOKEN }} - validateSingleCommit: true \ No newline at end of file From de6ce8530baa67eaa14474890018ea9bdaa808eb Mon Sep 17 00:00:00 2001 From: "snakedeploy-bot[bot]" <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Date: Thu, 13 Oct 2022 12:42:10 +0200 Subject: [PATCH 26/36] perf: autobump bio/deepvariant (#583) MIME-Version: 1.0 Content-Type: text/plain; charset=UTF-8 Content-Transfer-Encoding: 8bit Automatic update of bio/deepvariant. Co-authored-by: snakedeploy-bot[bot] <115615832+snakedeploy-bot[bot]@users.noreply.github.com> Co-authored-by: Johannes Köster --- bio/deepvariant/environment.yaml | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/bio/deepvariant/environment.yaml b/bio/deepvariant/environment.yaml index 983e6a53b4a..a8b89466955 100644 --- a/bio/deepvariant/environment.yaml +++ b/bio/deepvariant/environment.yaml @@ -1,6 +1,7 @@ channels: - conda-forge - bioconda + - nodefaults dependencies: - deepvariant =1.4 - - numpy + - numpy =1.23 From f9332c21e5781ce8adecf20913c1caa4bd86d265 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Christopher=20Schr=C3=B6der?= Date: Thu, 13 Oct 2022 13:59:03 +0200 Subject: [PATCH 27/36] feat: bazam wrapper (#580) ### Description ### QC * [x] I confirm that: For all wrappers added by this PR, * there is a test case which covers any introduced changes, * `input:` and `output:` file paths in the resulting rule can be changed arbitrarily, * either the wrapper can only use a single core, or the example rule contains a `threads: x` statement with `x` being a reasonable default, * rule names in the test case are in [snake_case](https://en.wikipedia.org/wiki/Snake_case) and somehow tell what the rule is about or match the tools purpose or name (e.g., `map_reads` for a step that maps reads), * all `environment.yaml` specifications follow [the respective best practices](https://stackoverflow.com/a/64594513/2352071), * wherever possible, command line arguments are inferred and set automatically (e.g. based on file extensions in `input:` or `output:`), * all fields of the example rules in the `Snakefile`s and their entries are explained via comments (`input:`/`output:`/`params:` etc.), * `stderr` and/or `stdout` are logged correctly (`log:`), depending on the wrapped tool, * temporary files are either written to a unique hidden folder in the working directory, or (better) stored where the Python function `tempfile.gettempdir()` points to (see [here](https://docs.python.org/3/library/tempfile.html#tempfile.gettempdir); this also means that using any Python `tempfile` default behavior works), * the `meta.yaml` contains a link to the documentation of the respective tool or command, * `Snakefile`s pass the linting (`snakemake --lint`), * `Snakefile`s are formatted with [snakefmt](https://github.com/snakemake/snakefmt), * Python wrapper scripts are formatted with [black](https://black.readthedocs.io). * Conda environments use a minimal amount of channels, in recommended ordering. E.g. for bioconda, use (conda-forge, bioconda, nodefaults, as conda-forge should have highest priority and defaults channels are usually not needed because most packages are in conda-forge nowadays). --- bio/bazam/environment.yaml | 7 ++++++ bio/bazam/meta.yaml | 10 +++++++++ bio/bazam/test/Snakefile | 28 ++++++++++++++++++++++++ bio/bazam/test/genome.fasta | 2 ++ bio/bazam/test/mapped/a.bam | Bin 0 -> 334 bytes bio/bazam/test/mapped/a.bam.bai | Bin 0 -> 24 bytes bio/bazam/test/mapped/a.cram | Bin 0 -> 955 bytes bio/bazam/test/mapped/a.cram.crai | Bin 0 -> 41 bytes bio/bazam/wrapper.py | 34 ++++++++++++++++++++++++++++++ test.py | 14 ++++++++++++ 10 files