beam_3.jsonl

{"article": "symmetry transitions are common during embryogenesis of all multicellular organisms [ 14 ] . in most cases ,\nthe transition is from radial to bilateral symmetry and controlled by hox and decapentaplegic genes in animals [ 5 , 6 ] .\nin fact , the echinoderms provide the only reported example in which this order is reversed such that the radially symmetric animal develops from a bilaterally symmetric larvae stage [ 7 , 8 ] . in the model plant\narabidopsis thaliana , the gynoecium is derived from the fusion of two carpels and forms in the center of the flower . during gynoecium development , the apical style becomes radially symmetric with stigmatic papillae arising   ( figure  1a and figures s1a  s1c available online ) , suggesting the existence of a switch from bilateral to radial symmetry .\ngiven that the arabidopsis gynoecium originates from two fused leaves [ 11 , 12 ] , it is likely that factors involved in specifying leaf margin tissue are also regulated in the gynoecium . although margin identity genes may have a role in defining margins in the bilaterally symmetric ovary , we would expect such activities to be repressed in the style to achieve radial symmetry .\nkluh ( klu ) is a margin - identity gene expressed in peripheral cells of arabidopsis petals and in the marginal tissue of the gynoecium .\nexpression of klu::gus was detected along the entire length of developing gynoecia at stage 9 ( figure  1b ) but lost at the style of the mature gynoecium ( stage 12 in figure  1c ; developmental stages defined in ) .\nmutations in the spatula ( spt ) gene lead to a failure in radial symmetry establishment at the style   ( figures 1d and s1d  s1f ) .\ninterestingly , in the spt-12 mutant , klu::gus was still expressed in the apical medial part throughout gynoecium development ( figure  1e ) .\nthese results suggest that the bilateral - to - radial transition occurring during style formation requires transcriptional repression of margin - identity genes .\nwhen the spt mutant is combined with mutations in the indehiscent ( ind ) gene , the effect on style and stigma development is significantly enhanced reflecting the synergistic activities of these two basic helix - loop - helix transcription factors ( figures 1j and s1g  s1i ) . in the wild - type gynoecium\n, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules , whereas the style is a rounded , compact , and radially symmetric structure ( figures 1g1i ) .\nspt and ind spt have defects in septum formation but maintain bilateral symmetry in the ovary ( figures 1j , 1l , s1j , and s1l ) .\nthe style in these mutants fails to acquire radial symmetry showing that ind and spt are required to ensure radial symmetry establishment at the gynoecium apex ( figures 1k and s1k ) .\nklu expression was found to be significantly upregulated in spt and ind spt mutants ( figure  1f ) and downregulated in a 35s::ind : gr line   induced by dexamethasone ( dex ) ( figure  s1n ) .\nthis is in agreement with a role of ind and spt in promoting radial symmetry , at least partially , by repressing margin identity .\nwe next tested whether ind and spt are sufficient to establish radial symmetry in an alternative developmental context such as a bilaterally symmetric flat leaf . to this end ,\nthe dex - inducible 35s::ind : gr line was grown on medium supplemented with dex . after 15  days , completely radialized leaves emerged as rod - like and cup - like structures ( figures 1 m , 1o , and s1 m ) .\nnotably , the epidermal cell shape of these radialized leaves is reminiscent of the shape of style cells ( figure  1s and inset 1s ) , which is in contrast to the normal jigsaw - shaped leaf epidermal cells from noninduced plants ( figure  1q ) .\nconversely , anatomical analyses of the internal cell types in cross - sections suggest that ind overexpression reprograms only the marginal cells ( figures s1p , s1r , s1 t , and s1v ) .\nthe ind - driven organ radialization was completely dependent on the presence of spt function , because the effect was lost in the spt-12 mutant background ( figures 1n , 1p , 1r , 1 t , s1q , s1s , s1u , and s1w ) .\naltogether , these results show that both ind and spt are necessary and sufficient for mediating organ radialization . during gynoecium development , auxin distribution\ntwo apical foci of the auxin - signaling reporter , dr5::gfp , are established in the lateral apical domains at early stages ( 5/6 ) of organ development ( figures 2a and 2b ) .\nsubsequently , two medial foci emerge at stage 8/9 ( figures 2c and 2d ; movie s1 ) , and immediately prior to formation of the style ( stage 10 ) , all four foci are connected in an auxin ring of radial symmetry ( figures 2e and 2f ) .\nthis pattern mimics the transition of bilateral - to - radial symmetry suggesting a role for the spatiotemporal dynamics of auxin in symmetry establishment .\nwe initially tested if the auxin - signaling foci are established by local auxin production .\nthe tryptophane aminotransferase of arabidopsis1 ( taa1 ) gene encodes an auxin - biosynthesis enzyme and is expressed in the same region as spt during early stages of gynoecium development ( figures s2a and s2b ) .\ntaa1 and its closest homolog tar2 likely regulate auxin dynamics in the gynoecium , because the taa1 tar2 double mutant exhibits a split - style phenotype .\nwe conducted the expression analysis of a taa1::taa1:gfp line concomitantly with dr5::rfp to correlate the dynamics of auxin production and auxin signaling in  vivo . early in development , expression of these two reporters is nonoverlapping with dr5::rfp in the apical lateral part and taa1::taa1:gfp in the medial region ( figure  s2b ) . at stage 9\n, there is overlap in the medial region with taa1::taa1:gfp expanding to the lateral adaxial side ( figure  s2c ) .\nbecause the dr5::rfp signal in the lateral foci appears before the taa1::taa1:gfp signal , it is unlikely that the two lateral auxin - signaling foci are established by local auxin synthesis .\nnext , we analyzed if auxin transport is involved in establishing the auxin - signaling foci .\nthe pin1 gene encodes a plasma membrane ( pm ) localized member of the pin auxin efflux family that directs polar auxin transport ( pat ) via their asymmetric subcellular localization [ 19 , 20 ] .\npin1 protein is located apically in cells of the ovary presumably to direct auxin flux from the base to the top of the developing gynoecium   ( figure  2 g ) . at the apex , pin1 localization becomes apolar primarily in the medial part of the gynoecium ( figure  2h ) .\npin1-mediated auxin transport is therefore likely to contribute to the specific pattern of auxin distribution at the apex . indeed , in gynoecia from a weak pin1 mutant allele ( pin1 - 5 ) , the intensity of the two lateral dr5::gfp foci are severely reduced and apical - basal polarity defects are detected ( figures s2d  s2f ) .\nan identical effect occurs in plants with mutations in the pinoid ( pid ) gene encoding an agc3-type protein kinase that promotes apical pin localization at the pm by phosphorylating specific serine residues in pin proteins [ 2124 ] ( figures 2 m , 2n , 2s , and 2u ) .\nindeed , mutations in two of those specific serine residues ( pin1:gfp s1,3a )   lead to apolar distribution of pin1 along the gynoecium ( figure  2i ) and apical - basal growth defects similar to the weak pid-8 mutant   ( figures 2 t and 2u ) . moreover , this growth - defective phenotype is reminiscent of treatment with the pat inhibitor npa [ 26 , 27 ] .\nanother member of the pin family , pin3 is initially confined to a few laterally positioned apical cells ( figure  2j ) overlapping with the lateral dr5::gfp foci ( figure  2a ) .\nlater , pin3 is detected throughout the apex in the same domain as dr5::gfp ( figures 2f and 2k ) with apolar localization of the protein ( figures 2j and 2k ) .\na third pin member , pin7 , is localized apolarly in a few medially positioned apical cells from around stage 7 ( figure  2l ) , presumably joining the activity of pin1 in establishing the medial foci . at later stages\n, pin7 is found throughout the apex sustaining the ring formation similarly to pin3 ( figure  s2 g ) .\nexpression and localization of pin1/pin3/pin7 suggests that pat mediates the transition from a bilaterally to a radially distributed auxin response ( figures 2a , 2b , 2e , and 2f ) .\nthe requirement for apolarly localized pins to establish the radial auxin maximum at the gynoecium apex resembles the apolar localization of pin4 around the quiescent center cells of the root apical meristem and its precursor cells during embryogenesis [ 28 , 29 ] . in this tissue ,\npin4 is necessary for the proper positioning of the auxin - response maximum at the embryo stem cell niche . to address the role of the lateral and medial pairs of auxin - signaling foci\n, we tested dr5 expression dynamics in mutants with defects in either apical - basal growth or style development .\ndr5::gfp in pin1 - 5 and dr5::rfp in pid-8 mutants showed a drastically decreased signal in the lateral foci , whereas the auxin ring appeared normally , thus correlating with radial style formation ( figures 2 m , 2n , 2p , 2q , 2u , and s2d  s2f ) .\nas in many organ - development processes , gynoecium growth along the apical - basal polarity axis follows the direction of auxin flux , directing growth toward the two lateral auxin foci providing cell and tissue polarity . in agreement with the reduced lateral dr5 signals , pin1 - 5 and\npid-8 mutants show apical - basal growth defects ( figures 2u and s2d ) . therefore , the two lateral foci are important to ensure apical - basal growth of the two carpels . in mutants with defects in the bilateral - to - radial symmetry transition ,\nthe two lateral dr5 foci are correctly established early during gynoecium development , and these mutants have no apparent apical - basal defects ( figures 2v , s1j , and s2h ) .\nin contrast , the medial dr5 foci were not established in these mutant backgrounds ( figures 2o and s2i ) and the dr5 ring fails to form ( figures 2r and s2j ) .\nthe lack of dr5::rfp in spt-12 is unlikely to be due to lack of auxin biosynthesis , because taa1::taa1:gfp is still expressed in spt-12 ( figure  s2k ) .\nthese results suggest that the medial auxin - signaling foci promote the bilateral - to - radial symmetry switch . in agreement with this ,\nthe medial dr5 foci form normally in pid-8 gynoecia with no defect in establishing the dr5 ring and correlating with formation of a radial style ( figures 2n and 2q ) .\nit was previously shown that spt and ind directly repress pid expression [ 15 , 16 ] .\naccordingly , we found that a pid::gus reporter was ectopically expressed in the style region of the spt-12 mutant compared to wild - type ( figures 3a and 3b ) .\nthe importance of apolar pin1 localization was analyzed by expressing a version of pin1 that mimics constitutive phosphorylation of the three serine residues targeted by pid ( pin1:gfp s1,2,3e ) in the pin1 mutant background .\ngynoecia from this line exhibited a split - style phenotype similar to the spt-12 mutant ( figures 1d , 3c , and 3f ) .\ninterestingly pin1:gfp s1,2,3e protein could not be detected at the apex as opposed to a nonmutated pin1:gfp version ( figures 3d and 3e ) , suggesting that apical localization renders pin1 unstable in this tissue .\nconsistent with defective pin1:gfp s1,2,3e protein localization , dr5::rfp was not detected in the medial foci of pin1:gfp s1,2,3e pin1 ( figure  3i ) but only in the lateral foci , thereby resembling dr5 distribution in spt and ind spt mutants ( figures 2o , 2r , and s2h  s2j ) .\nthese results suggest that pid - mediated phosphorylation of pin1 is sufficient to prevent radial symmetry .\nas expected , loss of pin1 phosphorylation had no effect on radial symmetry establishment , because constitutive apolar localization of the pin1:gfp s1,3a mutant protein sustains apolar auxin flux ( figures 3 g , 3h , s3a , and s3b ) .\ntogether , these results show that apolar localization of pin1 is required for radial style formation .\nwe next tested the developmental relevance of the sequential appearance of the lateral and medial pairs of foci .\nthe gynoecium phenotype resulting from crosses between pid loss - of - function mutants and spt-12 was analyzed to distinguish between two possible scenarios : ( 1 ) if activity of the medial foci is sufficient for radial symmetry establishment , complementation of the spt split - style phenotype was expected by eliminating pid function and ( 2 ) if the role of lateral foci is functionally upstream of the medial foci , a failure to establish radial style development was expected in the double mutant .\nanalysis of the pid-8 spt-12 and pid-9 spt-12 double mutants revealed a strong enhancement of the spt-12 phenotype and a complete failure in radial symmetry establishment .\nthis result is in agreement with the second scenario and suggests that the lateral foci are required to support the role of the medial foci during style development ( figures 3j , s3e , and s3f ) . to study whether the split - style phenotype in spt gynoecia is due to a failure of spt in controlling auxin transport in the medial apex , we introgressed the pin1::pin1:gfp s1,3a loss - of - phosphorylation mutant into spt-12 . here\n, the background was kept wild - type for the endogenous pin1 gene to sustain formation of the lateral foci and promote apical - basal growth .\ngynoecia from this genetic combination exhibited complete restoration of the split defect with perfectly radialized styles ( figures 3k , s3c , and s3 g ) .\nthis was dependent on wild - type endogenous pin1 in the background , because gynoecia from the pin1::pin1:gfp s1,3a spt-12 pin1 triple combination phenocopied spt pid double mutant gynoecia ( figures 3j and 3l ) .\nas with the spt pid double mutants , this triple combination was unable to sustain the apical - basal growth , thus affecting the activity of the lateral foci and enhancing the spt phenotype ( figures 3l , s3d , and s3h ) .\noverall , these results show that spt ( and ind ) controls radiality at the gynoecium apex by controlling auxin transport , thus governing auxin flux in the medial region of the style .\nthey also reveal that activity of the medial foci is linked to and dependent on the lateral auxin - signaling foci .\nthe functional relation between the lateral and medial auxin - signaling foci described here is closely aligned with the stereotypical stages occurring during gynoecium development . as indicated in figure  4 ,\nthe early function of the lateral foci is to sustain apical - basal growth allowing to build up the ovary .\nsubsequently , at stages 8 and 9 , in order to obtain a radialized apical style , spt and ind establish the medial foci by directly repressing pid expression [ 15 , 16 ] , thus sustaining apolar pin localization and auxin accumulation ( figure  4 ) .\nit is unknown what stimulates expression of the ind / spt module , but it is an intriguing possibility that a feedback mechanism exists between ind / spt and auxin . finally , we hypothesize that a long - distance signal is required to connect the different foci in a radial auxin - signaling maximum to achieve a switch in cell polarity and thus orchestrating the coordinated growth of the radial style to facilitate fertilization .\nexcellent progress has been made in understanding how auxin provides polarity and identity to cells in a range of developmental contexts .\nthe example presented here demonstrates that auxin can also be recruited to coordinate a heterogeneous group of cells to commit to a program , which imposes homogeneous identity to them .\nthis activity leads to an unusual developmental bilateral - to - radial symmetry transition in the arabidopsis style .\nthe radial style is a general feature of the female reproductive organ in angiosperms , which arose during the cretaceous period 100125 million years ago .\nthe early angiosperms underwent a remarkably rapid diversification and have since reached ecological domination in the plant kingdom in terms of number of species ( > 300,000 ) a phenomenon that charles darwin referred to as  the abominable mystery  . because a radial style is necessary to facilitate efficient fertilization , radialization of the style may have been a key event in allowing the success of flowering plants .\nconceived the hypothesis and planned the experiments , l.m . carried out the experimental work , and l.m . and l. .", "human": " summarysymmetry formation is a remarkable feature of biological life forms associated with evolutionary advantages and often with great beauty . \n several examples exist in which organisms undergo a transition in symmetry during development  [ 14 ] . \n such transitions are almost exclusively in the direction from radial to bilateral symmetry [ 58 ] . here \n , we describe the dynamics of symmetry establishment during development of the arabidopsis gynoecium . \n we show that the apical style region undergoes an unusual transition from a bilaterally symmetric stage ingrained in the gynoecium due to its evolutionary origin to a radially symmetric  structure . \n we also identify two transcription factors , indehiscent [ 9 ] and spatula [ 10 ] , that are both necessary and sufficient for the radialization process . \n our work furthermore shows that these two transcription factors control style symmetry by directly regulating auxin distribution . \n establishment of specific auxin - signaling foci and the subsequent development of a radially symmetric auxin ring at the style are required for the transition to radial symmetry , because genetic manipulations of auxin transport can either cause loss of radialization in a wild - type background or rescue mutants with radialization defects . whereas many examples have described how auxin provides polarity and specific identity to cells in a range of developmental contexts , our data presented here demonstrate that auxin can also be recruited to impose uniform identity to a group of cells that are otherwise differentially programmed . ", "section_names": "Results and Discussion\nAuthor Contributions", "bigbird_pegasus": "<s> summary symmetry transitions are common during embryogenesis of all multicellular organisms. in most cases,<n> the transition is from radial to bilateral symmetry and is controlled by hox and decapentaplegic genes in animals [ 1, 2 ].<n> however, the model plant arabidopsis thaliana develops from a bilaterally symmetric style with stigmatic papillae arising during gynoecium development [ 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 ]. given that the arabidopsis gynoecium originates from two fused leaves [ 13 ], it is likely that factors involved in specifying leaf margin tissue are also regulated in the gynoecium.<n> although margin identity genes may have a role in defining margins in the bilaterally symmetric ovary, we would expect such activities to be repressed in the style to achieve radial symmetry. here<n>, we show that the transition from bilateral to radial symmetry in the gynoecium requires transcriptional repression of margin - identity genes in the style.<n> in addition, we provide evidence that two basic helix - loop - helix transcription factors, spatula ( spt ) and indehiscent ( ind ), are required for radial symmetry establishment in the gynoecium.</s>", "longt5": "<pad> the radial style is a general feature of the female reproductive organ in angiosperms. during gynoecium development, the apical style becomes radially symmetric with stigmatic papillae arising. during gynoecium development, the apical style becomes radially symmetric with stigmatic papillae arising. during gynoecium development, the apical style becomes radially symmetric with stigmatic papillae arising. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a curved, compact, and radially symmetric structure. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a curved, compact, and radially symmetric structure. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a radially symmetric structure. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a radially symmetric structure. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a radially symmetric structure. in the wild - type gynoecium, the ovary has a bilateral symmetry plane in which the septum divides the ovary into two separate locules, whereas the style is a radially symmetric structure"}
