Macro: Not a full names of monomers are previewed in nucleotide sequence representation after paste as sequence or FASTA file

[Zhirnoff]

Steps to Reproduce
Case1 (Paste FASTA)

1. Switch to macro
2. Select sequence layout mode
3. Paste FASTA file

>BD190087.1 WO 2003008584-A/4: Human antibody against IgE receptor and the antibody fragment thereof
CACGTTATACTGACTCAACCGCCCTCAGTGTCCGTGTCTCCAGGACAGACTGCCAGGATCCCCTGTTCGG
GACAAGACCTGACCAACAAATATGTCTCTTGGTATCAACTGCAGTCAGGCCAGTCACCTGCGCTGGTCAT
CTATGAGGACTCAAAGAGGCCCTCAGGGATCCCTGAGCGCTTCTCTGGCTCCAACTCTGGAGACACAGCC
ACTCTGACCATCACCGGGACCCAGGCTGCGGATGAGGCTGACTTTTTCTGTCAGGCGTACGACACCAACG
GTTGGGTGTTCGGCGCAGGGACCAAGCTGACCGTCCTAGGT

4. Hover over any letter in sequence

Case2 (Paste Sequence)

1. Switch to macro
2. Select sequence layout mode
3. Paste any sequence for RNA or DNA ( for example ACTGU)
4. Hover over any letter in sequence

Actual behavior
Not a full names of monomers are previewed in nucleotide sequence representation
Note: When we add sequences on the canvas in editing mode, we see previews of monomers with full names.

Expected behavior
Full names of monomers are previewed in nucleotide sequence representation as described in #3876

Screenshots

2024-03-19_10h06_26.mp4

Desktop (please complete the following information):

• OS: Windows 11
• Browser Chrome
• Version 112.0.5615.138 (Official Build) (64-bit)

Ketcher version
[Version 2.20.0-rc.1]

[ViktoriaTkacheva]

When opening a Ket file Macro sequence.zip, incomplete names of nucleotide components are displayed in the preview in Flex mode. When switching to Sequence mode, incomplete names are also displayed

[AlexeyGirin]

Moved to indigo - epam/Indigo#1801

[Zhirnoff]

Bug is fixed on Indigo side epam/Indigo#1801