changed, 95 insertions(+) create mode 100644 bio/bazam/environment.yaml create mode 100644 bio/bazam/meta.yaml create mode 100644 bio/bazam/test/Snakefile create mode 100644 bio/bazam/test/genome.fasta create mode 100644 bio/bazam/test/mapped/a.bam create mode 100644 bio/bazam/test/mapped/a.bam.bai create mode 100644 bio/bazam/test/mapped/a.cram create mode 100644 bio/bazam/test/mapped/a.cram.crai create mode 100644 bio/bazam/wrapper.py diff --git a/bio/bazam/environment.yaml b/bio/bazam/environment.yaml new file mode 100644 index 00000000000..8ae1bbb412d --- /dev/null +++ b/bio/bazam/environment.yaml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda + - nodefaults +dependencies: + - bazam =1.0 + - snakemake-wrapper-utils ==0.5 \ No newline at end of file diff --git a/bio/bazam/meta.yaml b/bio/bazam/meta.yaml new file mode 100644 index 00000000000..2abe5a5d517 --- /dev/null +++ b/bio/bazam/meta.yaml @@ -0,0 +1,10 @@ +name: "bazam" +description: Bazam is a smarter way to realign reads from one genome to another. If you've tried to use Picard SAMtoFASTQ or samtools bam2fq before and ended up unsatisfied with complicated, long running inefficient pipelines, bazam might be what you wanted. Bazam will output FASTQ in a form that can stream directly into common aligners such as BWA or Bowtie2, so that you can quickly and easily realign reads without extraction to any intermediate format. Bazam can target a specific region of the genome, specified as a region or a gene name if you prefer. +url: https://github.com/ssadedin/bazam +authors: + - Christopher Schröder +input: + - BAM/CRAM file + - reference genome +output: + - fastq file diff --git a/bio/bazam/test/Snakefile b/bio/bazam/test/Snakefile new file mode 100644 index 00000000000..38464056209 --- /dev/null +++ b/bio/bazam/test/Snakefile @@ -0,0 +1,28 @@ +rule bazam_interleaved: + input: + bam="mapped/{sample}.bam", + bai="mapped/{sample}.bam.bai", + output: + reads="results/reads/{sample}.fastq.gz", + resources: + mem_mb=12000, + log: + "logs/bazam/{sample}.log", + wrapper: + "master/bio/bazam" + + +rule bazam_separated: + input: + bam="mapped/{sample}.cram", + bai="mapped/{sample}.cram.crai", + reference="genome.fasta", + output: + r1="results/reads/{sample}.r1.fastq.gz", + r2="results/reads/{sample}.r2.fastq.gz", + resources: + mem_mb=12000, + log: + "logs/bazam/{sample}.log", + wrapper: + "master/bio/bazam" diff --git a/bio/bazam/test/genome.fasta b/bio/bazam/test/genome.fasta new file mode 100644 index 00000000000..11d25dda641 --- /dev/null +++ b/bio/bazam/test/genome.fasta @@ -0,0 +1,2 @@ +>Sheila +GCTAGCTCAGAAAAAAAAAA diff --git a/bio/bazam/test/mapped/a.bam b/bio/bazam/test/mapped/a.bam new file mode 100644 index 0000000000000000000000000000000000000000..243bc19d34af48ee291f96ff4b05f4462a632d81 GIT binary patch literal 334 zcmb2|=3rp}f&Xj_PR>jWPZ&ZcIA$Mm5NK6jzG>m{e+@sGH=A)UP4&Mhwj{x6mVVQC708#?AP}U`1oyKV#WK9X_u8MeHcDHJ8iNwe_P`A^vxQ3tNlJ#<=NTW%wG0k z&aJ@fRpevit^Z?k`B?zKVs-IR~^ zA9l^&aF*@g?oHA^C*9eY(erzq|Gt;6*14u_p1$$eQ|A8N1x`wL`L_M&5((Uqd${UQ z+0iDKj|<*9W-51W&YY;m@PUEhvBU=!hV%r+H?8W73=HyUp7deZoRpC8gP+xhN6v|d zXCKcSk0c%-Xyb9x>*D1Rcp&lSjDR2zKarbyBB6ER?&&Od88&CF-B|++D0IW58JNKV G2qFLsfQxAW literal 0 HcmV?d00001 diff --git a/bio/bazam/test/mapped/a.bam.bai b/bio/bazam/test/mapped/a.bam.bai new file mode 100644 index 0000000000000000000000000000000000000000..a9b9979fed416428b1762d263d09d49bb00e5119 GIT binary patch literal 24 RcmZ>A^kigYKmaBv695vP0MP&d literal 0 HcmV?d00001 diff --git a/bio/bazam/test/mapped/a.cram b/bio/bazam/test/mapped/a.cram new file mode 100644 index 0000000000000000000000000000000000000000..0499f5980cb387f62bdc0e03c8516f00deb0bb1d GIT binary patch literal 955 zcmZ<`a`a_p&}F~`HyL4KOiT=oCd%re`aqFJ&BjOa-5e09|F!