{"article": "be that as it may , 5% of all cases of syncope are usually of cardiac origins and are thus known as cardiac syncope .\npulmonary embolism is a relatively rare cause of cardiac syncope , which may explain why it is frequently ignored.1 the variability of presentation sets the patient and clinician up for potentially missing the diagnosis .\npresentation with abrupt onset of pleuritic chest pain , shortness of breath , and hypoxia is rarely the case .\nstudies of patients who die unexpectedly of pulmonary embolism reveal that they complained of nagging symptoms often for weeks before death related to pulmonary embolism .\nforty percent of these patients had been seen by a physician in the weeks prior to their death.2 when syncope is the presenting symptom of pulmonary embolism , it should raise the clinical suspicion for a massive clot burden or saddle embolism requiring prompt treatment .\na 52-year - old man was referred to our hospital because of two episodes of syncope within a fortnight .\nhe had suffered from pleuritic chest pain and dry coughs for the previous two weeks , and antibiotics prescribed for pneumonia by an internist failed to prevent the exacerbation of the symptoms .\nthe internist subsequently referred the patient to a cardiologist , who subjected him to an exercise stress test ( to rule out coronary artery disease ) , during which he developed non - sustained ventricular tachycardia .\nthe following day , he suffered a one - minute syncope while talking a walk in his yard .\nhe was , therefore , once more referred to our hospital by the internist to evaluate ventricular tachycardia as a cause of syncope .\nwhen the patient arrived at our hospital , he had anxiety and had a respiratory rate of 30/min , pulse rate of 120/min , and supine blood pressure of 100/60 mmhg . additionally , the patient s lungs were clear and his heart sound and lower limb were normal .\nchest x - ray revealed mild cardiomegaly , dilated right descending pulmonary artery , and oligemia in the right lung ( figure 1 ) . on echocardiography ,\nthe left ventricle was normal ; however , the right heart was dilated and trabeculated and there was also right ventricular dysfunction .\nthe patient denied any history of deep vein thrombosis and mentioned only a six - hour car travel more than three weeks earlier .\nhis family history for venous thromboembolism was weakly positive and one of his nephews had a history of pulmonary thromboembolism .\nat this point , lung ct angiography was performed to rule out pulmonary embolism as the main cause of acute right ventricular enlargement .\nthe ct angiography demonstrated bilateral pulmonary artery thrombosis from the first division of the right and left pulmonary arteries to the distal ones ( figures 2 & 3 ) . with a diagnosis of pulmonary embolism , the patient underwent thrombolytic therapy with recombinant tissue plasminogen activator ( r - tpa ) 100 mg over a 90-minute period , which brought about immediate improvement in the patient s condition .\nthe following day , his symptoms improved dramatically , his respiratory rate decreased , his o2 saturation rose from 85% to 98% , and his blood pressure remained stable in different positions .\nct angiography showed improved right ventricular function and decreased right ventricular size and pulmonary arteries ( figures 4&5 ) .\nthe diagnosis of acute pulmonary embolism is amongst the most challenging problems encountered in clinical practice . despite the awareness amongst physicians of the risks associated with a delay in the diagnosis of pulmonary embolism ,\nit was not initially considered in this case because of the following reasons : firstly , syncope is an uncommon presentation of pulmonary embolism , occurring in only 14% of patients .\nthe most common symptoms are dyspnea ( 82% ) , pleuritic chest pain ( 49% ) , and cough ( 20%).3 secondly , the patient had no history of deep vein thrombosis .\nthe exact number of the symptoms and signs of deep vein thrombosis in patients with a diagnosis of pulmonary embolism is not clear , but one study reported deep vein thrombosis in 62% of patients with pulmonary embolism.4 and thirdly , our patient had severe right ventricular enlargement with severe trabeculations .\nthe occurrence of non - sustained ventricular tachycardia in the exercise test gave rise to other diagnoses , including arrhythmogenic right ventricular dysplasia , which justifies the syncope and right ventricular dilation .\nalthough arrhythmogenic right ventricular dysplasia is more common in younger patients , we considered it as one possible diagnosis because of the patient s having developed non - sustained ventricular tachycardia during the exercise test and his dilated right ventricle with trabeculations.5 the patient experienced three episodes of presyncope in the ccu , but his rhythm during these episodes was sinus bradycardia .\nwe concluded that ventricular tachycardia was not the mechanism of syncope / presyncope and performed ct angiography to confirm pulmonary embolism as the culprit for the syncope .\nthe patient had a weak family history of pulmonary embolism , hinting at the presence of hypercoagulable states such as activated protein c ( apc ) resistance , factor v leiden , anti thrombin iii deficiency , and protein c and s deficiency .\nfor the evaluation of hypercoagulable states , family history remains the most rapid and cost - effective method of identifying a predisposition to venous thrombosis.6 whereas management with anticoagulants alone is typically sufficient for low - risk patients , more aggressive treatments such as thrombolysis , embolectomy , and inferior vena cava ( ivc ) filters are recommended for higher - risk patients .\nthrombolytic therapy should be considered in all patients with massive pulmonary embolism and hypotension associated with deep vein thrombosis in the popliteal area or higher.7 the main indications for thrombolytic therapy include ongoing hypoxia , respiratory distress , pulmonary hypertension , and right heart failure because thrombolytic therapy often achieves an impressive and almost an immediate clinical benefit in these clinical settings.8 the patient s right ventricular failure and progressive course prompted us to candidate him for thrombolysis .\nthe other option in management would have been embolectomy , which is performed either with a catheter or during open heart surgery .\nembolectomy via open surgery is reported to have improved the survival rate to 89% in twenty - nine emergent pulmonary embolism cases.9 although interventional catheter - based catheter fragmentation and suction embolectomy are also available for pulmonary embolectomy in some institutions , open surgical embolectomy is indicated in patients who have contraindications to thrombolytic therapy , persistence of thrombi in the right heart or pulmonary arteries after pulmonary embolism , or severe hemodynamic compromise with cardiovascular collapse .\nearly surgical treatment must also be considered in patients whose course deteriorates in spite of aggressive medical therapy depending on the series .\nthe overall mortality rate after pulmonary embolectomy varies from 16% to 46% , with a mean mortality rate of 26% .\nthese findings suggest that earlier surgical intervention may result in improved survival.10 we can conclude that surgical embolectomy is warranted in patients with severe hemodynamic instability on the basis of clinical impression , after other causes of hemodynamic collapse have been ruled out .\nan experimental catheter embolectomy used in cardiac catheterization appears promising.11 ivc filters are an appropriate option for patients with high bleeding risks . the insertion rate of ivc filters has increased in recent years ; this increase , however , has occurred without proven improved safety and efficiency.12 another important point in the management of this patient was the optimal duration of anticoagulation . despite the fact that the patient had a weak family history of hypercoagulable states , a proper course of action required his management as a case of idiopathic venous thromboemboli and with an indefinite duration of oral anticoagulant ( warfarin ) therapy.13", "human": " a pulmonary embolus clogs the artery that provides blood supply to a part of the lung . \n the embolus not only prevents the exchange of oxygen and carbon dioxide but also decreases blood supply to the lung tissue itself , potentially causing the tissue to die ( infarct ) . a 52-year - old man presented with syncope and anxiety \n . \n he had sinus tachycardia and dilated right ventricle with trabeculations . \n a differential diagnosis of arrhythmogenic right ventricular dysplasia and pulmonary embolism prompted ct angiography , which revealed a bilateral massive pulmonary embolism . \n the patient was treated successfully with thrombolytic drugs . ", "section_names": "Introduction\nCase report\nDiscussion", "bigbird_pegasus": "<s> a 52-year - old man was referred to our hospital because of two episodes of syncope within a fortnight.<n> he had suffered from pleuritic chest pain and dry coughs for the previous two weeks, and antibiotics prescribed for pneumonia by an internist failed to prevent the exacerbation of the symptoms.<n> the following day, he suffered a one - minute syncope while talking a walk in his yard.<n> he was, therefore, once more referred to our hospital by the internist to evaluate ventricular tachycardia as a cause of syncope. when syncope is the presenting symptom of pulmonary embolism, it should raise the clinical suspicion for a massive clot burden or saddle embolism requiring prompt treatment.</s>", "longt5": "<pad> pulmonary embolism is a relatively rare cause of cardiac syncope, which may explain why it is frequently ignored. the variability of presentation sets the patient and clinician up for potentially missing the diagnosis. we report a case of syncope in a 52-year - old man who was referred to our hospital because of two episodes of syncope within a fortnight. he had suffered from pleuritic chest pain and dry coughs for the previous two weeks and antibiotics prescribed for pneumonia by an internist failed to prevent the exacerbation of the symptoms. he was subsequently referred to our hospital by an internist to evaluate ventricular tachycardia as a cause of syncope. chest x - ray revealed mild cardiomegaly, dilated right descending pulmonary artery, and oligemia in the right lung. on echocardiography, the left ventricle was normal ; however, the right heart was dilated and trabeculated and there was also right ventricular dysfunction. the patient denied any history of deep vein thrombosis and mentioned only a six - hour car travel more than three weeks earlier. a diagnosis of pulmonary embolism was made by the patient underwent thrombolytic therapy with recombinant tissue plasminogen activator 100 mg over a 90-minute period, which brought about immediate improvement in the patient s condition. the following day, his symptoms improved dramatically, his respiratory rate decreased, his o2 saturation rose from 85% to 98%, and his blood pressure remained stable in different positions. a proper course of action required his management as a case of idiopathic venous thromboemboli and an indefinite duration of oral anticoagulant therapy.</s>"}
{"article": "\n aspergillus species are ascomycetes that are classified in the form subdivision deuteromycotina , as many of them do not show a sexual reproductive phase .\ngenerally , they are common ubiquitous saprophytes in soil and on dead organic substrates . being classic opportunistic pathogens , invasive infections by aspergillus species almost exclusively develop in immunocompromised patients , while localized infections and allergic bronchopulmonary aspergillosis occur in individuals without immunosuppression . generally , the species aspergillus fumigatus represents the most common inducer of invasive and allergic manifestations , followed by a. terreus , a. flavus , and a. niger [ 1 , 2 ] .\ninvasive aspergillosis ( ia ) considerably contributes to the morbidity and mortality among immunocompromised individuals , including patients with haematological malignancies , recipients of haematological stem cell and solid organ transplants , aids patients , and patients treated with immunosuppressive regimens due to autoimmune diseases .\nthe most important single risk factor is prolonged and profound neutropenia ( < 500 neutrophils/l for more than 10 days ) [ 1 , 46 ] . over the last decades ,\ninvasive fungal infections , particularly aspergillosis , have become more frequent due to a higher number of immunocompromised patients ( new chemotherapy regimens , increasing number of solid organ transplant recipients , and immunosuppressive regimens ) and extended survival time in hiv patients ( haart therapy ) [ 1 , 79 ] .\non the side of the pathogen , several characteristics and various putative virulence factors that may facilitate the infection have been described for a. fumigatus .\nit differs from nonpathogenic species by its growth at 37c ; furthermore , it is rapidly growing and has very small conidiospores ( 35  m ) .\nthese include melanin and a hydrophobic protein - coat layer on the surface of conidia that may help to protect them against recognition , ingestion and/or elimination by complement and phagocytes [ 1014 ] .\nvarious proteases that may help to pass tissue barriers and to degrade proteins of the immune response are secreted by the fungus [ 1517 ] , and mycotoxins like gliotoxin might also contribute to undermine the host defence [ 1820 ] .  \nthe most important path of aspergillus infections is via inhalation of the conidia into the respiratory tract .\nas conidia of pathogenic aspergillus species are very small , they can be inhaled deeply into the lung and even into the pulmonary alveoli . in immunocompetent individuals , conidia are effectively phagocytosed and eliminated by alveolar macrophages and infiltrating neutrophils [ 12 , 21 , 22 ] , but in the case of immunologic deficits ,\nthey are able to germinate and to penetrate the lung tissue , thus causing an invasive pulmonary aspergillosis . infections of the lung are the by far most frequent type of ia . by penetration of blood vessels\n, aspergillus can disseminate and invade other organs , including the heart , the liver , and the central nervous system ( cns ) .\ncerebral aspergillosis occurs in 10%20% of all cases of ia and thus is the most common extrapulmonary form .\nneuropathologic features include hemorrhagic infarcts and/or necrosis , vascular thrombosis , meningitis , granuloma , and formation of solitary as well as multiple abscesses [ 6 , 2325 ] . according to the division of bacterial and mycotic diseases ( dbmd ) , the incidence of aspergillosis is 1 - 2 per 100,000 per year .\nincidence rates of ia in high - risk populations depend on the respective group and rise up to 24% in patients with prolonged and profound neutropenia .\nfurthermore , ia is the most expensive opportunistic infection in immunosuppressed patients , with annual treating costs in europe of approximately  200 million . in -\nhospital stays complicated by ia cause additional costs of  75,000 per patient .   despite antimycotic therapy and surgical interventions ,\nthe fatality of ia is high and depends on the degree of immunosuppression and on the affected organs . without treatment , the mortality is nearly 100% , while under treatment the overall case - fatality rate is nearby 60% and rises to more than 90% in cases of cns aspergillosis [ 1 , 6 , 26 ] .\ncomplement consists of approximately 30 fluid - phase and membrane - bound proteins that cooperate to form the cascade .\nregulatory factors control and modulate its activity , and cellular receptors mediate the interaction between complement factors and immune cells . representing a potent component of the innate host defence and an interface to adaptive immunity\nthe most outstanding roles are the direct and indirect defence against infections , the stimulation and regulation of b- and t - cell response , and the disposal of debris [ 2731 ] .\nhepatocytes are the main producers of complement factors ; however , several other cell types participate in the synthesis .\nactivation of the complement system is triggered by a multiplicity of  danger signals ,  such as pathogen - associated molecular patterns ( pamps ) , antigen / antibody complexes , and the presence of transformed cells , apoptotic cells , or cell debris .\nthree different activation pathways start the complement cascade , all of them resulting in the cleavage of the central complement factor c3 by proteolytic enzyme complexes ( c3 convertases ) , and subsequently leading to the common terminal pathway ( figure 1 ) . in the classical pathway , binding of complement factor c1q to immunoglobulin class g or m ( igg , igm ) of antigen - antibody complexes represents the initial step .\nalternatively , the globular heads of c1q can interact with microbial surfaces that had been covered by pentraxins , a class of soluble pattern recognition molecules .\nthe thereby induced conformational changes of c1q subsequently activate the associated proteases c1r and c1s , which cleave the factors c4 and c2 .\nthe resulting fragments form the c3 convertase c4b2a .   in the lectin pathway , foreign carbohydrate molecules on the surface of pathogens are recognized by mannose - binding lectin ( mbl ) or the related ficolins .\nmbl - associated serine proteases ( masps ) cleave c4 and c2 , and the fragments build up the c3 convertase c4b2a , which is identically equal to the one of the classical pathway .\nficolin-2 can also interact with pentraxin - covered microbes , thus starting the lectin pathway in an alternative manner .\ninterestingly , mbl was recently described to support c3 cleavage by a c2 bypass mechanism , which results in activation of the alternative pathway .\nthe alternative pathway is triggered via activating foreign surfaces and creates an amplification loop by spontaneous reaction of c3 with h2o ( c3(h2o ) ) ; alternatively , c3b generated by the other pathways represents the starting trigger .\nsurface - bound c3b associates with factor b , which is then cleaved by the plasma serine protease factor d. these steps result in the formation of the c3 convertase c3bbb [ 27 , 36 ] .  \nproteolytic cleavage of c3 by one of the c3 convertases is the common and central step of all three activation pathways .\nthis split generates the fragments c3a and c3b , which are two important components that mediate a multitude of complement functions ( see below ) .\nthe product c3b associates with the c3 convertases , thus forming the c5 convertases , which cleave factor c5 into c5a and c5b .\nthis step initiates a chain of assembly processes of the proteins c6 , c7 , c8 , and c9 .\nthe bound and polymerized c9 units create the terminal complement complex ( tcc ) that can form a pore in the target lipid bilayer , called membrane attack complex ( mac ) . targeted\ncells , bacteria and viruses die or are inactivated by efficient disruption of the membrane integrity [ 31 , 37 ] . beneath the mac formation and direct pathogen destruction\n, complement displays several additional antimicrobial mechanisms aiming to neutralize invading microbes and to restore body homeostasis .\nsurface - bound c3b undergoes internal cleavage steps ; the derived products ic3b , c3d , and further , coat and label the pathogens for phagocytosis ( opsonization ) .\neffector cells with specific membrane - bound complement receptors ( crs ) recognize the opsonizing complement fragments , ingest the labeled pathogens , and eliminate them .\nfurthermore , the interaction of the opsonized particles with cr - bearing immune cells results in their activation and their increased proliferation .\nthe receptor cr3 , a heterodimer of cd11b and cd18 , is regarded to be the most important mediator for complement - driven phagocytosis .\nbeing expressed on phagocytes like dendritic cells , neutrophils , macrophages , and microglia , it interacts with ic3b on the pathogen [ 27 , 38 ] .\nthe complement receptors cr3 and cr4 allow adhesion of cells to cells of the same and other cell types , respectively , ( homotypic and heterotypic adhesion ) .\nimmune cells can bind via these receptors to their ligands on endothelium of the blood vessels , a prerequisite for penetration through the vessel wall into the tissue and migration to the site of infection and inflammation .\nsurface - bound ic3b can be further cleaved proteolytically to generate the opsonizing fragment c3d .\nbinding of c3d - opsonised pathogens to the corresponding complement receptor cr2 ( cd35 ) on b cells induces cross - linkage with the b cell receptor complex , a process that lowers the threshold for b cell activation by the specific antigen by several orders of magnitude .\ncleavage of c3 and c5 generate the potent anaphylatoxins c3a and c5a , respectively , which exert several biological functions by binding to their corresponding cellular receptors c3ar , c5ar ( cd88 ) , and c5l2 .\nthey provoke chemotactic attraction of immune cells to the site of infection and an increase of vascular permeability [ 40 , 41 ] . furthermore , c3a and c5a trigger an efficient proinflammatory response by stimulating cytokine synthesis and secretion [ 40 , 41 ] .\nvarious cell types harboring the corresponding anaphylatoxin receptors on their surface react on ligand binding with cell activation , stimulation of cell specific signaling pathways , or of oxidative burst [ 27 , 42 ] .  \nthe complement cascade needs a tight control to prevent host damage by cell / tissue lysis and excessive inflammation .\na variety of both soluble and membrane - bound regulators can influence all steps of the complement cascade , with the c3/c5 convertases as main control targets [ 27 , 37 , 4345 ] . under normal conditions\n, these regulators should protect all body cells against auto - attack by the complement system .  \nthe serine protease factor i cleaves both c4b and c3b and is thereby supported by various cofactor molecules .\nc4 binding protein ( c4  bp ) and factor h ( fh ) are fluid - phase proteins that enable the cleavage of c4b and c3b , respectively , moreover , the membrane - anchored molecules complement receptor 1 ( cr1 , cd35 ) and membrane cofactor protein ( mcp , cd46 ) support the degradation of both c3b and c4b .\nin addition , fh and c4  bp accelerate the decay of assembled c3 convertase ; cr1 affects both c3 and c5 convertases .\ndecay accelerating factor ( daf , cd55 ) is another notable membrane - bound regulator that efficiently prevents the assembly and promotes the disintegration of both c3 and c5 convertases [ 27 , 4345 ] .   in the terminal pathway\n, the membrane - anchored cd59 ( protectin ) binds to c8 in the c5b-8 complex and thus inhibits further incorporation and polymerization of c9 units to form the mac [ 27 , 4345 ] .\nthe potency of complement represents a valuable tool to attack invading pathogens and to defend the host against penetration and dissemination .\none particular advantage of complement lies in the fact that activation can start within seconds after contact with the microbe and ends with a multifaceted spectrum of antimicrobial reactions .\nhowever , the fact that microbial infections occur in a considerable proportion , already implicates that the pathogens have developed appropriate counterstrategies to avoid elimination , thus starting a vicious circle of reaction and counterreaction .\nfurthermore , the antimicrobial effector mechanisms of the complement system might also harbour harmful consequences for the affected host . as known from several infectious and noninfectious diseases , chronic or exceeding complement - mediated inflammation\nputative mechanisms for such complement - induced tissue damage may include a fulminant inflammatory reaction and opsonization of surrounding  bystander  cells with subsequent lysis .\n\n aspergillus conidia and hyphae activate the complement system via all three pathways [ 4648 ] ( figure 1 ) .\ninitiation of the complement cascade by resting conidia is mediated predominantly by the alternative pathway .\nhowever , when the conidia begin to swell and transform into hyphae , there is a progressive involvement of the classical pathway .\nthese differences in the activation pathways are reflected by different kinetics ; the slowest initiation is seen with resting conidia .\nfurthermore , mbl as a pattern recognition molecule of the lectin pathway is able to bind to carbohydrate structures on the surface of aspergillus and promotes complement activation via the lectin pathway , which results in the deposition of c4 . as mentioned above\n, mbl can support c3 cleavage by a c2 bypass mechanism after contact with a. fumigatus conidia , resulting in activation of the alternative pathway and avoiding formation of the classical pathway c3 convertase .\nthis mechanism is not restricted to a. fumigatus , but can also take place in the presence of a. terreus , a. niger , and a. flavus .  \nmbl generally seems to be a molecule of high significance for innate defence against a range of pathogens . in several studies\n, it was shown to bind to various sugars on the surfaces of viruses , bacteria , yeasts , fungi , and protozoa [ 4851 ] .\nfurther evidence for the crucial role of mbl arises from findings in patients with chronic necrotizing pulmonary aspergillosis and mouse models of pulmonary aspergillosis [ 52 , 53 ] ; these facts suggest mbl as a promising molecule for prophylaxis and therapeutical treatment ( see below ) .  \na further mechanism for complement activation driven by aspergillus involves the interaction with the pattern recognition molecule pentraxin-3 ( ptx-3 ) .\nwhen a. fumigatus is opsonized with ptx-3 , the complement cascade can be activated either by interaction between ptx-3 and c1q via the classical pathway , or by interaction between ptx-3 and ficolin-2 via the lectin pathway .\nafter seroconversion , anti - aspergillus antibodies in the serum can trigger the start of the classical complement pathway .\nthe thesis that complement represents a central tool in antifungal host defence is supported by several findings .\nfurthermore , recognition by the complement system and activation of the cascade seems to interfere with efficient dissemination in the host .\nthis conclusion is strongly indicated by the fact that the level of complement deposition on different aspergillus species correlates inversely with their pathogenicity : highly virulent species like a. fumigatus and a. flavus bind less c3 on their surface than nonpathogenic species like a. glaucus or a. nidulans .\nthe antimicrobial potency of the complement cascade appears to be independent from direct killing via formation of a mac ; presumably , the thick fungal cell wall block the formation of a pore by the c9 polymers and the subsequent lysis of the cells .\nopsonization of the fungal surface with c3-derived fragments are presumably the most relevant complement - associated weapon , stimulating efficient phagocytosis or release of damaging compounds , oxidative burst and killing by monocytes , bronchoalveolar macrophages , and polymorphonuclear cells [ 46 , 47 , 57 ] .\nthe capacity to opsonize pathogens and to exert antifungal effects strictly depends on the available complement levels in the respective compartment of the body .\nthe complement concentrations in the central nervous system ( cns ) are low and thus only allow a rather weak deposition .\nconsequently , the complement amounts in the cerebrospinal fluid are unable to induce a significant oxidative burst in immune cells and to result in reduced fungal viability , thus making the cns a highly vulnerable organ . however , the brain cells react to the fungal presence with an upregulation of complement synthesis to enable better opsonization and therefore a more efficient clearance of the fungus .  \nmice deficient in complement factor c5 can exert the early opsonization processes with c3 fragments , but are unable to fulfil the complete cascade . when infected with a. fumigatus ,\nthese mice show decreased resistance and lower 50% lethal conidia dosage for a disseminated infection [ 59 , 60 ] .\nsince this enhanced susceptibility is unlikely to be due to absent mac formation in the fungal cell membrane , it might be supposed that the inability to form the anaphylatoxin c5a could be the relevant deficit in these mice [ 59 , 60 ] .\nc5a exerts a wide range of proinflammatory effects ; by binding to its receptor c5ar , c5a recruits inflammatory cells to the site of infection , enhances cellular adhesion , and stimulates oxidative metabolism .\nin addition , c5a can trigger the release of lysosomal enzymes and of inflammatory mediators such as tumor necrosis factor - alpha ( tnf- ) and interleukin-6 ( il-6 ) [ 61 , 62 ] .\nfurthermore , a higher susceptibility to aspergillosis in c5-deficient mice might be attributed to missing tcc .\nlow doses of this soluble complex were shown to bind to the membrane of a range of cell types , thereby triggering various effects like activation , rescue from apoptosis , and secretion of prostaglandins , which are important regulators of the immune response [ 6367 ] .\nthe potency of aspergillus to cope with the complement system and to undermine its mechanisms for elimination determines how successful the fungus can establish an infection .\naspergillus has developed a complex repertoire of effector mechanisms for this purpose ( table 1 ) .  \nsingle or multiple abscess formation is a characteristic feature of aspergillosis , particularly in the central nervous system ( cns ) .\nthe fungal hyphae are found in brain blood , vessels with invasion through vascular walls into adjacent parenchymal tissue .\nfungal brain abscesses may arise from these sites of localized parenchymal infection . in this case , white blood cells collect in the affected part of the brain , and fibrous tissue forms around this area , creating a mass .\ncns abscesses typically present with headache , focal neurological abnormalities , and/or seizure , which is the consequence of local destruction or compression of adjacent brain tissue .\nmature fungal abscesses exhibit a central necrotic area with fungal hyphae , surrounded by a capsule of newly formed fibrous tissue .\nthe formation of abscesses represents a host mechanism to inhibit further spreading of invading pathogens .\nhowever , this  sealing off  not only inhibits fungal dissemination , but also forms some kind of protection shields against the complement attack .\nimmunohistochemical staining revealed that effect : whereas the fibrous surrounding tissue was intensely stained for complement proteins , the central necrotic area contained only minor complement concentrations .\nno deposition of complement factors on the fungal surface in the abscess was visible , implying that the encapsulation protects the fungus within the abscess from any efficient complement attack .\nputative complement recognition sites on the conidial surface of a. fumigatus are optimally masked to minimize the stimulus for complement activation .\nexperiments aiming to identify the relevant fungal structure indicated that melanin could play a substantial role for masking ; for this purpose , knock out mutants lacking enzymes of the melanin biosynthesis pathway were used [ 10 , 11 , 76 ] .\ndisruption of the gene alb1 , which encodes a polyketide synthase in the synthesis of melanin , results in increased opsonization of the conidia with c3 and in a better ingestion by human neutrophils .\ndeposition of pigments on the conidial surface might mask the c3 binding sites , and disruption of the alb1 gene might expose these sites and thus allow enhanced c3 binding .\na mouse model confirms this function of alb1 in fungal pathogenesis , since the alb1-deficient mutant of a. fumigatus turned out to be less virulent than the wild - type fungus [ 11 , 76 ] .\ninactivation of the gene for the pigmentation protein arp1 similarly increased the deposition of c3 on conidia .\nthis pigment seems to be a central element of aspergillus against the host defence , as it is also involved in scavenging reactive oxygen species ( ros ) and inhibits the acidification of phagolysosomes of alveolar macrophages , monocyte - derived macrophages , and human neutrophil granulocytes after ingestion of conidia [ 12 , 13 , 77 ] .\nas mentioned above , the activity of the complement cascade is strictly limited by several fluid - phase inhibitors .\nimmunofluorescence analysis , adsorption assays and flow cytometry studies showed that aspergillus acquires fh , factor h - like protein 1 ( fhl-1 ) , factor h - related protein 1 ( fhr-1 ) , and c4  bp from the host [ 70 , 71 ] .\nfhl-1 is a splicing product of the fh gene , and fhr-1 is a related protein belonging to the fh family .\nbound to the conidial surface , fh maintained its regulatory activity and could act as a cofactor for the factor i - mediated cleavage of c3b .\nas a consequence of covering the fungal surface with these complement inhibitors , all three pathways might be downmodulated .\nthe attachment molecules on aspergillus are not yet known , whereas the corresponding binding regions within fh were recently described .\none of them was identified within n - terminal short consensus repeats ( scrs ) 1 to 7 and a second one within c - terminal scr 20 . \n\na. fumigatus not only acquires complement inhibitors from the host , but also produces and releases its own soluble factor that inhibits complement activation and opsonization of the fungus [ 72 , 73 ] .\nthis complement inhibitor ( ci ) , which is also synthesized by a. flavus , selectively abolishes activation of the alternative pathway and interferes with c3b - dependent phagocytosis and killing .\nthe exact chemical composition of ci is as yet unknown ; it contains 15% protein and 5% polysaccharide .\nrecent own results raise the possibility that this described ci or a closely related activity also contributes to the pathogenesis in cerebral aspergillosis , since immunohistochemical studies show deposition of c1q and c4 , but not of c3 , on the fungal hyphae in the cns .  \nstudies by sturtevant revealed the synthesis of a proteolytic enzyme that is able to degrade c3 ( , reviewed in : ) .\nthis is confirmed by own experiments showing complement - degrading proteolysis in the supernatant of aspergillus when grown in cerebrospinal fluid ( csf ) .\nthe fungus - induced degradation of complement in csf evoked a drastic reduction of the opsonization of the fungal hyphae . in parallel ,\nthe fungal serine protease alp1 might participate in complement degradation and thus be partly responsible for the complement evasion [ 15 , 17 ] . to date , degradation of c1q , c3 ,\nc4 , c5 , mbl , and factor d were shown [ 15 , 17 ] .\nthe high morbidity and lethality of invasive aspergillosis strongly demands for an expansion of the current treatment options . the antimycotic therapy might be completed by new approaches aiming to strengthen the host immune response against the fungus .\nputative approaches could be to increase the available complement concentrations or to improve the efficiency of complement attack by undermining the fungal evasion strategies .\nappropriate strategies that target the complement system may aim to the following .   our own studies about cerebral aspergillosis showed a clear correlation between the complement levels in the csf and the capacity of csf to opsonize fungal hyphae and designate them for phagocytic killing\n. a therapeutic increase of mbl concentrations in invasive aspergillosis might be an appropriate approach , since patients with chronic necrotizing pulmonary aspergillosis show more frequently mbl haplotypes that encode for low levels of the protein than healthy control persons .\nfurther support comes from a murine model of invasive pulmonary aspergillosis : those mice with externally administered recombinant mbl reveal better survival , compared to untreated animals .\ndetailed studies confirmed that mbl - treated mice show a significant increase in the levels of the proinflammatory cytokines tnf- and il-1 , together with a marked decrease of anti - inflammatory il-10 and of fungal hyphae in the lung .\nblocking of the fungal surface pigments by specific antibodies or peptides might be a hypothetical approach that could help to expose the c3 binding sites and thus improve complement deposition and ingestion of conidia by phagocytes .\nanother approach might target the acquisition of the negative complement regulators fh , fhl-1 , and c4  bp to the fungal surface . for candida albicans , some molecules that bind c4b and fh\nhave recently been identified [ 78 , 79 ] , while the attachment sites on aspergillus are still unknown but might include related molecules .\nblocking antibodies , designed peptides or other inhibitors against these complement regulator binding molecules might help to make the fungus more vulnerable towards complement attack .\na similar approach might be developed for the aspergillus - derived complement inhibitor described by washburn [ 72 , 73 ] .  \n\nour own results open the possibility to neutralize the fungal protease(s ) that is / are secreted by aspergillus to degrade complement proteins .\ntwo different strategies were tested by first in vitro experiments : the neutralization of the protease by specific inhibitors or interference with the production of this proteolytic enzyme . in our studies , we could prevent the complement degrading activity by serine protease inhibitors\n. however , a therapeutically used protease inhibitor must be highly specific , since a general block of serine proteases might be fatal for the host .\nalternatively , our experiments exhibited that the secretion of complement - degrading enzymes strictly depends on the availability of nitrogen sources .\nthus , the supply of amino acids in the infected host might downmodulate the secretion of the relevant fungal protease that cleaves the complement factors of the host .\ndespite new antifungal drugs and improved medical treatment , invasive aspergillosis remains a dangerous threat for immunocompromised patients , as the innate immune defence is the most crucial weapon against this infection .\nthe complement system is of particular importance , as it harbours multiple effects against infectious diseases , bridges the elements of the human defence network by a multitude of factors , and helps to preserve the homeostasis of the body .\nthe presence of fungal pathogens is detected by different pattern recognition molecules ; three pathways guarantee the activation of the complement cascade by resting , swollen , and germinating conidia as well as by hyphae of aspergillus .\ndirect lysis of fungal cells by the membrane attach complex ( mac ) appears to be of minor importance for the antifungal defence .\npresumably , attraction and activation of immune cells ( monocytes , pulmonary macrophages , and polymorphonuclear neutrophils ) are the most essential mechanisms .\nanaphylatoxins ( c3a , c5a ) chemotactically recruit immune cells to the site of the infection and induce further inflammatory reactions .\nopsonization of conidia and hyphae with complement fragments like c3b and ic3b mediate phagocytosis , oxidative burst , and release of damaging compounds by binding to corresponding receptors on immune cells\n. however , highly virulent aspergillus species have evolved mechanisms to evade the attack by complement .\nthey hide from recognition , acquire complement regulatory molecules from the host , and secrete proteases to degrade complement factors .  \nthe multifaceted interactions between complement and aspergillus represent promising approaches for future therapeutic strategies that may help to improve the outcome of invasive aspergillosis .", "human": " invasive aspergillosis shows a high mortality rate particularly in immunocompromised patients . perpetually increasing numbers of affected patients highlight the importance of a clearer understanding of interactions between innate immunity and fungi . \n innate immunity is considered to be the most significant host defence against invasive fungal infections . \n complement represents a crucial part of this first line defence and comprises direct effects against invading pathogens as well as bridging functions to other parts of the immune network . \n however , despite the potency of complement to attack foreign pathogens , the prevalence of invasive fungal infections is increasing . two possible reasons \n may explain that phenomenon : first , complement activation might be insufficient for an effective antifungal defence in risk patients ( due to , e.g. , low complement levels , poor recognition of fungal surface , or missing interplay with other immune elements in immunocompromised patients ) . \n on the other hand , fungi may have developed evasion strategies to avoid recognition and/or eradication by complement . \n in this review , we summarize the most important interactions between aspergillus and the complement system . \n we describe the various ways of complement activation by aspergillus and the antifungal effects of the system , and also show proven and probable mechanisms of aspergillus for complement evasion . ", "section_names": "1. \n2. Complement: An Innate and Sophisticated Antimicrobial Defence Mechanism\n3. Complement Activation by \n4. Complement Exerts Antimicrobial Functions against Invasive \n5. \n6. Therapeutic Approaches: What Can We Learn from the Conflict between \n7. Summary and Conclusion", "bigbird_pegasus": "<s> invasive fungal infections, particularly of aspergillosis, have become more frequent over the last decades, especially in immunosuppressed patients.<n> aspergillus fumigatus is the most common cause of invasive aspergillosis in immunocompromised individuals, while localized infections and allergic bronchopulmonary aspergillosis occur in individuals without immunosuppression.<n> prolonged neutropenia is the most important single risk factor for development of invasive aspergillosis in immunosuppressed patients.<n> aspergillus infections are usually initiated by inhalation of conidia into the lungs.<n> furthermore, several virulence factors like proteases and mycotoxins may also contribute to undermine the host defence.<n> furthermore, aspergillus may spread to other organs via the blood, brain, and liver.<n> furthermore, aspergillosis may also lead to severe local immunosuppression in immunosuppressed individuals.<n> furthermore, prolonged neutropenia, particularly in cases of invasive aspergillosis in immunosuppressed patients, may lead to significant morbidity and mortality.</s>", "longt5": "<pad> the complement system is of particular importance, as it harbours multiple effects against infectious diseases, bridges the elements of the human defence network by a multitude of factors, and helps to preserve the homeostasis of the body. the presence of fungal pathogens is detected by different pattern recognition molecules ; pathways guarantee the activation of the complement cascade by resting, swollen, and germinating conidia as well as by hyphae of aspergillus. direct lysis of fungal cells by the membrane attach complex appears to be of minor importance for the antifungal defence. presumably, attraction and activation of immune cells are the most essential mechanisms. anaphylatoxins ( c3a, c5a ) chemotactically recruit immune cells to the site of the infection and induce further inflammatory reactions. opsonization of conidia and hyphae with complement fragments like c3b and ic3b mediate phagocytosis, oxidative burst, and release of damaging compounds by binding to corresponding receptors on immune cells. however, highly virulent aspergillus species have evolved mechanisms to evade the attack by complement. they hide from recognition, acquire complement regulatory molecules from the host, and secrete proteases to degrade complement factors. the multifaceted interactions between complement and aspergillus represent promising approaches for future therapeutic strategies that may help to improve the outcome of invasive aspergillosis.</s>"}
{"article": "activation of mast cell degranulation has been demonstrated to be an important mediator of allergic disease and more recently , as an initiator or contributor to autoimmune disease [ 1 - 4 ] .\nmast cells are granulocytes that emanate from myeloid progenitors in bone marrow and play a critical role in innate immunity as vital sentinel cells that combat invading microorganisms at tissue / environment interfaces [ 1 - 4 ] .\nmast cells are phagocytic and can directly destroy pathogens ; they also release inflammatory mediators which promote inflammation by recruiting and activating other leukocytes . as regulators of adaptive immunity , mast cells promote antigen presentation , naive t cell differentiation into helper t cells , and induction of acquired immunity towards parasites via ige / fcr binding [ 1 - 4 ] .\nthe major contribution of mast cells to both immune function and dysfunction results from the release of a plethora of inflammatory mediators through a process known as regulated exocytosis [ 1 - 5 ] .\nthis process occurs in many cell types and involves the storage of intracellular pools of inflammatory mediators , hormones or neurotransmitters in pre - formed granules / vesicles . upon activation of the cell ,\nfusion can be activated through receptor stimulation or by membrane depolarization via 2 messengers , for example ca . the transport , fusion and release of vesicle contents through exocytosis is mediated by a family of proteins known as the snares [ 7 - 11 ] .\nsoluble n - ethylmaleimide - sensitive factor attachment protein receptors have been demonstrated to play a pivotal role in regulated exocytosis ( degranulation ) in mast cells [ 12 - 22 ] and represent a mechanical step involved in inflammatory mediators release that can be targeted for the design and development of therapeutics .\nwe review the expression , localization and operation of various functional snare complexes in both murine and human mast cells .\nwe evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation .\nvesicular trafficking of essential molecules between cellular compartments and into and out of cells is required for cell function and survival . in neurons ,\nneurotransmitter release is widely acknowledged as critical for the development and function of the nervous system in all higher organisms .\nthe snare family of proteins mediates the highly regulated processes of vesicular assembly and disassembly [ 6 , 810 ] .\nnumerous proteins are involved in the formation and disassembly of active snare complexes during membrane fusion .\neach set of snare proteins act as a vesicle loading signal , a mechanical address ( delivering the vesicle to the correct target membrane ) , and in the mechanical process of fusing two opposing membranes .\nthe neuronal and immunological snare proteins have a another layer of complexity added to this paradigm , the vesicles are loaded with cargo , but dock and await a chemical fusion signal .\nthe snare family of evolutionarily conserved proteins was first identified in the 1980s in yeast and a decade later in mammalian cells .\nsnares are found in most eukaryotic cells ; 25 members have been identified in saccharomyces cerevisiae , 54 members in arabidopsis thaliana and > 36 members in humans .\nthe proteins are composed of a simple domain structure highlighted by a snare motif , a stretch of 6070 amino acids arranged in a heptad repeat [ 6 - 11 ] .\ncore complexes form stable structures , which are composed of four intertwined parallel -helices contributed by three to four different snare members [ 6 - 11 ] .\nthese complexes consist of a central core of three glutamine residues and one arginine residue bordered by hydrophobic stacked layers of side chains .\nsoluble n - ethylmaleimide sensitive factor attachment protein receptors can be classified on the basis of whether they contain a q or r residue in their motif and are referred to as either a qa , qb , qc , qbc , or r - snares based on the position of their contributing motif in the assembled snare complex .\nthe vesicle - associated membrane protein ( vamp ) family of snares are examples of the r - snare sub - type and are characterized by a single transmembrane domain , a snare motif and a n - terminal domain containing profilin - like folds [ 8 , 10 ] .\nthe syntaxin family of snares is an example of the qa or qc sub - type and are characterized by a single transmembrane domain , a snare motif and a n - terminal domain made up of anti - parallel three - helix bundles [ 8 , 10 ] .\nthe synaptosome - associated protein ( snap ) family of snares is an example of the qbc subtype and contain two snare motifs joined by a flexible linker and that is palmitoylated and therefore lacks a transmembrane domain [ 8 , 10 ] .\nthe snap family is unique in that they contribute two snare motifs to the snare complex .