+Td4~){T3%k7^C`uTJoFzn^^u+2Fi#CqiYqTMr>FaMcVmv1#!rCzym)u){+ zr+K)ooU}dVPIzJDH0GWXlgX_bzJgyD{os3i&w+c-^^Gd>GapHBe`0#APyF+;PX`O* zA0LW{k=T`6u+^yd`L3dv$NW)pJ^X)8UpXgb<}ANqc8c?-PirPTNp8KHvZ=VL`-+tI zNfq0d=R-WzW-9nEek{0VqXRQfL)wIt!X_UU+5XEk_nNd#u*mWDV zb)D{iS+KAie00@qPsd82WB&sI zKLaBZ10N@2!;KrVcU2h}85+(uoRwe+abb51c8&;kW(f9`27w?yM#ligh8`g&H%3N& zXE$aRMrKBaARi#j&dA^x0HlGMgWMssFG!w=k-;yRnS&8*4Ui306A}zj69Uo;)Z^*L z%EZ9yl9}$f)WY2$2i|Npc4UGcxi7c_PdTb_NRbsWLqPx{!qjsFV?C z5(|j;0O)Ka5g>1_Gv^%!CI%fHxOdsvxOw>HV5%X)XtAUlVS1i{6)33B{^uhD3pWdk zA%h_UpV9mV1{NMZK2+7uW_Wfou<$c8`!@7mdHU=r1B)CVpQE$8yR%~ml$zq=Yrp_@ zATVn&y!-DV2;>1B2jYEJ<9o~xG!g8O2d@5ZAk!HcSohxa2U2Wopg>||c$duR4FJsz B^`-y- literal 0 HcmV?d00001 diff --git a/bio/bazam/test/mapped/a.cram.crai b/bio/bazam/test/mapped/a.cram.crai new file mode 100644 index 0000000000000000000000000000000000000000..b34400a88428f3344ef07241df382706c32385af GIT binary patch literal 41 scmb2|=3oE==1ZneOdgm#F)`ipz{JSpv5ATC6DAG=h9idYuY`dr0QyM`Q2+n{ literal 0 HcmV?d00001 diff --git a/bio/bazam/wrapper.py b/bio/bazam/wrapper.py new file mode 100644 index 00000000000..a9447429728 --- /dev/null +++ b/bio/bazam/wrapper.py @@ -0,0 +1,34 @@ +__author__ = "Christopher Schröder" +__copyright__ = "Copyright 2022, Christopher Schröder" +__email__ = "christopher.schroeder@tu-dortmund.de" +__license__ = "MIT" + +from snakemake.shell import shell +from snakemake_wrapper_utils.java import get_java_opts + +java_opts = get_java_opts(snakemake) + +log = snakemake.log_fmt_shell(stdout=False, stderr=True) +bam = snakemake.input.bam + +# Extra parameters default value is an empty string +extra = snakemake.params.get("extra", "") + +if bam.endswith(".cram"): + if not (reference := snakemake.input.get("reference", "")): + raise ValueError( + "input 'reference' is required when working with CRAM input files" + ) + reference_cmd = f"-Dsamjdk.reference_fasta={reference}" +else: + reference_cmd = "" + +# Extract arguments. +if reads := snakemake.output.get("reads", ""): + out_cmd = f"-o {reads}" +elif (r1 := snakemake.output.get("r1", "")) and (r2 := snakemake.output.get("r2", "")): + out_cmd = f"-r1 {r1} -r2 {r2}" +else: + raise ValueError("either 'reads' or 'r1' and 'r2' must be specified in output") + +shell("(bazam {java_opts} {reference_cmd} {extra} -bam {bam} {out_cmd}) {log}") diff --git a/test.py b/test.py index 3b4304f8996..575571f57e7 100644 --- a/test.py +++ b/test.py @@ -4853,4 +4853,18 @@ def test_calc_consensus_reads(): run( "meta/bio/calc_consensus_reads/", ["snakemake", "--cores", "1", "--use-conda", "-F", "results/consensus/sampleA.bam"], + ) + +@skip_if_not_modified +def test_bazam_interleaved(): + run( + "bio/bazam", + ["snakemake", "--cores", "1", "--use-conda", "-F", "results/reads/a.fastq.gz"], + ) + +@skip_if_not_modified +def test_bazam_separated(): + run( + "bio/bazam", + ["snakemake", "--cores", "1", "--use-conda", "-F", "results/reads/a.r1.fastq.gz"], ) \ No newline at end of file From 39c488da6354d2dc0e6c8924ecedabdd2bba2cb2 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Thu, 13 Oct 2022 14:04:37 +0200 Subject: [PATCH 28/36] chore: release 1.16.0 (#596) :robot: I have created a release \*beep\* \*boop\* --- ## [1.16.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.2...v1.16.0) (2022-10-13) ### Features * bazam wrapper ([#580](https://www.github.com/snakemake/snakemake-wrappers/issues/580)) ([17e58e6](https://www.github.com/snakemake/snakemake-wrappers/commit/17e58e6f254ce429b3b76b841df29b573949e278)) ### Bug Fixes * set RG tag ([#593](https://www.github.com/snakemake/snakemake-wrappers/issues/593)) ([506a083](https://www.github.com/snakemake/snakemake-wrappers/commit/506a08391b56d4b53edda2c6555b9b9d404d4f94)) ### Performance Improvements * autobump bio/deepvariant ([#583](https://www.github.com/snakemake/snakemake-wrappers/issues/583)) ([9b7c4fe](https://www.github.com/snakemake/snakemake-wrappers/commit/9b7c4feec69d05fc7d6286dcdfdc65802cb93317)) --- This PR was generated with [Release Please](https://github.com/googleapis/release-please). See [documentation](https://github.com/googleapis/release-please#release-please). Co-authored-by: github-actions[bot] <41898282+github-actions[bot]@users.noreply.github.com> --- CHANGELOG.md | 17 +++++++++++++++++ 1 file changed, 17 insertions(+) diff --git a/CHANGELOG.md b/CHANGELOG.md index 1b36ea309e4..802608bf48f 100644 --- a/CHANGELOG.md +++ b/CHANGELOG.md @@ -1,5 +1,22 @@ # Changelog +## [1.16.0](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.2...v1.16.0) (2022-10-13) + + +### Features + +* bazam wrapper ([#580](https://www.github.com/snakemake/snakemake-wrappers/issues/580)) ([17e58e6](https://www.github.com/snakemake/snakemake-wrappers/commit/17e58e6f254ce429b3b76b841df29b573949e278)) + + +### Bug Fixes + +* set RG tag ([#593](https://www.github.com/snakemake/snakemake-wrappers/issues/593)) ([506a083](https://www.github.com/snakemake/snakemake-wrappers/commit/506a08391b56d4b53edda2c6555b9b9d404d4f94)) + + +### Performance Improvements + +* autobump bio/deepvariant ([#583](https://www.github.com/snakemake/snakemake-wrappers/issues/583)) ([9b7c4fe](https://www.github.com/snakemake/snakemake-wrappers/commit/9b7c4feec69d05fc7d6286dcdfdc65802cb93317)) + ### [1.15.2](https://www.github.com/snakemake/snakemake-wrappers/compare/v1.15.1...v1.15.2) (2022-10-12) From 77a2f4c468c6a5d8a5ae1ce666a441efc34f6a7c Mon Sep 17 00:00:00 2001 From: tdayris Date: Tue, 11 Apr 2023 09:23:15 +0200 Subject: [PATCH 29/36] revert --- utils/datavzrd/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml index 3024650a12f..19eb1b9e578 100644 --- a/utils/datavzrd/environment.yaml +++ b/utils/datavzrd/environment.yaml @@ -1,5 +1,5 @@ channels: -- conda-forge -- nodefaults + - conda-forge + - nodefaults dependencies: - datavzrd =2.18.1 From 939082e86212ec58f64fc93e60c04bf43bb75db6 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 14 Apr 2023 13:52:40 +0200 Subject: [PATCH 30/36] revert --- utils/datavzrd/environment.yaml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/utils/datavzrd/environment.yaml b/utils/datavzrd/environment.yaml index 3024650a12f..19eb1b9e578 100644 --- a/utils/datavzrd/environment.yaml +++ b/utils/datavzrd/environment.yaml @@ -1,5 +1,5 @@ channels: -- conda-forge -- nodefaults + - conda-forge + - nodefaults dependencies: - datavzrd =2.18.1 From eaf34e547245d5a3b1c96c1320c4970eafbadc5e Mon Sep 17 00:00:00 2001 From: tdayris Date: Tue, 27 Aug 2024 15:13:06 +0200 Subject: [PATCH 31/36] feat: bwameth index --- .../index/environment.linux-64.pin.txt | 46 +++++++++++++++++++ bio/bwameth/index/environment.yaml | 7 +++ bio/bwameth/index/meta.yaml | 16 +++++++ bio/bwameth/index/test/Snakefile | 44 ++++++++++++++++++ bio/bwameth/index/test/genome.fasta | 2 + bio/bwameth/index/wrapper.py | 35 ++++++++++++++ test.py | 25 ++++++++++ 7 files changed, 175 insertions(+) create mode 100644 bio/bwameth/index/environment.linux-64.pin.txt create mode 100644 bio/bwameth/index/environment.yaml create mode 100644 bio/bwameth/index/meta.yaml create mode 100644 bio/bwameth/index/test/Snakefile create mode 100644 bio/bwameth/index/test/genome.fasta create mode 100644 bio/bwameth/index/wrapper.py diff --git a/bio/bwameth/index/environment.linux-64.pin.txt b/bio/bwameth/index/environment.linux-64.pin.txt new file mode 100644 index 00000000000..799bd84aca6 --- /dev/null +++ b/bio/bwameth/index/environment.linux-64.pin.txt @@ -0,0 +1,46 @@ +# This file may be used to create an environment using: +# $ conda create --name --file +# platform: linux-64 +@EXPLICIT +https://conda.anaconda.org/conda-forge/linux-64/_libgcc_mutex-0.1-conda_forge.tar.bz2#d7c89558ba9fa0495403155b64376d81 +https://conda.anaconda.org/conda-forge/linux-64/ca-certificates-2024.7.4-hbcca054_0.conda#23ab7665c5f63cfb9f1f6195256daac6 +https://conda.anaconda.org/conda-forge/linux-64/ld_impl_linux-64-2.40-hf3520f5_7.conda#b80f2f396ca2c28b8c14c437a4ed1e74 +https://conda.anaconda.org/conda-forge/noarch/tzdata-2024a-h8827d51_1.conda#8bfdead4e0fff0383ae4c9c50d0531bd +https://conda.anaconda.org/conda-forge/linux-64/libgomp-14.1.0-h77fa898_0.conda#ae061a5ed5f05818acdf9adab72c146d +https://conda.anaconda.org/conda-forge/linux-64/_openmp_mutex-4.5-2_gnu.tar.bz2#73aaf86a425cc6e73fcf236a5a46396d +https://conda.anaconda.org/conda-forge/linux-64/libgcc-ng-14.1.0-h77fa898_0.conda#ca0fad6a41ddaef54a153b78eccb5037 +https://conda.anaconda.org/conda-forge/linux-64/bzip2-1.0.8-h4bc722e_7.conda#62ee74e96c5ebb0af99386de58cf9553 +https://conda.anaconda.org/conda-forge/linux-64/c-ares-1.33.1-heb4867d_0.conda#0d3c60291342c0c025db231353376dfb +https://conda.anaconda.org/conda-forge/linux-64/keyutils-1.6.1-h166bdaf_0.tar.bz2#30186d27e2c9fa62b45fb1476b7200e3 +https://conda.anaconda.org/conda-forge/linux-64/libdeflate-1.21-h4bc722e_0.conda#36ce76665bf67f5aac36be7a0d21b7f3 +https://conda.anaconda.org/conda-forge/linux-64/libev-4.33-hd590300_2.conda#172bf1cd1ff8629f2b1179945ed45055 +https://conda.anaconda.org/conda-forge/linux-64/libexpat-2.6.2-h59595ed_0.conda#e7ba12deb7020dd080c6c70e7b6f6a3d +https://conda.anaconda.org/conda-forge/linux-64/libffi-3.4.2-h7f98852_5.tar.bz2#d645c6d2ac96843a2bfaccd2d62b3ac3 +https://conda.anaconda.org/conda-forge/linux-64/libnsl-2.0.1-hd590300_0.conda#30fd6e37fe21f86f4bd26d6ee73eeec7 +https://conda.anaconda.org/conda-forge/linux-64/libstdcxx-ng-14.1.0-hc0a3c3a_0.conda#1cb187a157136398ddbaae90713e2498 +https://conda.anaconda.org/conda-forge/linux-64/libuuid-2.38.1-h0b41bf4_0.conda#40b61aab5c7ba9ff276c41cfffe6b80b +https://conda.anaconda.org/conda-forge/linux-64/libxcrypt-4.4.36-hd590300_1.conda#5aa797f8787fe7a17d1b0821485b5adc +https://conda.anaconda.org/conda-forge/linux-64/libzlib-1.2.13-h4ab18f5_6.conda#27329162c0dc732bcf67a4e0cd488125 +https://conda.anaconda.org/conda-forge/linux-64/ncurses-6.5-he02047a_1.conda#70caf8bb6cf39a0b6b7efc885f51c0fe +https://conda.anaconda.org/conda-forge/linux-64/openssl-3.3.1-hb9d3cd8_3.conda#6c566a46baae794daf34775d41eb180a +https://conda.anaconda.org/conda-forge/linux-64/xz-5.2.6-h166bdaf_0.tar.bz2#2161070d867d1b1204ea749c8eec4ef0 +https://conda.anaconda.org/bioconda/linux-64/bwa-mem2-2.2.1-hd03093a_5.tar.bz2#a8de1b9c3db53f3436e06f86997b5316 +https://conda.anaconda.org/conda-forge/linux-64/libedit-3.1.20191231-he28a2e2_2.tar.bz2#4d331e44109e3f0e19b4cb8f9b82f3e1 +https://conda.anaconda.org/conda-forge/linux-64/libnghttp2-1.58.0-h47da74e_1.conda#700ac6ea6d53d5510591c4344d5c989a +https://conda.anaconda.org/conda-forge/linux-64/libsqlite-3.46.0-hde9e2c9_0.conda#18aa975d2094c34aef978060ae7da7d8 +https://conda.anaconda.org/conda-forge/linux-64/libssh2-1.11.0-h0841786_0.conda#1f5a58e686b13bcfde88b93f547d23fe +https://conda.anaconda.org/conda-forge/linux-64/perl-5.32.1-7_hd590300_perl5.conda#f2cfec9406850991f4e3d960cc9e3321 +https://conda.anaconda.org/conda-forge/linux-64/readline-8.2-h8228510_1.conda#47d31b792659ce70f470b5c82fdfb7a4 +https://conda.anaconda.org/conda-forge/linux-64/tk-8.6.13-noxft_h4845f30_101.conda#d453b98d9c83e71da0741bb0ff4d76bc +https://conda.anaconda.org/conda-forge/linux-64/zstd-1.5.6-ha6fb4c9_0.conda#4d056880988120e29d75bfff282e0f45 +https://conda.anaconda.org/bioconda/linux-64/bwa-0.7.18-he4a0461_1.tar.bz2#4ecde7d4a03fabe440a90aea1389d62d +https://conda.anaconda.org/conda-forge/linux-64/krb5-1.21.3-h659f571_0.conda#3f43953b7d3fb3aaa1d0d0723d91e368 +https://conda.anaconda.org/conda-forge/linux-64/python-3.12.3-hab00c5b_0_cpython.conda#2540b74d304f71d3e89c81209db4db84 +https://conda.anaconda.org/conda-forge/linux-64/libcurl-8.8.0-hca28451_1.conda#b8afb3e3cb3423cc445cf611ab95fdb0 +https://conda.anaconda.org/conda-forge/noarch/setuptools-72.2.0-pyhd8ed1ab_0.conda#1462aa8b243aad09ef5d0841c745eb89 +https://conda.anaconda.org/bioconda/noarch/toolshed-0.4.6-pyh864c0ab_3.tar.bz2#61065996a8b60a54d5350427f51a54f3 +https://conda.anaconda.org/conda-forge/noarch/wheel-0.44.0-pyhd8ed1ab_0.conda#d44e3b085abcaef02983c6305b84b584 +https://conda.anaconda.org/bioconda/linux-64/htslib-1.20-h5efdd21_2.tar.bz2#f0923cdb85b44dc77bdead8018645ea9 +https://conda.anaconda.org/conda-forge/noarch/pip-24.2-pyhd8ed1ab_0.conda#6721aef6bfe5937abe70181545dd2c51 +https://conda.anaconda.org/bioconda/linux-64/samtools-1.20-h50ea8bc_1.tar.bz2#1a4c52f8079fea1b18b3e4bd329bab3a +https://conda.anaconda.org/bioconda/noarch/bwameth-0.2.7-pyh7cba7a3_0.tar.bz2#ab1318507241aab310382b26aaf429e2 diff --git a/bio/bwameth/index/environment.yaml b/bio/bwameth/index/environment.yaml new file mode 100644 index 00000000000..22ad7716083 --- /dev/null +++ b/bio/bwameth/index/environment.yaml @@ -0,0 +1,7 @@ +channels: + - conda-forge + - bioconda + - nodefaults +dependencies: + - bwameth =0.2.7 + - bwa-mem2 =2.2.1 diff --git a/bio/bwameth/index/meta.yaml b/bio/bwameth/index/meta.yaml new file mode 100644 index 00000000000..ef3b122b560 --- /dev/null +++ b/bio/bwameth/index/meta.yaml @@ -0,0 +1,16 @@ +name: bwa-meth index +url: https://github.com/brentp/bwa-meth?tab=readme-ov-file#index +description: > + Index a reference sequence for future BS-Seq mapping. +authors: + - Thibault Dayris +input: + - Path to reference fasta file. +output: + - List of paths to index files. +params: + - use_bwa_mem_2: Either `True` (use bwa-mem2) or `False` (use bwa-mem, default behaviour). +notes: > + While bwa-meth explicitely writes the index alongside the reference file, this wrapper lets user freely chose the output directory. + + No optional arguments allowed while indexing. diff --git a/bio/bwameth/index/test/Snakefile b/bio/bwameth/index/test/Snakefile new file mode 100644 index 00000000000..d860906ea1b --- /dev/null +++ b/bio/bwameth/index/test/Snakefile @@ -0,0 +1,44 @@ +rule test_bwameth_index_mem: + input: + "genome.fasta", + output: + multiext( + "genome.fasta.bwameth", + ".c2t", + ".c2t.amb", + ".c2t.ann", + ".c2t.bwt", + ".c2t.pac", + ".c2t.sa", + ), + cache: True # save space and time with between workflow caching (see docs) + threads: 1 + params: + subcommand="index", + log: + "bwameth_index.log", + wrapper: + "master/bio/bwameth/index" + + +rule test_bwameth_index_mem2: + input: + "genome.fasta", + output: + multiext( + "genome.fasta.bwameth", + ".c2t", + ".c2t.amb", + ".c2t.ann", + ".c2t.bwt.2bit.64", + ".c2t.pac", + ".c2t.0123", + ), + cache: True # save space and time with between workflow caching (see docs) + threads: 1 + params: + subcommand="index-mem2", + log: + "bwameth_index.log", + wrapper: + "master/bio/bwameth/index" diff --git a/bio/bwameth/index/test/genome.fasta