\nsoluble n - ethylmaleimide - sensitive factor attachment protein receptors were previously classified based on whether they localized to the vesicle membrane ( v - snares ; e.g. vamps ) or to the target plasma membrane ( t - snares ; e.g. syntaxins and the snap families ) but these classifications have subsequently been shown to have a number of exceptions .\nsoluble n - ethylmaleimide - sensitive factor attachment protein receptors localized on opposing membranes [ vesicle : vesicle or vesicle : plasma membrane ] drive fusion of membranes using the free energy released during the formation of the stable four - helix bundle .\npost - fusion snare proteins end up on the interior surface of the target membrane .\nthese bundles are recycled via dissociation mediated by n - ethylmaleimide - sensitive factor ( nsf ) and other co - factors such as snap ( soluble nsf attachment protein ) .\nmechanical models [ 6 - 11 ] all predict that snares function to bring opposing membranes into close proximity initiating fusion events .\nthe presence of ca is indispensable , acting to bridge the opposing membranes , which leads to the exclusion of water allowing lipid mixing , fusion and subsequent exocytosis .\nca - regulated snare complexes are involved in neurotransmitter release [ 8 , 23 ] .\nthe neuronal snare complex was the first snare complex identified and the most vigorously dissected .\ndocked vesicles containing snare complexes composed of syntaxin 1a and snap-25 on the plasma membrane and vamp-2 on the vesicular membrane allow for the rapid ( millisecond ) release of neurotransmitters upon ca influx .\nfree , uncomplexed membrane snares form cis - snare acceptor complexes on the plasma membrane in response to the actions of regulatory proteins .\nthese acceptor complexes on the plasma membranes interact with snares on opposing vesicular membranes and form trans - snare complexes that are fusion \nready. these  docked vesicles persist for a substantial period of time until ca influx triggers the final step of fusion and cargo ( neurotransmitter ) release through the actions of ca sensors such as synaptotagmin and complexins .\nvarious investigators have reported the expression of multiple snares in murine and human mast cells [ 12 , 13 , 15 , 17 , 1922 , 2431 ] .\ncomposite rt - pcr data identifying snare mrna in murine and human mast cells are presented in table 1 .\nthe neuronal snare snap-25 showed weak mrna expression in human mast cells , but was not detected via western blot in the same study .\nmultiple studies report the expression of several vamp family representatives mrna [ vamp-1 , 2 , 3 , 7 , 8 ( r snares ) ] and several members of the syntaxin family [ syntaxin 1 , 2 , 3 , 4 ( qa snares ) ] as well .\nsnare family mrna expression in murine and human mast cells immunoblotting studies confirm that snap-23 is the consensus representative of the qb , c family in both murine and human mast cells ( see composite of protein expression data presented in table 2 ) .\ninterestingly , two groups have reported the expression of the neuronal snap-25 qb , c snare protein in primary murine mast cells via immunoblot and immunohistochemistry [ 25 , 27 ] .\nthese data could not be recapitulated in published work by several groups in primary murine mast cells [ 12 , 22 ] and the rat cell line rbl-2h3 [ 13 , 22 , 24 ] . the reason[s ] behind this discrepancy is not clear , but may involve specificity of antibodies and/or limits of detection of signal .\nprotein expression of vamp and syntaxin family members correlate well with mrna studies , as the majority of snares detected via rt - pcr were also detected via immunoblot .\nsnare family protein expression ( via immunoblotting ) in murine and human mast cells immunohistochemistry studies in primary murine mast cells [ 12 , 18 , 21 ] have demonstrated that snap-23 and syntaxin 4 localize to the plasma membrane , while syntaxin 3 , vamp-2 and vamp-8 appear to localize to secretory granules .\ndetected snap-25 expression in the secretory granules of rat primary mast cells ( rpmc ) .\nsimilar immunohistochemistry results in rbl-2h3 cells [ 13 , 14 , 24 , 29 , 31 ] have been reported demonstrating plasma membrane localization of snap-23 , syntaxin 4 and syntaxin 3 ; and secretory granule localization of syntaxin 3 , vamp-2 , 3 , 7 and 8 . in human mast cells ,\nsander et al .   demonstrated that snap-23 and syntaxin 4 localize in the plasma membrane while vamp-3 , vamp-7 and vamp-8 are dispersed throughout the cytoplasm , suggesting granule localization .\nhowever , upon activation of the mast cell , only vamp-7 and vamp-8 appear to redistribute to the periphery of the cell , suggesting fusion and degranulation .\nimmunoprecipitation ( ip ) pull - down studies in primary murine mast cells , rbl-2h3 cells , and human mast cells have identified snare complexes composed of snap-23 and syntaxin 4 in complex with the r - snares , vamp-2 [ 13 , 18 , 28 , 29 ] , vamp-8 [ 13 , 15 , 17 , 18 , 22 ] ; vamp-7   and vamp-3 .\nin addition , complexes composed of snap-23 , syntaxin 3 and vamp-8 also co - precipitated .\n.   demonstrated that ip with anti - snap-23 antibody in rbl-2h3 cells pulled down syntaxin 2 , 3 , 4 and vamp-2 , 3 , 8 .\ninterestingly , n - ethylmaleimide ( nem ) treatment was required to observe vamp-8 co - precipitation .\nit was also demonstrated that ip with anti - syntaxin 4 resulted in the co - precipitation of snap-23 , vamp-2 , vamp-3 and vamp-8 , while ip with anti - syntaxin 2 or syntaxin 3 only pulled down snap-23 .\nthese data suggest that ternary complexes in rbl-2h3 cells consist of snap-23 , syntaxin 4 and a member of the r - snares family , presumably vamp-2 , 3 or 8 .\nshowed that in rbl-2h3 cell lysates ; syntaxin 4 co - precipitated with snap-23 and vamp-8 within and outside of lipid rafts ; however , syntaxin 3 , snap-23 and vamp-8 co - precipitates were found to be complexed only within lipid rafts .\nthe implication of these two different complexes and their unequal distribution in the membrane remains unclear .\nadditional studies by hepp et al .   demonstrated co - precipitated complexes of snap-23 , vamp-2 and syntaxin 4 in rbl-2h3 cells and also showed that most of the snap-23 associated with vamp-2 and syntaxin 4 in these complexes is phosphorylated .\nan elegant study by puri et al .   demonstrated that snap-23 , syntaxin 4 , vamp-2 complexes are present in lipid rafts and showed that snap-23 functions to recruit non - lipid raft - associated syntaxin 4 into a functional complex .\nonce again it was demonstrated that a predominant proportion of the snap-23 in complexes was phosphorylated , implicating snap-23 phosphorylation as a key prerequisite to complex formation .\nour group has demonstrated that in rbl-2h3 cells , snap-23 co - precipitates with syntaxin 4 and vamp-8 ; however , nem treatment was needed to observe vamp-8 association . in human mast cells isolated from surgical tissues , sander et al\n.   demonstrated that snap-23 co - precipitated with syntaxin 4 , vamp-7 and vamp-8 , but not vamp-2 and vamp-3 . in\nderived mast cells , vamp-8 was shown to associate preferentially with syntaxin 4 and snap-23 , and to a lesser degree , vamp-2 .\nhowever , it appears that vamp-2 and vamp-3   may act to substitute for vamp-8 in vamp-8-deficient cells , perhaps due to an unusual compensatory mechanism .\nisolation of ternary complexes of snare proteins after cellular activation has proven anything but trivial .\nprevious data have demonstrated that only 5% of the snap-23 present in rbl-2h3 cells is actually capable of forming a complex after activation .\nfurthermore , it is suggested that snare complexes have limited lifespans after activation - induced formation [ 35 , 36 ] . using recombinant snare proteins , foster et al .  \ndemonstrated the in vitro association of the recombinant snares , snap-23 , vamp-2 and syntaxin 4 and further demonstrated that deletion of the amino terminus and the second coiled - coil domain of snap-23 inhibited binding to both vamp-2 and syntaxin 4 .\nalthough immunolocalization and ip studies identify the individual snare proteins and their complexes associated with mast cell function , functional studies aimed at disrupting snare complex formation / action provide a practical method to dissect the role of these complexes in mast cell degranulation .\nsnare proteins also function to mediate constitutive trafficking events through both endocytic and secretory pathways ; reviewed in hong et al .\npreviously published functional data have implicated the snares snap-23 , syntaxin 4 , vamp-2 , vamp-3 , vamp-7 and vamp-8 in mast cell degranulation in studies using streptolysin - o - permeabilized cells and inhibitory recombinant snare proteins , snare neutralizing antibodies [ 12 , 17 , 19 ] ; overexpression studies [ 13 , 14 , 22 , 29 , 38 ] , rna interference methods [ 20 , 22 , 39 ] and snare - deficient mice [ 18 , 21 ] .\na compilation of functional data implicating the various snare proteins is presented in table 3 .\nfunctional data implicating snare proteins in mast cell degranulation the most compelling evidence for the role of snare proteins in mast cell degranulation is presented in data describing vamp-8-deficient mice [ 18 , 21 ] .\n.   demonstrated that mast cells derived from the bone marrow of these mice [ bmmc ] had a 50% decrease in their ability to release -hexosaminidase and serotonin but had normal histamine and tnf- release .\ntiwari et al .   showed that bmmc from vamp-8-deficient mice resulted in a 50% decrease in -hexosaminidase and histamine , but no changes in cytokine / chemokine release .\nour group has shown via sirna that we could demonstrate about a 50% knockdown in rbl-2h3 degranulation after targeting vamp-8 mrna / protein .\ninterestingly , puri et al .   also showed that vamp-2 and vamp-3 do not play a role in mast cell degranulation as bmmc derived from vamp-3-deficient animals and mast cells derived from vamp-2-deficient stem cells showed normal degranulation .\nthese data are confirmed by studies with tetanus toxins [ 17 , 40 ] , which are known to cleave and inactivate vamp-2 but do not have any effect on mast cell degranulation . supporting evidence for the role of vamp-8 in mast cell degranulation comes from sander et al . , who demonstrated that neutralizing anti - vamp-8 antibodies inhibit degranulation in streptolysin - permeabilized human mast cells by 60% .\ndata from this report also demonstrated a role for vamp-7 ( 50% inhibition ) but not vamp-2 and vamp-3 .\nsimilarly , lippert et al .   demonstrated that recombinant vamp-8 inhibited ca-/gtps - mediated degranulation in permeabilized rbl-2h3 cells by 30% .\nour group 's sirna studies also implicate snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation , as knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment . in support of our data ,\nsalinas et al .   demonstrated that in permeabilized rpmc , neutralizing antibodies to snap-23 and syntaxin 4 resulted in 25% and 65% inhibition of histamine release .\nin addition , sander et al .   demonstrated that neutralizing antibodies to snap-23 and syntaxin 4 inhibited histamine release from permeabilized human mast cells with inhibition reaching 90% and 40% , respectively .\nearlier studies by guo et al .   demonstrated that anti - snap-23 neutralizing antibody decreased rpmc degranulation , although this inhibition required high antibody concentrations ( 500 g / ml ) .\nrecently , suzuki et al .   demonstrated that a shrna to snap-23 knocked down degranulation in stimulated rbl-2h3 cells by 30% , similar to the maximal inhibition we have observed for snap-23 . in addition , liu et al .   demonstrated that treatment of rbl-2h3 cells with syntaxin 4 sirna resulted in a decrease in antigen - induced histamine and -hexosaminidase release .\ninterestingly , various groups [ 13 , 14 , 29 , 37 ] have implicated syntaxin 4 , vamp-7 and snap-23 in mast cell degranulation via overexpression studies .\noverexpression of syntaxin 4 , vamp-7 and snap-23 all had an effect on degranulation in rbl-2h3 cells , although the effects were manifested as either an augmentation or inhibition of degranulation .\nthe exact mechanism leading to augmentation or inhibition has yet to be elucidated but may involve competition for free snare proteins or competition for regulatory proteins . because many of the snare - deficient transgenic mice are embryonic lethal ( table 4 ) , sirna methods may represent the only efficient way to characterize degranulation pathways in both in vitro and in vivo models of anaphylaxis and autoimmune disease .\nmast cell phenotype of snare knockout animals / cells these reports provide evidence that these snares do not participate in the mast cell degranulation process .\nthere are a number of studies published recently that utilize sirna to validate the role of individual snares or snare complexes mediating trafficking events in various cell types [ 46 - 54 ] .\nhowever , an interesting report published recently   eloquently suggests that the abundance of snare - member isoforms and therefore the overall increase in snare redundancy may play a major role in the lack of snare sirna cellular efficacy .\nin addition , the authors describe the phenomenon that many cell types appear to express a sizeable reserve of snare proteins not required for normal physiological cellular processes ( a so - called  snare reserve ) .\ninterestingly , the literature is scant with respect to sirna studies characterizing snare - protein function in mast cells .\nin addition , as snares are intracellular targets , the use of biotherapeutics such as recombinant proteins or neutralizing antibodies is not possible as these large proteins can not as of yet be targeted to the inside of the cell . therefore , interfering rna offers an exciting new approach for the development of a snare - directed therapy . to date , several sirna - based therapies have initiated clinical trials for the treatment of viral diseases , cancer and macular degeneration .\nin addition , our sirna data identifies snap-23 and syntaxin 4 as essential for rbl-2h3 degranulation , and knockdown of these snares resulted in 30% inhibition of degranulation when compared to control sirna treatment .\nthese studies reflect the effect that a snare sirna therapeutic could have as we utilized whole cells stimulated with physiologic stimuli .\nhowever , additional studies focused on in vivo delivery of these sirna and testing in animal models of disease are warranted .\nsec1/munc18 ( sm ) proteins are arch - shaped cytosolic proteins that have been demonstrated to bind syntaxins and regulate intracellular trafficking [ 57 , 58 ] .\nspecifically , munc182 has been demonstrated to play a role in mast cell degranulation [ 15 , 26 , 31 ] .\nsm proteins appear to regulate snare activity in several ways [ 57 - 60 ] .\nthey can bind non - complexed syntaxins and act as negative regulators of snare assembly and interestingly , can also bind to trans - complexes and promote fusion .\nmembers of the munc13 family of accessory proteins also have been demonstrated to act as positive regulators of mast cell degranulation .\ncomplexins are cytosolic snare regulatory proteins that bind snare complexes and  lock the snare machinery into a primed state awaiting a final trigger of fusion events [ 57 , 60 ] .\nspecifically , complexin ii has been demonstrated to function as a positive regulator of mast cell degranulation as sirna to complexin ii attenuates ige - induced degranulation .\nsynaptotagmins are type i membrane calcium binding proteins that facilitate the formation of the snare  calcium\n phospholipid complex that triggers final fusion and release of mediators from the cell [ 57 , 60 ] . in mast cells ,\nthe rab family of gtpases has been implicated in the control of degranulation in mast cells .\nsecretory carrier membrane proteins ( scamps ) are accessory proteins that play a role in the regulation of mast cell degranulation .\nscamp-1 and scamp-2 are postulated to function at the later stages of membrane fusion , in concert with phospholipase d , to form functional fusion pores . finally ,\nas previously mentioned vide supra , snare disassembly is mediated by the proteins snap and the atpase nsf [ 60 , 64 ] .\nsnap functions to capture the snare complex and allow the binding of nsf and the subsequent disassembly of the snare complex .\nthe important qb , c and qa snares on the plasma membrane unequivocally appear to be snap-23 and syntaxin 4 , while the most likely r - snare partners on the vesicle membranes appear to be both vamp-7 and vamp-8 ( fig .\n1 ) . functionally , there is growing evidence that ternary complexes of the above snares are critically involved in the mast cell degranulation process .\ndisruption of these complex 's formation or interactions with regulators may offer a window for therapeutic intervention and the development of novel small molecules for the treatment of allergic and autoimmune disease .\nmodel of the mast cell snare complex mediating degranulation based on functional findings [ 1214 , 1622 , 29 , 3738 ] .\n( a ) snap-23 and syntaxin 4 represent the consensus plasma membrane snares involved in mast cell degranulation . under normal physiological conditions , vamp-7 and/or vamp-8 represent the secretory granule ( vesicle ) snare that interacts with snap-23 and syntaxin 4 to form a functional ternary complex .\n( b ) in the absence of vamp-8 , it appears that a compensatory mechanism may allow vamp-2 and/or vamp-3 to associate with snap-23 and syntaxin 4 to mediate ternary complex formation and possible function .", "human": " mast cell function and dysregulation is important in the development and progression of allergic and autoimmune disease . \n identifying novel proteins involved in mast cell function and disease progression is the first step in the design of new therapeutic strategies . \n soluble n - ethylmaleimide - sensitive factor attachment protein receptors ( snares ) are a family of proteins demonstrated to mediate the transport and fusion of secretory vesicles to the membrane in mast cells , leading to the subsequent release of the vesicle cargo through an exocytotic mechanism . \n the functional role[s ] of specific snare family member complexes in mast cell degranulation has not been fully elucidated . here , \n we review recent and historical data on the expression , formation and localization of various snare proteins and their complexes in murine and human mast cells . \n we summarize the functional data identifying the key snare family members that appear to participate in mast cell degranulation . furthermore , we discuss the utilization of rna interference ( rnai ) methods to validate snare function and the use of sirna as a therapeutic approach to the treatment of inflammatory disease . \n these studies provide an overview of the specific snare proteins and complexes that serve as novel targets for the development of new therapies to treat allergic and autoimmune disease . ", "section_names": "Introduction\nSNARE function in membrane fusion events\nExpression of SNAREs and SNARE complexes in mast cells\nFunctional studies implicating specific SNAREs or SNARE complexes in mast cell degranulation\nRNA interference studies, SNARES and mast cells\nRegulation of mast cell SNAREs\nConclusions\nConflict of interest", "bigbird_pegasus": "<s> mast cells are granulocytes that originate from myeloid progenitors in bone marrow and play a critical role in innate immunity as vital sentinel cells that combat invading microorganisms at tissue / environment interfaces.<n> mast cells are phagocytic and can directly destroy pathogens ; they also release inflammatory mediators which promote inflammation by recruiting and activating other leukocytes. as regulators of adaptive immunity, mast cells promote antigen presentation, naive t cell differentiation into helper t cells, and induction of acquired immunity towards parasites via ige / fcr binding.<n> the major contribution of mast cells to both immune function and dysfunction results from the release of a plethora of inflammatory mediators through a process known as regulated exocytosis.<n> this process occurs in many cell types and involves the storage of intracellular pools of inflammatory mediators, hormones or neurotransmitters in pre - formed granules / vesicles.<n> transport, fusion and release of vesicle contents through exocytosis is mediated by a family of proteins known as the snares.<n> we review the expression, localization and operation of various functional snare complexes in both murine and human mast cells.<n> we evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation.</s>", "longt5": "<pad> the snare family of proteins plays an important role in regulating vesicular assembly and disassembly. soluble n - ethylmaleimide - sensitive factor attachment protein receptors ( snares ) have been demonstrated to play a pivotal role in regulated exocytosis ( degranulation ) in mast cells and represent a mechanical step involved in inflammatory mediators release that can be targeted for the design and development of therapeutics. we review the expression, localization and operation of various functional snare complexes in both murine and human mast cells. we evaluate the published functional data that has been used to implicate specific snares and snare complexes as indispensable mediators of mast cell degranulation.</s>"}