b/bio/bwameth/index/test/genome.fasta new file mode 100644 index 00000000000..308e288c979 --- /dev/null +++ b/bio/bwameth/index/test/genome.fasta @@ -0,0 +1,2 @@ +>Sheila +GCTAGCTCAGAAAAAAAAAA \ No newline at end of file diff --git a/bio/bwameth/index/wrapper.py b/bio/bwameth/index/wrapper.py new file mode 100644 index 00000000000..46c1d8d50f4 --- /dev/null +++ b/bio/bwameth/index/wrapper.py @@ -0,0 +1,35 @@ +# coding: utf-8 + +"""Snakemake wrapper for BWA-Meth index""" + +__author__ = "Thibault Dayris" +__mail__ = "thibault.dayris@gustaveroussy.fr" +__copyright__ = "Copyright 2024, Thibault Dayris" +__license__ = "MIT" + +import os +import os.path + +from tempfile import TemporaryDirectory +from snakemake import shell + +log = snakemake.log_fmt_shell(stdout=True, stderr=True, append=True) + +subcommand = snakemake.params.get("subcommand", "index") + +with TemporaryDirectory() as tempdir: + # Create symlink to avoid bwa-meth index to be written next to the input reference file + ref_basename = os.path.basename(snakemake.input[0]) + used_reference = os.path.join(tempdir, ref_basename) + os.symlink(os.path.abspath(snakemake.input[0]), os.path.join(tempdir, ref_basename)) + + # Find user-defined reference directory + prefix = os.path.commonprefix([os.path.abspath(f) for f in snakemake.output]) + out_dir = os.path.dirname(prefix) + + # Run bwameth index command + shell("bwameth.py {subcommand} {used_reference} {log}") + + # Return index file to user where they expect them + os.unlink(used_reference) + shell("mv -v {used_reference}.bwameth.c2t* {out_dir} {log}") diff --git a/test.py b/test.py index e2cce1175ab..5b94f6738b7 100644 --- a/test.py +++ b/test.py @@ -458,6 +458,31 @@ def test_sickle_se(): ], ) +@skip_if_not_modified +def test_bwameth_index(): + run( + "bio/bwameth/index", + [ + "snakemake", + "--cores", + "1", + "--use-conda", + "-F", + "genome.fasta.bwameth.c2t.sa", + ], + ) + run( + "bio/bwameth/index", + [ + "snakemake", + "--cores", + "1", + "--use-conda", + "-F", + "genome.fasta.bwameth.c2t.0123", + ], + ) + @skip_if_not_modified def test_bwa_memx_index(): From e8ad777709310df95028ada50c1f5041dd628da7 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 30 Aug 2024 09:14:57 +0200 Subject: [PATCH 32/36] Aligner autodetection --- bio/bwameth/index/meta.yaml | 3 +-- bio/bwameth/index/test/Snakefile | 4 ---- bio/bwameth/index/wrapper.py | 5 ++++- 3 files changed, 5 insertions(+), 7 deletions(-) diff --git a/bio/bwameth/index/meta.yaml b/bio/bwameth/index/meta.yaml index ef3b122b560..815a7cca906 100644 --- a/bio/bwameth/index/meta.yaml +++ b/bio/bwameth/index/meta.yaml @@ -9,8 +9,7 @@ input: output: - List of paths to index files. params: - - use_bwa_mem_2: Either `True` (use bwa-mem2) or `False` (use bwa-mem, default behaviour). + No optional argument used, everything is handled by the wrapper. notes: > While bwa-meth explicitely writes the index alongside the reference file, this wrapper lets user freely chose the output directory. - No optional arguments allowed while indexing. diff --git a/bio/bwameth/index/test/Snakefile b/bio/bwameth/index/test/Snakefile index d860906ea1b..02a084c69b7 100644 --- a/bio/bwameth/index/test/Snakefile +++ b/bio/bwameth/index/test/Snakefile @@ -13,8 +13,6 @@ rule test_bwameth_index_mem: ), cache: True # save space and time with between workflow caching (see docs) threads: 1 - params: - subcommand="index", log: "bwameth_index.log", wrapper: @@ -36,8 +34,6 @@ rule test_bwameth_index_mem2: ), cache: True # save space and time with between workflow caching (see docs) threads: 1 - params: - subcommand="index-mem2", log: "bwameth_index.log", wrapper: diff --git a/bio/bwameth/index/wrapper.py b/bio/bwameth/index/wrapper.py index 46c1d8d50f4..a168ac35bab 100644 --- a/bio/bwameth/index/wrapper.py +++ b/bio/bwameth/index/wrapper.py @@ -15,7 +15,10 @@ log = snakemake.log_fmt_shell(stdout=True, stderr=True, append=True) -subcommand = snakemake.params.get("subcommand", "index") +# Automatic detection of aligner based on one output file +subcommand = "index" +if any(str(outfile).endswith(".0123"): + subcommand = "index-mem2" with TemporaryDirectory() as tempdir: # Create symlink to avoid bwa-meth index to be written next to the input reference file From 2aefa9ed89aaf466780be22495b1768c479dd1b7 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 30 Aug 2024 09:16:41 +0200 Subject: [PATCH 33/36] Black --- bio/bwameth/index/wrapper.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/bwameth/index/wrapper.py b/bio/bwameth/index/wrapper.py index a168ac35bab..d24ebb77011 100644 --- a/bio/bwameth/index/wrapper.py +++ b/bio/bwameth/index/wrapper.py @@ -17,7 +17,7 @@ # Automatic detection of aligner based on one output file subcommand = "index" -if any(str(outfile).endswith(".0123"): +if any(str(outfile).endswith(".0123") for outfile in snakemake.output): subcommand = "index-mem2" with TemporaryDirectory() as tempdir: From ec78fd9459a3f5e0f09205b9d28fdd60c5b492c6 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 30 Aug 2024 09:26:11 +0200 Subject: [PATCH 34/36] black --- bio/bwameth/index/wrapper.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/bwameth/index/wrapper.py b/bio/bwameth/index/wrapper.py index d24ebb77011..36bfd94e599 100644 --- a/bio/bwameth/index/wrapper.py +++ b/bio/bwameth/index/wrapper.py @@ -18,7 +18,7 @@ # Automatic detection of aligner based on one output file subcommand = "index" if any(str(outfile).endswith(".0123") for outfile in snakemake.output): - subcommand = "index-mem2" + subcommand = "index-mem2" with TemporaryDirectory() as tempdir: # Create symlink to avoid bwa-meth index to be written next to the input reference file From 9338e8b354b925647ca0202807da9b4cad9ac0f8 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 30 Aug 2024 09:36:36 +0200 Subject: [PATCH 35/36] Update bio/bwameth/index/meta.yaml Co-authored-by: Filipe G. Vieira <1151762+fgvieira@users.noreply.github.com> --- bio/bwameth/index/meta.yaml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/bio/bwameth/index/meta.yaml b/bio/bwameth/index/meta.yaml index 815a7cca906..e741c5b0dc1 100644 --- a/bio/bwameth/index/meta.yaml +++ b/bio/bwameth/index/meta.yaml @@ -1,5 +1,5 @@ name: bwa-meth index -url: https://github.com/brentp/bwa-meth?tab=readme-ov-file#index +url: https://github.com/brentp/bwa-meth description: > Index a reference sequence for future BS-Seq mapping. authors: From 677c9e488757c76d6c0c2d8c8f67aaa7930db4a1 Mon Sep 17 00:00:00 2001 From: tdayris Date: Fri, 30 Aug 2024 09:38:15 +0200 Subject: [PATCH 36/36] Change prefix and ensure out_dir is not empty --- bio/bwameth/index/wrapper.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/bio/bwameth/index/wrapper.py b/bio/bwameth/index/wrapper.py index 36bfd94e599..12239a55212 100644 --- a/bio/bwameth/index/wrapper.py +++ b/bio/bwameth/index/wrapper.py @@ -27,8 +27,8 @@ os.symlink(os.path.abspath(snakemake.input[0]), os.path.join(tempdir, ref_basename)) # Find user-defined reference directory - prefix = os.path.commonprefix([os.path.abspath(f) for f in snakemake.output]) - out_dir = os.path.dirname(prefix) + prefix = os.path.commonprefix(snakemake.output) + out_dir = os.path.dirname(prefix) or "./" # Run bwameth index command shell("bwameth.py {subcommand} {used_reference} {log}")