{"article": " disability has been assigned as the umbrella term to include impairments , activity limitations or participation restrictions by the international classification of functioning ( icf ) disability and health .\nthe older concept of  disability along with the terms  impairment and  handicap , as described by icf , have been subsumed under the concept of  activity and participation. neuropsychiatric disorders continue to be leading contributors to the global burden of disease . as per the world health report , 2001 mental illnesses accounted for 25% of total disability and 16% of the total burden . among women aged 15 - 44 years , mental disorders constitute three of the 10 leading causes of disease burden in low - and middle - income countries , and 4 of the leading 10 in high - income countries . as per the census of india , 2001\nthere are an estimated 2,263,821 ( for a population of 1,028,610,328 ) people suffering from disability due to mental illness in the country .\nmental disorders rank third among the five leading contributors to disability in india . however , a recent community - based study in india found mental disability to be the most common type of disability accounting for 36.7% of total disability .\nschizophrenia has been identified as one of the most disabling condition known to mankind . as per the estimates for global burden of a disease study ,\nit usually starts during young age and is frequently associated with deterioration from the previous level of functioning .\nthis deterioration is reflected in various functional deficits leading to social isolation and poor occupational functioning .\nit is also being increasingly recognized that disability is one of the outcome indices for chronic illnesses such as schizophrenia .\nthe indian literature on disability in schizophrenia has focused on patients seeking treatment in out - patient setting , in patient setting and community setting . however , till recently there was no published literature on disability certification seeking behavior of patients diagnosed with schizophrenia . a recent study from karnataka explored the utilization of disability benefits by those who have been issued disability certificates . the current study aimed at understanding the profile of patients diagnosed with schizophrenia seeking disability certification for a tertiary level multispecialty hospital in india .\nthe findings of this study are expected to provide valuable information on various socio - demographic and illness related variables of these individuals .\nthe current study aimed at assessing the profile of subjects diagnosed with schizophrenia seeking disability certification . additionally it aimed at assessing the various socio - demographic and illness related variables among these individuals .\nthe study was carried out at the psychiatry department for a tertiary care hospital in india .\nwe here present the findings form review of cases seeking disability certification over a 5 year period .\nthe evaluation of the subjects was carried out in the presence of a primary care giver .\ndetailed history taking and mental status examination was carried out as part of this evaluation process .\nthe evaluation board comprised of three qualified psychiatrists with at least 3 years of post - senior residency experience in psychiatry .\nfirst , the diagnosis was established using icd-10 ( international statistical classification of diseases and related health conditions ) .\nsubsequently , the disability was assessed using indian disability evaluation assessment scale ( ideas ) .\nsocio - demographic information from all the subjects was collected using a pre - approved semi - structured proforma .\nideas are approved by the government of india for documenting the level of disability due to mental illness .\nit assesses disability under four domains : self - care , interpersonal activities ( social relationships ) , communication and understanding , and work .\neach item is scored between 0 and 4 , i.e. , from no to profound disability , adding scores on 4 items gives the  total disability score. global disability score is calculated by adding the  total disability score and mi2y score ( months ill in 2 years- a score ranging between 1 and 4 , depending on the number of months in the last 2 years the patient exhibited symptoms ) .\nglobal disability score of 0 corresponds to  no disability , a score between 1 and 7 corresponds to  mild disability , and a score of 8 - 13 corresponds to \nsevere disability , and a score of 20 corresponds to  profound disability. an ideas is a well - validated instrument and is being used across the country for disability evaluation in psychiatric disorders .\nthe alpha value for the scale has been found to be 0.8682 , indicating good internal consistency between the items .\ncriterion validity of the scale has been established by comparing ideas with schedule for the assessment of psychiatric disability which has been standardized in india .\ndata were analyzed using spss ( statistical package for social sciences ) software version 17 .\ncategorical variables were analyzed using chi - square test and continuous variables were analyzed using parametric tests .\nthese included independent sample t - test for in - between group differences for male and female subjects ; and family history positive / negative subjects .\nfurther , correlation between different illness variables and ideas scores was carried out using pearson 's correlation coefficient .\nconditions of anonymity and confidentiality as recommended were strictly adhered to during the course of the study and data reporting .\nsocio - demographic information from all the subjects was collected using a pre - approved semi - structured proforma .\nideas are approved by the government of india for documenting the level of disability due to mental illness .\nit assesses disability under four domains : self - care , interpersonal activities ( social relationships ) , communication and understanding , and work .\neach item is scored between 0 and 4 , i.e. , from no to profound disability , adding scores on 4 items gives the  total disability score. global disability score is calculated by adding the  total disability score and mi2y score ( months ill in 2 years- a score ranging between 1 and 4 , depending on the number of months in the last 2 years the patient exhibited symptoms ) .\nglobal disability score of 0 corresponds to  no disability , a score between 1 and 7 corresponds to  mild disability , and a score of 8 - 13 corresponds to \nsevere disability , and a score of 20 corresponds to  profound disability. an ideas is a well - validated instrument and is being used across the country for disability evaluation in psychiatric disorders .\nthe alpha value for the scale has been found to be 0.8682 , indicating good internal consistency between the items .\ncriterion validity of the scale has been established by comparing ideas with schedule for the assessment of psychiatric disability which has been standardized in india .\ndata were analyzed using spss ( statistical package for social sciences ) software version 17 .\ncategorical variables were analyzed using chi - square test and continuous variables were analyzed using parametric tests .\nthese included independent sample t - test for in - between group differences for male and female subjects ; and family history positive / negative subjects .\nfurther , correlation between different illness variables and ideas scores was carried out using pearson 's correlation coefficient .\nconditions of anonymity and confidentiality as recommended were strictly adhered to during the course of the study and data reporting .\na total of 169 subjects seeking disability certification over the study period of 5 years were diagnosed with schizophrenia .\nout of 169 subjects 132 ( 78.1% ) were male and 37 ( 21.9% ) were female .\nthe mean age of male subjects and female subjects were 36.89 ( standard deviation ( sd ) 9.67 ) years and 39.56 ( sd11.79 ) years , respectively .\nmajority of the study subjects were literate [ table 1 ] . only around 5.3% of males and 10% of females were illiterate .\nmajority of the study subjects ( 93.9% males and 86.4% females ) were from an urban setting .\nin - between group differences for male and female subjects for socio - demographic variables there was a statistically significant difference ( chi - square=25.27 , df=4 , p<0.05 ) in the marital status of the male and female study subjects . while the majority of male subjects were unmarried ( 62.1% ) and an equal proportion of female subjects were married and unmarried ( 35.1% each ) .\nalso , 18.9% of the female subjects were either separated or divorced . in comparison ,\nthere was a statistically significant difference in the employment status of the male and female subjects ( chi - square=7.84 , df=2 , p=0.02 ) .\nwhile 17.4% of male subjects were employed , none of the female subjects was currently employed . around 56.7% of the female subjects were from a lower socio - economic background .\nthe rest belonged to middle socio - economic status . in comparison , 15.9% of the male subjects belonged to lower socio - economic status , with the rest belonging to middle socio - economic status .\nthis difference was not statistically significant ( chi - square=3.23 , df=1 , p=0.07 ) .\na significantly higher ( chi - square=8.99 , df=2 , p=0.01 ) percentage of male subjects ( 10.6% ) were the primary earning member of the family as compared to female subjects ( none ) .\nfamily history of psychiatric illness was positive in 9.8% of male subjects and 10.8% of female subjects [ table 2 ] .\nof these , around 76.4% of the family members were suffering from schizophrenia . in - between group differences for male and female subjects for illness\nrelated variables there was no significant difference between male and female subjects for the duration of illness ( t=1.20 , p=23 , 95% ci-4.62 - 1.12 ) and duration of being on treatment ( t=0.86 , p=38 , 95% ci-4.03 - 1.57 ) .\nthe mean global score on ideas were 12.29 sd2.67 and 11.78 sd2.82 for male and female subjects , respectively [ figure 1 and table 3 ] .\n* statistically significant difference at p<0.05 in - between group differences for male and female subjects for age , illness related and ideas variables male and female subjects did not differ significantly on the ideas global score ( t=1.01 , p=31 , 95% ci-0.48 - 1.51 ) , personal care ( t=0.68 , p=0.49 , 95% ci-0.20 - 0.41 ) , interpersonal interaction ( t=0.35 , p=0.72 , 95% ci-0.33 - 0.22 ) , and understanding and communication ( t=0.16 , p=0.87 , 95% ci-0.33-.28 ) domains of ideas .\nthe two groups differed significantly on the work domain ( t=3.92 , p<0.05 , 95% ci-0.43 - 1.30 ) .\nthe disability on work domain was higher for male ( mean=3.38 sd1.21 ) as compared to female ( mean=2.51 sd1.09 ) subjects .\naround 59.8% of male subjects and 56.7% of female subjects were suffering from moderate level of disability .\nsevere disability was found in 34.8% of male subjects and 35.1% of female subjects [ table 2 ] . there was a significant positive correlation between total duration of illness and global ideas score ( r=0.287 , p=0.001 ) and duration for seeking treatment and global ideas score ( r=0.242 , p=0.005 ) for male subjects [ table 4 ] .\ncorrelation between socio - demographic , illness variables and ideas score for the male subjects however , no such correlation was observed for female subjects [ table 5 ] .\ncorrelation between socio - demographic , illness variables and ideas score for the female subjects additionally , the subjects with or without a family history of psychiatric illness did not differ on various domains of ideas scale as well as global ideas score [ table 6 ] . in - between group differences for the study variables for subjects with and without a family history of psychiatric illness\nthe current study aimed at assessing the profile of patients with schizophrenia seeking disability certification at a tertiary care multispecialty hospital in india . additionally it aimed at assessing the various socio - demographic and illness related variables among these individuals .\nthe existing indian literature on disability among patients diagnosed with schizophrenia has focused on patients seeking treatment in out - patient , in - patient and community settings .\nwe analyzed a total of a total of 169 subjects seeking disability certification over the study period of 5 years was diagnosed with schizophrenia .\nschizophrenia remains the most common diagnosis among previous indian studies on disability among treatment seeking psychiatric patients .\nreported 65.3% of the subjects to be diagnosed with schizophrenia in their total sample of 285 over a 3 year period .\nhowever , affective disorders have been found to be the most common cause of disability among not treatment seeking individuals in community based studies . in spite of comparatively lower prevalence than other mental disorders schizophrenia continues to be over represented among treatment seekers in hospitals . in the current study ,\nan overwhelming majority of study subjects were male . in a community based epidemiological survey for disability in rural karnataka ,\nfemales constituted 68% of individuals with mental disability . in a recent study from karnataka , females constituted 49.1% of all disability certificate seeking individuals over a 3 year period .\nsimilarly , in a study among long stay patients diagnosed with schizophrenia 67.86% were male . in another study from assam ,\n31.6% of the study subjects were female . while previous indian studies have reported relatively later help seeking for female patients suffering from schizophrenia , the same is not reflected in the findings of the current study .\nin the present study male and female subjects did not differ significantly with regards to age at presentation , total duration of illness and duration since seeing treatment .\nthe study by kujur et al . also observed a significant difference in marital status of male and female patients with schizophrenia with majority ( 57.7% ) of women were separated from their husbands . a significantly higher proportion of female subjects were divorced or separated in the current study .\nprevious studies from the west have documented moderate disability in most of patients diagnosed with schizophrenia irrespective of the setting . in the current study\nindian studies have revealed the disability among patients with schizophrenia to moderate to severe as early as 2 - 5 years after illness onset . in a study from assam ,\n64% of patients suffering from schizophrenia and 30% of those suffering from bipolar affective disorder had severe disability as per the ideas .\nhowever , an indian study among non - treatment seeking individuals in a community setting found mild disability as the most common . in the present study , the highest disability for both male and female subjects was observed in the work domain of ideas .\nprevious indian studies have also reported occupational disability as the most disabling of all the categories . additionally , the least disability observed for personal care ( for both male and female subjects ) was also in keeping with similar observations in previous studies .\nhowever , another indian study conducted in a mental hospital setting found the highest level of disability for understanding and communication domain of world health organisation disability assessment schedule ii ( whodas ii ) .\ndisability in schizophrenia has been found to be affected by characteristics like age of onset and duration of illness among other factors . in a previous indian study from ranchi\nit was found that duration of illness has a significant correlation with personal areas of disability and age of onset has significant positive correlation with personal and occupational area of disability .\nhowever , in the current study a significant positive correlation between total duration of illness and global ideas score was observed only for the male subjects .\na previous study by thara et al . found a significantly higher global disability and occupational disability among male patients suffering from schizophrenia as compared to the female patients .\nhowever , the two did not differ for disability on other domains including self - care , social withdrawal and social contact . in the present\nalso the male and female subjects differed significantly only on the work domain of ideas .\nno significant differences were observed for personal care , interpersonal interaction and understanding and communication domains .\nalso , there was no significant difference on the global ideas score for male and female subjects .\nstigma , poor knowledge about the ideas , fear of misuse of certificates , discomfort to approach government hospitals , time constraints , rigid negative thinking about legal issues , denial of disability have been specified as some of reasons for underutilization of disability certification .\nlack of education among disabled is an important barrier for effective delivery of services . according to national sample survey organization , 2002\ngender has been found to be an important determinant of help seeking for mental disorders .\nwomen with common mental disorders were more likely to have sought some form of help than men in studies from western setting .\nhowever , the situation is different in developing countries such as india . due to socio - cultural factors women\nresearchers has revealed that those closest to the individual play an influential role in whether or not an individual seeks mental health services when experiencing distressing symptoms .\nmulti - ethnic studies have reported that asian patients with psychiatric illness tend to show the longest delay in help seeking .\nmore intensive , extended and persistent family involvement is a possible reason for the delay in seeking help by these individuals .\nthe present study offers some interesting and important insights in to disability certification seeking behavior of patients diagnosed with schizophrenia .\nthere is a relatively long gap between the onset of illness and disability certification . in spite of regulatory threshold of 2 years ,\nalso , all the female subjects in the present study were not gainfully employed and were financially dependent on the family . also , a significant greater proportion of them were either divorced or separated .\nthe findings also suggest a relatively early stabilisation of disability among females as the duration of illness was not found to be correlated with global ideas score .\nhowever , there was a significant correlation between these two variables for male subjects . relatively later impact of disorder on employment status is a likely possible reason for this observation .\nlack of impact of presence of psychiatric illness in another family member does not impact the disability seeking behavior of the study subjects .\nthis is a worrisome finding and it reflects poor education of family with regard to the provisions of disability certification and disability benefits available .\nthere is a need to disseminate information related to impact on disabled , community mobilization , opportunity for education , opportunity for work , transfer skills to community level , program activities , and involvement of disabled people .\nalso , research with respect to services , fund allocation , cost - effectiveness , manpower , training , and technical aid of disabled people should be strengthened .\na special emphasis should be placed on providing rehabilitation services and disability benefits to the unreached persons with disabilities living in rural areas and small towns of the country .\npositive impact of disability assessment camps on disability certification seeking behavior has been documented in india .\neven those who have received disability certification do not utilize the disability benefits offered by the government .\nthe underutilization is even more prominent in rural areas with disability pension being the most utilized benefit .\nwe included all the subjects diagnosed with schizophrenia seeking disability certification over the study period .\nassessment was carried out using a standardized indian instrument that has been used previously in indian settings . however , there are certain limitations as well .\nalso , the findings need to be replicated in multisite studies before they could be generalized .\nalso , it would be informative to review these subjects over time to assess the stability of disability level .\nadditionally , information on the utilization of disability benefits subsequent to certification should also be assessed in future studies .\nwe included all the subjects diagnosed with schizophrenia seeking disability certification over the study period .\nassessment was carried out using a standardized indian instrument that has been used previously in indian settings .\nalso , the findings need to be replicated in multisite studies before they could be generalized .\nalso , it would be informative to review these subjects over time to assess the stability of disability level .\nadditionally , information on the utilization of disability benefits subsequent to certification should also be assessed in future studies .\nmajority of patients with schizophrenia seeking disability certificate continue to be male . however , male and female subjects tend to differ very little on various socio - demographic and illness related variables .\nthere are significant difference in the likely impact of schizophrenia on marital status of males and females .\nhowever , the work related disability is relatively higher among males and females continue to be financially dependent on the family members .", "human": " background : schizophrenia has been identified as one of the most disabling condition known to mankind . until recently there was no published literature on disability certification seeking behavior of patients diagnosed with schizophrenia . the current study aimed at understanding the profile of patients diagnosed with schizophrenia seeking disability certification for a tertiary level multispecialty hospital in india.materials and methods : \n the study was carried out at the psychiatry department for a tertiary care hospital in india . \n the evaluation of the subjects was carried out in the presence of a primary care giver . \n first , the diagnosis was established using international statistical classification of diseases and related health conditions ( icd)-10 . \n subsequently , the disability was assessed using indian disability evaluation assessment scale ( ideas ) . \n data were analyzed using spss ( statistical package for social sciences ) software version 17.results:a total of 169 subjects seeking disability certification over the study period of 5 years were diagnosed with schizophrenia . out of 169 subjects 132 ( 78.1% ) were male and 37 ( 21.9% ) were female . \n there was a statistically significant difference in the marital status of the male and female study subjects . \n family history of psychiatric illness was positive in 9.8% of male subjects and 10.8% of female subjects . \n there was no significant difference between male and female subjects for the duration of illness and duration of being on treatment . \n male and female subjects did not differ significantly on the ideas global score , personal care , interpersonal interaction , and understanding and communication domains of ideas . \n the two groups differed significantly on the work domain.conclusions:majority of patients with schizophrenia seeking disability certificate continue to be male . \n however , male and female subjects tend to differ very little on various socio - demographic and illness related variables . the levels of disability are also comparable among males and females . \n however , the work related disability is relatively higher among males and females continue to be financially dependent on the family members . ", "section_names": "INTRODUCTION\nMATERIALS AND METHODS\nStudy instrument\nStatistical analysis\nRESULTS\nDISCUSSION\nStrengths of the study\nLimitations of the study\nCONCLUSIONS", "bigbird_pegasus": "<s> background : till recently there was no published literature on disability certification seeking behavior of patients diagnosed with schizophrenia.<n> the current study aimed at understanding the profile of patients diagnosed with schizophrenia seeking disability certification for a tertiary level multispecialty hospital in india.materials and methods : the study was carried out at the psychiatry department for a tertiary care hospital in india.<n> we here present the findings form review of cases seeking disability certification over a 5 year period.results:the study included a total of 285 cases.<n> most ( 65.3% ) of the subjects were single, employed ( 100% ), with no dependents ( 62.1% ).<n> the mean global disability score was 12.29 sd2.82 for male and 12.29 sd2.82 for female subjects.<n> severe disability was observed in 34.8% of male subjects and 35.1% of female subjects.<n> family history of psychiatric illness was positive in 78.1% of male subjects and 10.8% of female subjects.<n> there was a significant correlation between total duration of illness and global disability score ( r=0.287, p=0.72 ).<n> the most common cause of disability for both male and female subjects was from an urban setting.conclusions:disability is an important determinant for effective delivery of services.<n> the most common diagnosis among previous indian studies were from urban areas.<n> family history.<n> family history of the family history of the family history..<n>..<n> the family history.<n>........<n>.<n>.........<n>..........<n>.......<n><n><n><n> is a family..<n>..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> is a family..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n>", "longt5": "<pad> background : schizophrenia is one of the most disabling conditions known to mankind. it is also being increasingly recognized that disability is one of the outcome indices for chronic illnesses such as schizophrenia.aims:the current study aimed at understanding the profile of patients diagnosed with schizophrenia seeking disability certification for a tertiary level multispecialty hospital in india.materials and methods : the study was carried out at the psychiatry department for a tertiary care hospital in india. the study was carried out at the psychiatry department for a tertiary care hospital in india. the evaluation board comprised of qualified psychiatrists with at least 3 years of post - senior residency experience in psychiatry.results:a total of 169 subjects seeking disability certification over the study period of 5 years were diagnosed with schizophrenia. the mean age of male subjects and female subjects were 36.89 ( standard deviation 9.67 ) years and 39.56 ( sd11.79 ) years, respectively. there was a statistically significant difference ( chi - square=25.27, df=4, p<unk>0.05 ) in marital status of the male and female study subjects. there was no significant difference between male and female subjects for the duration of illness ( t=1.20, p=23, 95% ci-4.62 - 1.12 ) and duration of being on treatment ( t=0.86, p=38, 95% ci-4.03 - 1.57 ). the mean global score on ideas were 12.29 sd2.67 and 11.78 sd2.82 for male and female subjects, respectively. the two groups differed significantly on the work domain ( t=3.92, p<unk>0.05, 95% ci-0.43 - 1.30 ). there was a significant positive correlation between total duration of illness and global ideas score ( r=0.287, p=0.001 ) and duration for seeking treatment and global ideas score ( r=0.242, p=0.005 ) for male subjects.conclusion:majority of patients with schizophrenia seeking disability certificate continue to be male. however,"}
{"article": "regeneration of lost periodontal structures , especially the lost alveolar bone , is a matter of prime concern in the clinical management of periodontal disease as bone destruction is primarily responsible for tooth loss .\ndifferent therapeutic modalities such as autogenous bone graft and allograft etc . have been recommended for restoring periodontal osseous defects with their own set of advantages and inherent disadvantages such as sense of procurement of the same , patients discomfort ; antigenic reactivity , danger of transmission of diseases such as hiv etc .\nrecently , choukroun 's platelet - rich fibrin ( prf ) and a unique alloplastic graft material hydroxyapatite ( hap)-bioactive glass ( bg ) composite granules ( biograft habg active ) because of promising regenerative potential attracted lot of attention of various researchers .\nthe purpose of this case report is to describe the current concept of periodontal diagnosis and to evaluate clinically as well as radiographically the efficacy of choukroun 's prf and biograft habg active combination in the treatment of localized advance intrabony and grade ii furcation defect in # 36 .\na 25-year - old female patient reported to the department of periodontics with chief complaint of teeth discoloration , mild and intermittent pain in left lower back tooth region , and bleeding gums while brushing since childhood , 12 and 2 months , respectively . on examination , dental fluorosis , local factors , and gingival inflammation were observed [ figure 1 ] ; bleeding on probing , vertical probing depth ( vpd ) of 45 mm with clinical attachment loss ( cal ) of 12 mm was present in more than 30% teeth , but distobuccal , distolingual , and mid - lingual aspect of vital tooth # 36 showed vpd 11 , 4 and 10 mm [ figure 2 ] with advance cal of 9 , 2 , and 8 mm , respectively , along with horizontal probing depth ( hpd ) of 6 mm with lingual grade ii furcation involvement .\nthe orthopantomogram [ figure 3 ] and intraoral periapical radiograph [ figure 4 ] revealed generalized mild bone loss with advance bone loss in furcation and on the distal surface of # 36 .\ngeneralized mild chronic periodontitis with localized advance loss of periodontal support in # 36 was diagnosed .\nclinical frontal aspect depicts dental fluorosis and local factors associated gingival inflammation ( a ) vertical probing depth of 10 mm at mid - lingual and ( b ) distobuccal aspect of # 36 , respectively orthopantomogram reveals generalized mild bone loss with advance bone loss in furcation and on the distal surface of # 36 intraoral periapical radiograph showing interradicular bone loss and severe osseous defect at distal aspect of # 36 after phase i therapy , plaque control was re - evaluated every 2 week and maintenance therapy was reinforced as per need . by the end of 8 weeks , gingiva was found healthy with normal sulcus depth , but no change was observed in # 36 .\nthe management of existing isolated intrabony and grade ii furcation defect in # 36 utilizing different periodontal regenerative treatment modalities such as bone grafts and guided tissue regeneration was discussed in detail with the patient .\nchoukroun 's prf and biograft habg active was selected , and duly signed consent from the patient was taken .\nthe patient was advised routine blood , urine investigations which were within the normal limits and hiv , hepatitis c virus , and hepatitis viral markers were reported to be negative .\nprf prepared just before the surgery as per protocol developed by choukroun 's et al . ten milliliters of blood sample was taken from antecubital vein of the patient in sterile glass tube without an anticoagulant and centrifuged at 24002800 rpm for 12 min .\na fibrin clot was formed in the middle part of the tube whereas the upper and bottom part contained acellular plasma and red corpuscles , respectively . under aseptic condition , after local anesthesia administration both the buccal and lingual full - thickness flaps were reflected after crevicular incision with respect to # 35#37 followed by thorough subgingival scaling and root planing of both furcation and intrabony defects associated with # 36 . a fibrin clot formed in the middle part of the tube was obtained and amalgamated with biograft habg active and filled in both furcation and intrabony defects of # 36 followed by direct loop sutures and periodontal dressing application . the patient was instructed oral rinse twice daily with 0.2% chlorhexidine for 2 weeks and amoxicillin 500 mg and ibuprofen 400 mg was advised thrice a day for 5 days .\nreduction in vpd [ figure 5 ] , hpd [ figure 6 ] , and cal was observed at 3 , 9 , 12 months as shown in .\npostoperative radiographic evaluation of # 36 at 3 months showed mild changes [ figure 7a ] whereas complete healing of grade ii furcation and intrabony defect up to the adjacent mesial alveolar bone margin of # 37 observed at 9 and 12 months [ figure 7b and c ] .\n( a ) vertical probing depth distobuccal aspect reduced to 6 mm ( b ) reduced to 4 mm ( c ) reduced to 3 mm at 3 , 9 and 12 months postoperative respectively ( a ) horizontal probing depth 4 mm ( b ) 3 mm ( c ) 0 mm at 3 , 9 and 12 months postoperatively postoperative healing of hard structures at ( a ) at 3 months ( b ) 9 months ( c ) 12 months respectively\nchronic periodontitis is characterized by loss of attachment due to destruction of periodontal ligament , loss of adjacent supporting bone ; usually slow to moderate rate of progression but may have the period of rapid destruction localized , involving one area of the tooth 's attachment or more generalized .\nthe area of rapid destruction characterized by probing depth > 6 mm with attachment loss > 4 mm , furcation involvement if present will exceed class i ( incipient ) with radiographic evidence of same .\nthe severity and distribution / extent of chronic periodontitis was diagnosed on the basis of 1999 international workshop for classification of periodontal diseases and condition ; and american academy of periodontology task force report 2014 , respectively ( the task force preferred to use the percentage of affected teeth rather than the percentage of affected sites as an extent descriptor for chronic periodontitis that is generalized chronic periodontitis may be defined as periodontitis without a clear pattern of disease distribution of affected teeth or > 30% of affected teeth ) .\nsimilarly , in the present case , the generalized chronic mild periodontitis was observed in > 30% of the teeth along with localized severe loss of periodontal support with respect to # 36 , therefore , diagnosed as generalized chronic mild periodontitis associated with localized advance loss of periodontal support in # 36 .\nas regeneration in furcation and deep intrabony defect is difficult to attain because anatomy that impedes the accessibility for individual oral hygiene in molars , professional root debridement and due to slow and difficult integration of the grafted material into the physiological architecture as cited in reports of sharma and pradeep and rastogi et al .\n, respectively . in spite of different periodontal regenerative approaches , as currently , not a single regenerative material is considered gold standard in the treatment of osseous defects ; therefore , amalgamation of biograft habg active and choukroun 's prf was utilized because of their promising properties in the present report to obtain maximum outcome .\nreported that the interleukin ( il ) 1 , il 6 , tumor necrosis factor- , il 4 , vascular endothelial growth factor ( vegf ) in the prf clot play a crucial role in balancing the tissue homeostasis , whereas the healing cytokines il 4 and vegf inhibit inflammatory signal pathways thereby support and coordinate the neovascularization which may be the reason for uneventful healing in present case .\nthe present case report showed reduction in pds , cal clinically and complete healing of furcation as well as intrabony defect radiographically ; may be due to the property of biograft habg that bonds with host bone faster than hap ceramics and resorbs slowly but completely than bg , which is replaced and remodeled by the new bone .\nprf when used as a membrane or as a grafting material creates an improved space making effect , which facilitates cell events that are favorable for periodontal regeneration leading to mineralized tissue formation , and it also induces the cell proliferation of osteoblasts , periodontal ligament cells , growth factors , but suppress the oral epithelial cell growth .\nthe combined effect prf and biograft habg because of their distinct properties along with thorough debridement may result in excellent outcome in the present case report , which is in accordance with the reports of rastogi et al .\nutilized hap particles with prf membrane in the intrabony defect , whereas salaria et al .\namalgamation of prf and biograft habg active was effective for the management of adjoin localized advance intrabony and grade ii furcation defect in the same tooth , but long - term randomized clinical trials should be undertaken before reaching final conclusion .", "human": " periodontal disease is infectious , complex , multifactorial , chronic inflammatory disease of supporting periodontal tissues that not only alters the bone morphology but also leads to the reduction in bone height . \n different types of bony deformities such as horizontal , vertical , craters , and furcation result from periodontal disease , but vertical and grade ii furcation defects are more amenable to regenerative periodontal therapy . \n the present case report describes the current concept of periodontal diagnosis and the clinical radiographical efficiency of platelet - rich fibrin and hydroxyapatite bioactive glass composite granules graft combination in the management of localized advance osseous defects with respect to tooth number 36 in chronic periodontitis patient at 1 year postoperatively . ", "section_names": "Introduction\nCase Report\nDiscussion\nConclusion\nFinancial support and sponsorship\nConflicts of interest", "bigbird_pegasus": "<s> the purpose of this case report is to describe the current concept of periodontal diagnosis and to evaluate clinically as well as radiographically the efficacy of choukroun's platelet - rich fibrin ( prf ) and biograft mineralized glass ( bg ) composite granules ( biograft habg active ) in the treatment of localized advance intrabony and grade ii furcation defect in # 36.<n> a 25-year - old female patient reported to the department of periodontics with chief complaint of teeth discoloration, mild and intermittent pain in left lower back tooth region, and bleeding gums while brushing since childhood, 12 and 2 months, respectively. generalized mild chronic periodontitis with localized advance loss of periodontal support in # 36 was diagnosed.<n> choukroun's prf and biograft habg active were amalgamated in both furcation and deep intrabony defect.<n> reduction in vertical probing depth, clinical attachment loss, and radiographic evidence of bone fill at 3, 9 and 12 months were observed.</s>", "longt5": "<pad> the purpose of this case report is to describe the current concept of periodontal diagnosis and to evaluate clinically as well as radiographically the efficacy of choukroun's platelet - rich fibrin ( prf ) and biograft habg active combination in the treatment of localized advance intrabony and grade ii furcation defect in # 36. a 25-year - old female patient reported to the department of periodontics with chief complaint of teeth discoloration, mild and intermittent pain in left lower back tooth region, and bleeding gums while brushing since childhood, 12 and 2 months, respectively. on examination, dental fluorosis, local factors, and gingival inflammation were observed ; bleeding on probing, vertical probing depth ( vpd ) of 45 mm with clinical attachment loss ( cal ) of 12 mm was present in more than 30% teeth, but distobuccal, distolingual, and mid - lingual aspect of vital tooth # 36 showed vpd 11, 4 and 10 mm, and advance cal of 9, 2, and 8 mm, respectively, along with horizontal probing depth ( hpd ) of 6 mm with lingual grade ii furcation involvement. the orthopantomogram and intraoral periapical radiograph revealed generalized mild chronic periodontitis with localized advance loss of periodontal support in # 36. a fibrin clot formed in the middle part of the tube was obtained and amalgamated with biograft habg active and filled in both furcation and intrabony defects of # 36 followed by direct loop sutures and periodontal dressing application. postoperative radiographic evaluation of # 36 at 3 months showed mild changes whereas complete healing of grade ii furcation and intrabony defect up to the adjacent mesial alveolar bone margin of # 36 observed at 9 and 12 months. the combined effect prf and biograft habg because of their distinct properties along with thorough debridement may result in excellent outcome in the present case report.</s>"}
{"article": "drug rash with eosinophilia and systemic symptoms ( dress ) syndrome was first described by bocquet et al . in 1996 .\nhowever , the most frequent causes are anticonvulsants , sulfonamides , dapsone , allopurinol , minocycline , and gold salts [ 13 ] .\nin addition to hematologic , hepatic , cardiac , neurological , gastrointestinal , and endocrine abnormalities , pulmonary involvement is observed rarely . in this study ,\ndress syndrome was presented with multiorgan involvement based on carbamazepine use in a 14-year - old female patient .\npulmonary involvement presented in the form of pleurisy and atelectasis , different from the literature , and as a long - term sequela , type 2 diabetes was observed in our case .\na 14-year - old female patient presented at our clinic due to skin rash and fever lasting for 1 week .\nit was found in her history that carbamazepine treatment had been initiated owing to epilepsy 15 days before her symptoms began .\nthere had been no transmitted chronic disease history such as viral , bacterial , or parasitic infection before the patient 's reaction in question . on the physical examination , she had 38.5c core temperature , and there was a bilateral crepitant rale condition determined by listening on her respiratory system examination .\n, there were maculopapular rashes in the process of healing with desquamation that involved > 50% of the body ( fig .\nthere was microscopic hematuria in her total urinalysis . in the viral serological evaluation of the case , ebstein - barr virus ( ebv ) ,\nherpes virus type 1 - 2 , hepatitis a - b - c virus , hiv , and toxoplasma were established as negative .\nimmunoglobulins , c3 and c4 levels , urinalysis were normal . in the punch biopsy obtained from the skin lesions ,\ndue to the drug intake history and the clinical , laboratory , and histopathological findings , carbamazepine treatment was discontinued in our patient .\ndesloratadine antihistaminic 5 mg / day treatment and systemic steroid 1 mg / kg / day ( 40 mg / day ) were added to the therapy .\nowing to the chest pain and the reduction in lung sounds in basals and since the sinuses were monitored as closed in the chest radiography , thorax ultrasonography was carried out , and bilateral pleural effusion 6 mm thick was determined . in the thorax ct performed on the patient , a local consolidated area in the middle lobe segment of the right lung , atelectatic changes in the lower lobes of both lungs , and thickness in the left fissure were seen .\nsince there was symptomatic hyperglycemia on the second day of steroid treatment , the steroid was discontinued .\nthe patient was found hyperglycemic ( fasting blood glucose : 120 - 180 mg / dl , postprandial blood glucose:160 - 250 mg / dl ) .\nthe 33-year - old mother was diagnosed with type 2 diabetes at the age of 26 years .\nphysical examination revealed a weight of 52.8 kg ( 64 percentile , 0.38 sds ) , a height of 151 cm ( 8 percentile , 1.38 sds ) , body mass index of 23.56 ( 1.52 sds ) and normal vital signs .\nislet cells cytoplasmic autoantibodies ( ica ) were negative as tested by indirect immunofluorescence and her glutamic acid decarboxylase autoantibodies ( gada ) , which was measured by radioimmunoassay , were also negative and fasting levels of c - peptide and insulin ( electrochemiluminescent immunoassay ; roche diagnostics , penzberg , germany ) remained detectable throughout the observation period ( c - peptide 2.1 - 6.23 ng / ml ) . with an hba1c value of 8.6% , she was diagnosed with diabetes mellitus .\nthe combination of long - standing non - ketotic hyperglycemia , glycosuria , at a relatively high fasting and postprandial blood glucose , and negative pancreatic auto - antibodies in a child with a diabetic mother raised the possibility of mody .\ndirect dna sequencing of all exons and intron - exon bounders of the mody genes revealed no mutation in our patient .\ninsulin treatment was discontinued as the hyperglycemia disappeared , and metformin treatment was initiated with the type 2 diabetes diagnosis .\nthe patient was discharged from the hospital after the lung , skin , liver , and renal findings regressed .\na patch test was performed with carbamazepine 10% concentration 6 weeks later . as a result of\nthe evaluation carried out 48 , 72 , and 96 h later , + 1 sensitivity was determined ( fig .\n2 ) . although the skin , liver , renal and lung findings resolved during the 1-year follow - up period , regulation of type 2 diabetes with an oral antidiabetic continued . a ) maculopapular lesion in the recovery process with desquamation on the erythematous base .\nb ) skin biopsy determined by lymphocytic infiltration in the papillary dermis epicutaneous patch test with carbamazepine\ndress syndrome , known as drug hypersensitivity syndrome , is a quite rare acute , idiosyncratic , and life - threatening drug reaction characterized by fever , skin rash , and single or multiple internal organ involvement [ 3 , 4 ] .\nthere is an average 3- to 9-week latent period ( 0.5 - 16 weeks ) between drug use and the emergence of symptoms .\nthese findings can persist or exacerbate although the responsible drug is discontinued [ 1 , 3 , 5 ] .\nfever , skin rash , liver involvement , hypereosinophilia , and lymphadenopathy can be seen in almost all patients .\nthere was pulmonary involvement presented by pulmonary atelectasia and pleurisy as well as maculopapular rash , fever , and hypereosinophilia , liver involvement manifested with transaminase elevation , and renal involvement was characterized by microscopic hematuria in the case .\nit has been suggested that there is a delayed hypersensitivity reaction related to t lymphocytes against toxic metabolites of drugs , and viral infections ( ebv , human herpes virus , types 6 and 7 ) can also play a role in the etiology .\nit has been reported in the literature that there can be a genetic predisposition , and families of patients diagnosed with dress syndrome are also at risk in terms of this syndrome .\nit has been maintained in recent years that human herpes virus type 6 reactivation can also be used as a diagnostic marker [ 1 , 3 , 6 , 7 ] .\nthe positive result on the patch test with carbamazepine conducted 6 weeks later supports that there was a delayed hypersensitivity reaction .\nthe main principle in the treatment of dress syndrome is to discontinue the drug or drugs thought to be suspicious immediately and provide supportive care .\nsystemic steroid is particularly recommended in internal organ involvement [ 2 , 3 , 7 ] .\nhyperglycemia thought to be dependent on steroid treatment in the first place preceded although steroid treatment was discontinued and insulin treatment had to be commenced .\ntype 1 diabetes and pancreatitis have been reported in patients with dress syndrome in the literature [ 6 , 9 ] . however , our patient 's lipase level was normal , and no laboratory finding supporting type 1 diabetes was diagnosed in our patient .\nalthough the hyperglycemia finding in the patient was not linked to dress syndrome in the first place , it was evaluated as dress syndrome related to type 2 diabetes by the endocrine department since it had a clinical table regulated by oral antibiotic in 1-year follow - up period . in the literature , various long - term sequelae concerning dress syndrome have been observed . in a study by chen et al .\n, a long - term sequelae rate was reported as 11.5% in analyses of 52 patients of whom 9 were lost and 43 recovered .\nthe researchers reported that a total of 4 patients had autoimmunity disease , including 2 with grave 's disease , 1 with type 1 diabetes , and 1 with autoimmune hemolytic anemia .\nthey also observed that lifetime hemodialysis was necessary due to renal failure in 2 patients with organ involvement . in a study in which 34 patients were evaluated ,\nhowever , the researchers reported that autoimmune disease developed in 2 patients , including 1 with lupus erythematosus and 1 with autoimmune thyroiditis .\nreported 11 patients with type 1 diabetes related to dress syndrome and observed that half of the patients developed non - autoimmune fulminant type 1 diabetes .\nhowever , no case of type 2 diabetes associated with dress syndrome has been reported thus far . to the best of our knowledge\n, this case is the first in whom dress syndrome initially developed followed by type 2 diabetes .\ndress syndrome is an acute , life - threatening , and rarely seen drug reaction .\nit should be considered a definitive diagnosis in patients with fever , diffuse skin rash , and internal organ involvement . the drugs used by patients should be questioned .\nit should be kept in mind that a variety of organ involvement as well as long - term sequelae can also be seen in patients with dress syndrome .", "human": " drug rash with eosinophilia and systemic symptoms ( dress ) syndrome is an uncommon , life - threatening drug reaction . \n the basic findings are skin rash , multiorgan involvement , and eosinophilia . \n most of the aromatic anticonvulsants , such as phenytoin , phenobarbital and carbamazepine can induce dress . \n herein we report a 14-year - old patient with dress syndrome related to carbamazepine use . \n the patient presented with signs of involvement of the skin , lungs , liver , and microscopic hematuria . \n carbamazepine treatment was discontinued ; antihistamines and steroids were started . \n hyperglycemia , commencing on the first dose of the steroid given , persisted even after the discontinuation of steroids and improvement of other signs . \n there were no signs of pancreatitis or type 1 diabetes clinically in laboratory tests . \n her blood glucose levels were regulated at first with insulin and later with metformin . within 1 year of follow - up , still regulated with oral antidiabetics , she has been diagnosed with type 2 diabetes . \n formerly , long - term sequelae related to  drug rash with eosinophilia and systemic symptoms syndrome  such as hepatic and renal failure , type 1 diabetes mellitus , grave 's disease , autoimmune hemolytic anemia , and lupus have also been reported . however , up to date , no cases with type 2 diabetes have been reported as long - term sequelae . to our knowledge , this is the first case in the literature presenting with type 2 diabetes as long - term sequelae . ", "section_names": "Introduction\nCase report\nDiscussion\nNone", "bigbird_pegasus": "<s> drug rash with eosinophilia and systemic symptoms ( dress ) syndrome is characterized by skin, hepatic, cardiac, neurological, endocrine, and hematologic abnormalities. in this study, dress syndrome was presented with multiorgan involvement based on carbamazepine use in a 14-year - old female patient. pulmonary involvement presented in the form of pleurisy and atelectasis, different from the literature, and as a long - term sequela, type 2 diabetes was observed in our case.</s>", "longt5": "<pad> drug rash with eosinophilia and systemic symptoms ( dress ) syndrome is a quite rare acute, idiosyncratic, and life - threatening drug reaction characterized by fever, skin rash, and single or multiple internal organ involvement. it should be considered a definitive diagnosis in patients with fever, diffuse skin rash, and internal organ involvement. the drugs used by patients should be questioned. it should be kept in mind that a variety of organ involvement as well as long - term sequelae can also be seen in patients with dress syndrome.</s>"}
{"article": "superficial leiomyosarcomas are rare malignant tumors that account for only 510% of all soft tissue sarcomas .\nthey can be subdivided into two types according to its primary site of origin : deep subcutaneous and superficial cutaneous types .\nprimary cutaneous leiomyosarcoma ( pcl ) is a rare subtype with few isolated case reports and occasional case series described in the literature .\nwe report the clinical , histopathological and immunohistochemical findings in a 70-year - old male patient with pcl arising in the right leg .\na 70-year - old male patient presented with a painful nodule in the right leg , which had been progressively increasing in size for 4 months . on palpation , an irregular , firm , tender exophytic swelling , measuring 5 cm  5 cm , with overlying skin showing ulceration was noted on the lateral aspect of the lower one third of the right leg [ figure 1a ] .\nhis past history was significant of a trauma and subsequent non - healing ulcer formation at the same site in the right leg .\n( a ) clinical photograph showing an irregular , exophytic swelling , measuring 5 cm  5 cm , with overlying skin showing ulceration on the lateral aspect of the lower one - third of the right leg .\n( c ) gross photograph showing greyish white , solid , homogenous and fleshy cut surface of the irregular tumor mass measuring 5 cm  5 cm  2.5 cm systemic examination and investigations , including complete blood count , fasting blood sugar level , liver function test and renal function test , were within normal limits .\nhepatitis b virus surface antigen and human immunodeficiency virus enzyme - linked immunosorbent assay were non - reactive .\na clinical diagnosis of squamous cell carcinoma was considered and fine needle aspiration cytology of the swelling was requested .\nfine needle aspiration cytology of the same was reported as a spindle cell neoplasm with suspicion of malignancy .\nthe swelling was excised with a 5 cm resection margin and submitted for histopathological examination [ figure 1b ] .\ngross inspection revealed a grey brown , irregular , nodular soft tissue mass , measuring 5 cm  5 cm  2.5 cm and partly covered with skin .\nthe cut surface of the mass was greyish white , solid , homogenous and fleshy [ figure 1c ] .\nthe neoplasm was composed of bundles of elongated spindle cells arranged in interlacing fascicles , with intensely pink , fibrillary cytoplasm and pleomorphic nuclei with coarse irregularly dispersed chromatin .\nmitosis , including atypical , amounting to 22 mitotic figures per 10 high power fields and multinucleate tumor giant cells , was evident .\n( a ) light microscopy revealed a dermal neoplasm with extension into the subcutaneous tissue ( h & e , 40 ) .\n( b ) neoplasm composed of interlacing fascicles of elongated spindle cells ( h & e , 100 ) .\n( c ) tumor cells are spindle shaped with intensely pink , fibrillary cytoplasm and pleomorphic hyperchromatic nuclei frequently exhibiting atypical mitosis ( black arrow ) ( h & e , 400 ) .\n( d ) tumor cells with markedly pleomorphic nuclei and multinucleate tumor giant cell ( inset ) ( h & e , 400 ) a provisional diagnosis of spindle cell malignant neoplasm of the skin , which typically includes a host of diagnostic possibility , namely fibrosarcoma , leiomyosarcoma , malignant peripheral nerve sheath tumor , monophasic synovial sarcoma , malignant fibrous histiocytoma and spindle cell variant of squamous cell carcinoma , was considered and immunohistochemistry was advised for confirmation .\non immunohistochemistry , tumor cells showed strong immunopositivity for vimentin , muscle - specific actin ( msa ) , smooth muscle actin ( sma ) , caldesmon and desmin and negative for pancytokeratin , epithelial membrane antigen ( ema ) , myogenin , cd34 and s-100 protein [ figure 3 ] .\nimmunohistochemical staining : neoplastic cells showing positive immunostaining for ( a ) vimentin ( vimentin , 400 ) , ( b ) caldesmon ( caldesmon , 400 ) , ( c ) muscle - specific actin ( msa , 400 ) and ( d ) smooth muscle actin ( sma , 400 ) based on the immunophenotypic features , a final diagnosis of pcl was rendered .\nthe patient is currently on periodic follow - up since 1 year and no recurrence or metastasis has been identified so far .\nalthough pcl most commonly arises in the extremities , particularly hair bearing surfaces , it may occur at any anatomic site on the body .\nmost case series described in the literature report a predilection for the middle aged to elderly male . in a large case series reported by fields and helwig ,\n95% of the patients with pcl presented with a solitary nodule with a median size of 1.8 cm at presentation .\npain was reported by 24% of their patients at presentation , whereas pain could be elicited on pressure in an additional 27% of the patients .\nhistologically , pcl is characterized by a poorly circumscribed proliferation of interwoven fascicles of spindle shaped atypical myomatous cells that merge with a collagenous stroma .\nmitosis , equivalent to one or more per 10 high - power fields , high cellularity and bizarre myomatous cells are the generally accepted criteria for malignancy .\ndescribed two growth patterns : a nodular pattern characterized by high cellularity , prominent nuclear atypia , conspicuous mitosis and a diffuse pattern that is less cellular , well differentiated and inconspicuous mitosis .\nmorphologic differential diagnosis includes a galaxy of other malignant spindle cell neoplasms , namely desmoplastic malignant melanoma , spindle cell synovial sarcoma , spindle cell angiosarcoma , fibrosarcoma , malignant fibrous histiocytoma and malignant peripheral nerve sheath tumor .\ncutaneous leiomyosarcoma often exhibit immunophenotypic polymorphism , thereby mandating the use of a large panel of antibodies .\nhowever , none of these markers is absolutely specific for smooth muscle , and positivity for two of these markers is more supportive of leiomyosarcoma .\njensen et al . identified several poor prognostic factors , namely tumor size 5 cm , acral location , deep localization with fascia involvement and high histological grade .\ncutaneous leiomyosarcomas have fewer incidences of local recurrence ( 30 - 50% ) and negligible potential for distant metastases ( 010% ) . in contrast\n, subcutaneous leiomyosarcomas may develop local recurrence in about 4060% and distant metastasis in 2060% of patients .\na wide local excision with a 35 cm margin is usually an effective treatment for pcl .\n, pcl is a rare entity that must be borne in mind when encountered with a malignant spindle cell neoplasm of the skin and usually requires a panel of immunohistochemical markers to distinguish it from other cutaneous malignancies with spindle cell morphology .", "human": " primary cutaneous leiomyosarcoma ( pcl ) is an exceedingly uncommon malignant superficial soft tissue sarcoma with a predilection for middle - aged to elderly male . \n morphologic differential diagnosis includes a host of other malignant spindle cell neoplasms , thereby necessitating the use of a panel of immunohistochemical markers to arrive at a definitive diagnosis . \n we report a case of pcl arising in the right leg of a 70-year - old male . ", "section_names": "INTRODUCTION\nCASE REPORT\nDISCUSSION", "bigbird_pegasus": "<s> primary cutaneous leiomyosarcoma ( pcl ) is a rare subtype of cutaneous leiomyosarcoma, which most commonly occurs in the hair bearing extremities.<n> it is characterized by a poorly circumscribed proliferation of interwoven fascicles of elongated spindle cells that merge with a collagenous stroma.<n> we report the clinical, histopathological and immunohistochemical findings in a 70-year - old male patient with pcl arising in the right leg.</s>", "longt5": "<pad> primary cutaneous leiomyosarcoma ( pcl ) is a rare subtype with few isolated case reports and occasional case series described in the literature. we report the clinical, histopathological and immunohistochemical findings in a 70-year - old male patient with pcl arising in the right leg.</s>"}
{"article": "glutamate functions as the major excitatory neurotransmitter by binding to n - methyl - d - aspartate receptors ( nmdars ) that are widespread in the central nervous system .\nthe nmdars constitute a major class of ionotropic glutamate receptors and play an essential role in synaptic transmission , plasticity , and memory .\nactivation of nmdars results in cell membrane depolarization with an equilibrium potential near 0 mv , producing the excitatory postsynaptic potential ( epsp ) and leading to an increase of ca influx into the cell .\nthe intracellular ca can in turn function as a second messenger , mediating a variety of signaling cascades .\nexcessive activation of nmdars by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases ( choi et al .\nthe nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury , and a variety of antagonists or blockers of nmdars have been developed .\nunfortunately , the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars ( chen and lipton , 2006 ) .\ntherefore , a better understanding of the mechanism of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function , and may represent an alternative to treating nmdar - mediated excitotoxic injury .\nthis short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor ( ncs ) protein , dream / calsenilin / kchip3 .\nnmdars are believed to be heterotetrameric complexes composed of combinations of the obligatory nr1 subunit and nr2 and/or nr3 subunits ( chazot and stephenson , 1997 ; laube et al .\n, 1998 ; schorge and colquhoun , 2003 ; furukawa et al . , 2005 ) .\nthe nr1 subunit is encoded by a single gene but exists as eight functional splice variants , while the nr2 ( nr2a - b ) and nr3 ( nr3a - b ) subunits are encoded by four and two different genes , respectively .\nthe nmdar subunits form a central ion conductance pathway selective for cations such as na , k , and ca , and share a common membrane topology , with each subunit consisting of four transmembrane ( tm ) domains ( m1m4 ) .\nthe long extracellular n - terminal regions of nmdar subunits are organized as a tandem of two domains .\nthe first domain , called the n - terminal domain ( ntd ) that includes the first 380 amino acids , is involved in tetrameric assembly ( mayer , 2006 ; paoletti and neyton , 2007 ; stroebel et al . ,\nthe second domain of about 300 amino acids is known as the agonist - binding domain ( abd ) that precedes the tm1 domain .\nthe abd binds glycine ( or d - serine ) in the nr1 and nr3 subunits , whereas the nr2 abd binds glutamate ( furukawa et al .\n, 2005 ; yao and mayer , 2006 ) . the pore loop ( p loop ) , or the m2 region , forms the narrowest constriction of the channel ion conductance pathway and determines the permeation properties of nmdars .\nthe nmdars feature an intracellular c - terminal tail of about 400600 residues that has a strong diversity in its amino acid sequence .\nthe c - terminal tails of nmdar subunits contain a series of short motifs that interact with intracellular factors or binding partners involved in receptor trafficking , anchoring and signaling ( skeberdis et al .\nactivation of nmdars requires a simultaneous binding of two co - agonists , glutamate , and glycine with different biophysical properties of ion permeation .\nthe typical nmdars contain nr2 subunits with properties of high permeability to ca and extracellular mg block at hyperpolarized membrane potentials ( wrighton et al .\ndifferent from conventional nr1/nr2 heterotetramers , nr3-containing nmdars have unique properties with a five to tenfold decrease of ca permeability , insensitivity to mg block , and reduced single - channel conductance and open probability , functioning as a negative modulator for nmda receptor channel function ( das et al . , 1998 ;\n2009 ; cavara et al . , 2010 ; henson et al . , 2010 ) .\nnmda receptors are also regulated by other intracellular signals and proteins , including calcium , protein kinases , protein phosphatase calcineurin , and calcium - sensitive proteins such as calmodulin ( legendre et al . , 1993 ; vyklicky , 1993 ; lieberman and mody , 1994 ; tong et al . , 1995 ; ehlers et al . , 1996 ) .\ncalcium - dependent nmda receptor desensitization and inactivation provides a feedback mechanism capable of regulating subsequent ca entry into the postsynaptic cell through nmda channels ( figure 1 ) .\nschematic representation for inhibitory effect of dream / calsenilin / kchip3 on nmdars in a ca - sensitive manner . upon activation of nmdars by glutamate\nbinding , ca influx through nmdars increases the association between dream and nr1 subunits , resulting in reduced surface expression of nmdars , and subsequent inhibition of nmdars - mediated ca influx and excitotoxicity .\ndream functions as a ca - sensitive modulator for the negative feedback control of nmdar function .\nso far , a number of nr1 or nr2 subunit binding partners have been identified in the postsynaptic density .\nthe nr1 binding proteins include calmodulin ( cam ) ( ehlers et al . , 1996 ; akyol et al . , 2004\n) , ca / cam - dependent protein kinase ii ( camkii ) ( leonard et al . , 2002 ) , -actinin ( wyszynski et al . , 1997 ; merrill et al . , 2007 ) ,\ntubulin ( van rossum et al . , 1999 ) , spectrin ( wechsler and teichberg , 1998 ) , neurofilament ( ehlers et al . ,\ncalmodulin binding to the nr1 subunit is ca dependent and occurs with homomeric nr1 complexes , heteromeric nr1/nr2 subunit complexes from expression systems , and nmda receptors from the brain .\ncalmodulin binding to nr1 causes a fourfold reduction in nmda channel open probability , mediating the negative modulation of nmdar function ( ehlers et al . , 1998 ) .\nthe downstream regulatory element antagonist modulator ( dream ) protein , first identified in the nucleus as a ca - regulated transcriptional repressor through its binding to dna at specific regulatory elements , contains four ca - binding ef - hand domains and belongs to the ncs family ( carrion et al . , 1999 ; burgoyne , 2007 ) .\ndream was named for its ability to block gene expression in its ca - free form via direct binding with the downstream regulatory element ( dre ) sequence in target genes such as preprodynorphin ( ppd ) , c - fos , hrk , na , and ca exchanger ncx3 ( carrion et al .\n, 1999 ; sanz et al . , 2001 ; gomez - villafuertes et al . ,\ndream was also named calsenilin or kv channel interacting protein 3 ( kchip3 ) ( buxbaum et al . , 1998 ; an et al . , 2000\n) , indicating that dream / calsenilin / kchip3 has multifunctional properties . in the nucleus\nthe dream protein functions as a dimer , whereas outside the nucleus kchip3 is a monomer and regulates the surface expression and gating kinetics of kv4 channels ( an et al . , 2000 ;\nkim and sheng , 2004 ; scannevin et al . , 2004 ; pioletti et al .\ndream / calsenilin / kchip3 is preferentially expressed in the central nervous system , as well as in non - neuronal tissues ( link et al .\ndream / calsenilin / kchip3 knock - out mice display a hypoalgesic phenotype , suggesting a critical role of dream / calsenilin / kchip3 in pain modulation ( cheng et al . ,\nin addition , emerging evidence reveals the role of dream / calsenilin / kchip3 in long - term potentiation ( ltp ) ( lilliehook et al . , 2003 ) and learning and memory ( alexander et al . , 2009 ; fontan - lozano et al . , 2009 ) , suggesting a possible connection between dream and nmda function .\nkchip13 were initially identified from a rat brain library in yeast two - hybrid ( yth ) screens using the cytoplasmic n - terminal domain ( amino acids 1180 ) of rat kv4.3 as a bait ( an et al . , 2000 ) .\nsimilarly , kchip4 from mouse and human was accidentally cloned using the c - terminal 43 amino acid residues of presenilin 2 ( ps2 , amino acids 406448 ) as a bait in the yth system ( morohashi et al . , 2002 ) .\nkchip4 , also known as calsenilin - like protein ( calp ) , binds to ps2 which is known to facilitate intramembranous -cleavage of -amyloid protein precursor ( app ) ( morohashi et al . , 2002 ) .\nkchip14 ( 216  256 amino acids ) can co - immunoprecipitate and co - localize with either kv4 from co - transfected cells or kv4 -subunits from tissues , and thus constitute integral components of native kv4 channel complexes ( wang , 2008 ) . kchip14\nall share a conserved carboxy - terminal core region that contains four ef - hand - like calcium binding motifs , but have a variable amino - terminal region that causes diverse modulation of kv4 trafficking and channel function ( an et al .\n, 2000 ; holmqvist et al . , 2002 ; scannevin et al . , 2004 ;\nfindings from co - immunoprecipitation experiments show that dream antibody can immunoprecipitate endogenous nr1 subunit and dream protein from rat hippocampal tissue ( zhang et al . , 2010 ) .\nin the reciprocal co - ip studies in hek 293 cells expressing dream and nr1 - 1a ( nr1a ) proteins , nr1 antibody can also immunoprecipitate dream along with the nr1 subunit .\ngst pull - down assays reveal that the n - terminus of dream directly interacts with the nr1a c - terminus , and that the dream - nr1 interaction is sensitive to ca and depends on the ef hand domains of dream ( zhang et al . , 2010 ) .\npsd-95 is a major scaffolding protein in the postsynaptic density , tethering nmdars to signaling proteins , and is critical for nmda receptor function ( kim and sheng , 2004 ) .\nwu et al . generated a line of transgenic mice ( tgdream ) overexpressing a dominant active dream mutant , and compared nmda receptor - mediated epscs in tgdream and wild - type mice under conditions of various stimulation intensities ( wu et al .\nthey found that the amplitude of nmda receptor - mediated epscs in tgdream mice is significantly reduced compared to that in wild - type mice ( wu et al . , 2010 ) .\nin addition , ltd is significantly reduced in tgdream mice whereas ltp is not affected by dream , demonstrating that dream interacts with psd-95 , and that the interaction is negatively regulated by calcium ( wu et al . ,\n2010 ) . in xenopus oocytes expressing nr2b - containing nmdars alone or together with dream ,\ntwo - electrode voltage clamp recordings show that , in the absence of dream , the peak currents of nmda channels activated by glutamate ( plus glycine ) are suppressed by dream , and the current decrease is caused by a reduction in the density of nmdars at the cell surface ( figure 1 ; zhang et al . , 2010 ) .\nfontan - lozano et al . recently provided another piece of evidence that dream negatively regulates the function of nmda receptors ( fontan - lozano et al . , 2011 ) .\nby taking advantage of mice lacking the dream protein , they demonstrated that the facilitated learning induced by decreased expression of kv4.2 in dream mice requires the activation of nmda receptors containing the nr2b subunit ( fontan - lozano et al . , 2011 ) .\nthis study not only indicates the significance of the balance between kv4 channel function and nmdar activity , but also suggests the formation of a functional complex between dream / kv4.2/nmdars that regulates the synaptic efficacy mediating synaptic plasticity and learning .\nexcitotoxicity is caused by overactivation of nmda receptor function , and inhibition of nmdars can reverse the neuronal toxicity .\nthe data available so far support both the pro - apoptotic and anti - apoptotic roles of dream .\nin general , the pro - apoptotic role of dream closely correlates with its interaction with presenilins , the production of amyloid beta ( a ) and the modulation in ca signaling , whereas the anti - apoptotic role of dream is conferred by its transcriptional repressor activity on the apoptotic protein hrk .\njo et al . reported that hela cells transiently transfected with dream exhibit the morphological and biochemical features of apoptosis and that expression of presenilin potentiates dream - induced apoptosis ( jo et al . , 2001 ) .\njo et al . also reported that dream expression increases in either human neuroblastoma sk - n - be2(c ) cells or rat neuroblastoma b103 cells after exposure to a , but no other apoptotic inducers such as staurosporine , thapsigargin , and calcium ionophore a23187 .\nthe pro - apoptotic role of dream is selectively induced during ab toxicity . because of the involvement of presenilins/-secretase in a formation and neuronal death , dream coordinates with presenilin activity to play a crucial role in these processes through binding with the c - terminus of presenilins ( jo et al . , 2003 , 2004 ) .\nstably expressed dream in h4 neuroglioma cells which showed no initiation of apoptosis in the absence of apoptosis triggers , and the apoptosis - associated caspase and calpain activities were not affected by dream ( lilliehook et al .\non the other hand , binding of the transcriptional repressor dream to the hrk gene avoids inappropriate hrk expression and apoptosis in hematopoietic progenitor cell lines ( sanz et al . , 2001 , 2002 ) .\nnevertheless , the precise function of dream in pro - apoptosis and anti - apoptosis remains to be explored . from our previous observations\n, we noticed that cell viability is affected by the amount of exogenous dream gene and the method of transfection .\nhowever , we could not observe any obvious morphological changes associated with cell death after the transfection of dream . to prove the cytoprotective role of dream , we utilized cell lines and primary cultured hippocampal neurons with dream overexpression or sirna - mediated knockdown , and evaluated lactate dehydrogenase ( ldh ) leakage and propidium iodide ( pi ) uptake both in nmda and oxygen - glucose deprivation ( ogd ) -induced excitotoxic injury models ( zhang et al . , 2010 ) .\nadministration of nmda markedly increases the number of pi - positive cells ( dead cells ) in nmdar - transfected cho cells , whereas co - expression of dream greatly reduces pi - positive cells ( zhang et al . , 2010 ) .\nogd is commonly used in vitro to mimic ischemia - reperfusion insult to the brain , and ogd treatment induces a significant increase of ldh release ( dawson et al . , 1994 ) .\nwith over - expression of dream , however , ogd treatment induces a smaller increase in ldh release .\nthese results indicate that the over - expression of dream attenuates nmdar - mediated excitotoxicity ( zhang et al . , 2010 ) . we have previously tested the effect of dream sirna on nmda - induced current and excitotoxic injury in hippocampal neurons ( zhang et al . , 2010 ) .\nknockdown of endogenous dream with sirna results in an increased amplitude of nmda current recorded by whole - cell patch - clamp assays .\nafter nmda exposure , pi - positive cells in the dream sirna group increase compared with control sirna , indicating the inhibitory effect of dream on nmdar - mediated current and excitotoxic injury ( zhang et al . , 2010 ) .\nthe ncs protein dream / calsenilin / kchip3 acts as an auxiliary subunit and suppresses nmda receptor channel function .\nthis negative modulation of nmda receptor function by dream likely provides a feedback mechanism by which overactive nmda receptors are inhibited .\ntherefore , targeting regulatory proteins of nmdars may represent an alternative approach to treating nmdar - mediated excitotoxic damage and providing neuroprotection .\nthe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .\nthe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest .", "human": " n - methyl - d - aspartate receptors ( nmdars ) are glutamate - gated ion channels highly permeable to calcium and essential to excitatory neurotransmission . \n the nmdars have attracted much attention because of their role in synaptic plasticity and excitotoxicity . \n evidence has recently accumulated that nmdars are negatively regulated by intracellular calcium binding proteins . \n the calcium - dependent suppression of nmdar function serves as a feedback mechanism capable of regulating subsequent ca2 + entry into the postsynaptic cell , and may offer an alternative approach to treating nmdar - mediated excitotoxic injury . \n this short review summarizes the recent progress made in understanding the negative modulation of nmdar function by dream / calsenilin / kchip3 , a neuronal calcium sensor ( ncs ) protein . ", "section_names": "Introduction\nStructural and functional features of NMDA receptor channels\nModulation of NMDAR function by intracellular binding partners\nDREAM/calsenilin/KChIP3, a neuronal calcium sensor and calcium binding EF-hand protein\nFunctional interactions between DREAM and NMDA receptors\nNeuroprotective effect of DREAM/calsenilin/KChIP3 over-expression on neuronal excitotoxic injury\nConclusions\nConflict of interest statement", "bigbird_pegasus": "<s> excessive activation of n - methyl - d - aspartate receptors ( nmdars ) by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases.<n> the nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury, and a variety of antagonists or blockers of nmdars have been developed. unfortunately, the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars.<n> therefore, a better understanding of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function, and may represent an alternative to treating nmdar - mediated excitotoxic injury.<n> this short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor ( ncs ) protein, calsenilin / kchip3.</s>", "longt5": "<pad> the n - methyl - d - aspartate receptors ( nmdars ) are a major class of ionotropic glutamate receptors and play an essential role in synaptic transmission, plasticity, and memory. excessive activation of nmdars by glutamate mediates neuronal damage in many neurological disorders including ischemia and neurodegenerative diseases. the nmdars have long been considered the main target for the treatment of excitotoxicity - related neuronal injury, and a variety of antagonists or blockers of nmdars have been developed. unfortunately, the results of clinical trials have been disappointing because of the obvious side effects associated with blocking the physiological roles of nmdars. therefore, a better understanding of the mechanism of how nmdars can be modulated by regulatory proteins should help in the development of new therapeutic agents to counteract overactive nmda receptor function, and may represent an alternative to treating nmdar - mediated excitotoxic injury. this short review focuses on the specific negative modulation of nmdars by a neuronal calcium sensor protein, dream / calsenilin / kchip3.</s>"}
{"article": "we report a case of a patient visiting africa for the first time presenting with malaria and arf .\nmalaria is an italian word composed of  mala  and  aria  , derived from malus ( bad ) and aeris ( air ) .\nit is a disease caused by a protozoan parasite of the genus plasmodium , namely , p. falciparum , p. vivax , p. malariae , and p. ovale , while p. knowles commonly affects nonhuman primates .\nthe disease remains to be the major cause of morbidity and mortality in many tropical developing countries where it is mostly caused by plasmodium falciparum .\nit is estimated that the latter causes around 600,000 deaths annually and the vast majority of such deaths occur in sub - saharan african countries .\nthe high mortality rates caused by p. falciparum are to a great extent attributed to the parasite 's ability to induce severe malaria associated with life - threatening complications such as cerebral malaria ( cm ) , acute renal failure ( arf ) , severe anemia , acidosis , respiratory distress , jaundice , and acute respiratory distress syndrome ( ards ) .\nplasmodium falciparum malaria presenting symptoms and mortality pattern vary considerably according to geographical distribution , parasite 's transmission intensity , and host 's immunity to the parasite . in areas with high and stable malaria transmission , for instance ,\nsevere malaria is common in children under 5 years of age and commonly presents as severe anemia , while adults with acquired immunity to the parasite do not usually suffer severe malaria . in areas with moderate malaria transmission intensity\nlikewise , in low unstable malaria transmission intensity , severe malaria occurs in all age groups and can manifest as , cm , renal failure , severe jaundice , and/or pulmonary edema .\nhowever , arf has been reported to be one of the most common complications of falciparum malaria in nonimmune adults .\nmalarial acute renal failure ( marf ) can occur as an isolated complication or as a component of multiorgan involvement . indeed , an association of arf and cm has been reported and found to cause relatively higher mortality rates than cm alone .\nmarf should be suspected when urine output falls to less than 400 ml/24 h or 20 ml / h despite adequate rehydration and the diagnosis is confirmed when serum creatinine exceeds 3 mg / dl ( 260 mol / l ) . the availability and provision of renal replacement therapy ( rrt ) as well as appropriate antimalarial chemotherapy has been shown to reduce marf associated mortalities and enhance the restoration of renal function .\nwe are reporting a case of a 55-year - old male caucasian referred from morogoro regional referral hospital to the university of dodoma haemodialysis unit , with a 3-days history of acute onset of high - grade fever associated with episodes of nonprojectile vomiting with the vomitus being mostly comprised of recently eaten food .\nthe fever was also associated with chills , myalgia , and loss of consciousness , with episodes of generalized tonic \nfew hours following the fever onset , the patient developed shortness of breath with no cough . on the second day , while in the ward , he developed anuria ( decrease in urine output ) , with 50 ml collected over 24 h that was soon followed by hiccups .\nthe patient was visiting morogoro , tanzania for the first time and he had never been to any malaria endemic area before .\nhe denied having chest pain , palpitations , diarrhea , bleeding from any site , and declared that he had not been exposed to sick contacts . at the morogoro regional referral hospital ,\nhe was given two doses of 600 mg quinine in 600 ml of 5% dextrose infusion .\nhe was referred to the university of dodoma haemodialysis unit due to his nonimproving renal functioning ( anuria ) .\nhe had smoked one pack of cigarette per day for 30 years and he drank alcohol occasionally .\nhowever , he denied illicit or any kind of drug use , and he had no known allergies .\nphysical examination revealed that he was obtunded ( gcs = 9/15 ) , jaundiced , dyspneic , pale .\nvitals : his blood pressure was 90/60 mm hg with no postural hypotension , his heart rate was 102 beats per minute .\npertinent findings on chest examination included fine crackles at the lung bases , with decreased vocal fremitus .\nhis cardiovascular examination showed normal first and second heart sounds , with no jugular venous distention , murmurs , rubs , or gallops .\nabdominal examination revealed normal bowel sounds without distension , tenderness to palpation , or organomegaly .\nrectal examination showed normal rectal tone , heme - negative stool , and no masses .\nadditionally , an electrocardiogram was performed and results were remarkable for sinus tachycardia . furthermore , laboratory analyses including complete blood cell count ( cbc ) with differential , complete metabolic panel , finger - stick blood glucose , blood slide ( bs ) for malaria parasites ( mps ) , malaria rapid diagnostic test ( mrdt ) , bilirubin levels , urine analysis , and lumbar puncture for cerebral spinal fluid ( csf ) were carried out .\nthe cbc revealed a normal white blood cell ( wbc ) count without a left shift .\nhe was found to be anemic , with a hemoglobin level of 11.9 g / dl , mean corpuscular volume of 87 fl , and an elevated erythrocyte sedimentation rate ( esr ) of 35 mm / h .\nthe initial renal workup revealed serum creatinine of 1.33 mg / dl ( 117.24 mol / l ) , high serum urea of 30.66 mmol / l , serum potassium of 5.1 meq / l , and serum sodium of 140 meq / l .\nmol / l , while direct bilirubin was 30 mol / l and random blood glucose was 8.8\n. microscopic examination of bs for mps showed 1200 trophozoites/200 wbc ( 4800 mps per l ) and mrdt was positive for p.falciparum . regarding urine analysis , sedimentation revealed muddy brown granular casts , specific gravity of 1.010 , and sodium content of 42 ( mmol / d ) .\ncsf analysis revealed normal findings and abdominal ultrasound showed normal - sized kidneys with no features of chronic kidney disease .\non the basis of the foregoing findings , the case was diagnosed as complicated malaria with arf , pulmonary edema , cm and anemia , and the patient was scheduled for emergency dialysis .\ndouble lumen catheter was inserted on the right femoral vein of the patient and hemodialysis was started and ran for 4 h on day one .\nthe process was facilitated by pump pressure of 100 and no fluid removal from the body was allowed .\nthe patient was also subjected to intramuscular ( i / m ) injection of artemether 160 mg bolus then 80 mg od  4/7 , i / v frusemide 80 mg bid  3/7 , i / v normal saline alternating with ringers lactate 6 l/12 h , and po paracetamol 1 g tid  5/7 .\nafter three sessions of consecutive hemodialysis of 4 h per day , the patient was conscious , able to sit upright without support , and had urine output of 2400 ml/24 h. his serum creatinine , urea , and potassium were 0.43 mg / dl ( 37.8 mol / l ) , 4.72 mmol / l , and 3.5 meq / l , respectively .\nhe was closely followed up after 2 weeks and 1 month and found to have normal and stable renal function .\nmarf is almost always caused by p.falciparum infection although renal involvement has also been reported in p. malariae , and recently in p. vivax infections .\np. malariae has been associated with chronic progressive renal failure , while p. falciparum is usually associated with arf as in our patient .\nthe incidence of marf worldwide is 14% and may be as high as 60% among nonimmune adults from nonendemic regions visiting endemic regions of the world   as it is the case in our patient . in severe malaria , arf has been shown to be an important cause of mortality . in most cases\n, marf manifests clinically and pathologically as acute tubular necrosis as is reported in this case .\nthe jaundice is usually  biphasic  with both conjugated and nonconjugated bilirubin elevated due to cholestasis and hemolysis , respectively .\nit has been shown elsewhere that early initiation of hemodialysis speeds recovery of renal function in the management of a patient with marf , .\nhemodialysis has been shown to be more effective than peritoneal dialysis which is often readily available in sub - saharan africa .\nhemodialysis is considered adequate when there is postdialysis decrease of blood urea nitrogen ( bun ) and serum creatinine by 50% from baseline .\nour patient underwent three consecutive cycles and demonstrated complete recovery of renal function and postdialysis bun and serum creatinine more than 50% less than baseline values .\nthe foregoing report conclusively outlines the importance of rapid recognition , proper case assessment , and early initiation of repeated sessions of hemodialysis in addition to fluid replacement and appropriate antimalarial therapy for early recovery of renal function in marf .\na copy of the written consent is available for review by the editor - in - chief of this journal .", "human": " key clinical messageacute renal failure ( arf ) secondary to severe malaria is uncommon . \n we report a case of a patient visiting africa for the first time presenting with malaria and arf . \n there was complete recovery after hemodialysis . \n early initiation of hemodialysis proves to be useful in restoration of renal function . ", "section_names": "Key Clinical Message\nIntroduction\nCase Report\nDiscussion\nConclusion\nConsent\nConflict of Interest", "bigbird_pegasus": "<s> acute renal failure ( arf ) is one of the most common complications of malaria in nonimmune adults.<n> plasmodium falciparum malaria presenting symptoms and mortality pattern vary considerably according to geographical distribution, parasite's transmission intensity, and host's immunity to the parasite. in areas with high and stable malaria transmission, severe malaria is common in children under 5 years of age and commonly presents as severe anemia, while adults with acquired immunity to the parasite do not usually suffer severe malaria.<n> it is estimated that the latter causes around 600,000 deaths annually and the vast majority of such deaths occur in sub - saharan african countries.<n> the high mortality rates caused by p. falciparum are to a great extent attributed to the parasite's ability to induce severe malaria associated with life - threatening complications such as arf, severe anemia, acidosis, respiratory distress, jaundice, and acute respiratory distress syndrome.</s>", "longt5": "<pad> malaria is an italian word composed of mala and aria, derived from malus ( bad ) and aeris ( air ). it is a disease caused by a protozoan parasite of the genus plasmodium, namely, p. falciparum, p. vivax, p. malariae, and p. ovale, while p. knowles commonly affects nonhuman primates. we report a case of a patient visiting africa for the first time presenting with malaria and acute renal failure ( marf ).</s>"}
{"article": "chronic suppurative otitis media ( csom ) is defined as long - standing chronic suppuration of the middle ear cleft and its mucoperiosteal lining resulting in discharging ear and deafness .\nchronic suppuration can occur with ( tympano - mastoid type ) or without ( tubo - tympanic type ) cholesteatoma .\nthe tubo - tympanic type is the usually safe variety and follows a benign course .\nit usually occurs as a complication of acute otitis media , where there is perforation of the tympanic membrane .\nbacterial pathogens in the tubo - tympanic type csom vary considerably , and can be a combination of both aerobic and anaerobic bacteria . in csom , the bacteria may be aerobic ( e.g. , escherichia coli , staphylococcus aureus , streptococcus pyogenes , proteus mirabilis , klebsiella species , escherichia species , haemophilus influenzae , etc . ) or anaerobic ( e.g. , bacteroides , peptostreptococcus , proprionibacterium , etc.).[24 ] bacteriological cultures may not be needed to establish the diagnosis of csom as exhaustive studies have established that 90100% of chronic draining ears yield two or more isolates consisting of both aerobic and anaerobic bacteria .\nthe choice of the antibiotic agent depends greatly on the knowledge of the type of bacteria most frequently implicated in csom and their sensitivity to antibiotics . since their introduction , systemically\nacting fluoroquinolones have opened up new therapeutic possibilities for using an orally administered antibiotic in the treatment of csom .\nciprofloxacin , in particular , has proven to be very active in vitro against a large number of gram - negative and gram - positive organisms .\nmoreover , ciprofloxacin concentrations within the structures of the middle ear have been shown to exceed the minimum inhibitory concentration ( mic ) for the microorganisms responsible for csom .\ncefpodoxime , an oral third - generation cephalosporin , has good antimicrobial activity against aerobic gram - positive and gram - negative bacteria .\nthere are few studies that have evaluated the effectiveness of cephalosporins like cephalexin and ceftriaxone in acute exacerbation of chronic suppurative otitis media ( aecsom ) , and results have shown that they can be considered as an effective agent for the treatment of aecsom . against this backdrop ,\nthe present study was planned to compare the effectiveness and safety of cefpodoxime with ciprofloxacin in aecsom .\nthe objective of this study was to demonstrate equivalence between cefpodoxime ( test drug ) and ciprofloxacin ( comparator ) with respect to their effectiveness in aecsom .\nthe study was approved by the institutional ethics committee and conducted according to the icmr guidelines for biomedical research on human subjects , 2006 , and the declaration of helsinki .\nsubjects were recruited in the ent outpatient department of a tertiary care teaching hospital and the study was conducted between june 2011 and october 2011 .\nthe study was registered under clinical trials registry - india ( registration number - ctri/2011/10/002079 ) .\nthe objective of the study was to demonstrate equivalence in the effectiveness between the two treatment groups .\na difference of 10% in clinical cure rates was assumed to be the largest clinically acceptable effect for which equivalence could be accepted ( equivalence limit ) .\nconsidering the true mean difference between the two treatment groups as zero and the expected standard deviation of 10% in the study population , 90% power and  = 0.05 , the number of subjects required in each treatment group was 21 .\nthe sample size was calculated by using primer of biostatistics software ( version 5.0 ) .\nclinically documented cases of tubo - tympanic - type csom , defined as long - standing chronic suppuration of middle ear cleft and its muco - periosteal lining resulting in discharging ear and deafness presenting with clinical symptoms and signs of acute exacerbation of the disease and baseline otological symptom score [ table 1 ] of > 4 but 8 were included in the study .\nsevere cases of aecsom for which hospitalization or parenteral antibiotic treatment is required and patients with otological symptom score of 4 and > 8 were also excluded from the study .\npatients with foul - smelling discharge and those who received antibiotic in the preceding 4 weeks of screening were left out .\nnumber of subjects achieving  treatment success  in each treatment group was considered to be the effectiveness parameter .\ntreatment success was based on changes in the otological symptoms scores at day 14 visit .\nit was subdivided into two categories : ( a )  clinical cure  if the otological symptom score was <3 at day 14 visit or ( b )  clinical improvement  if the otological symptom score was between 3 and 5 on day 14 .\n treatment failure  was declared if there was no change or increase in the baseline otological symptom score on day 14 .\npatients were evaluated clinically at baseline ( day 0 ) and at subsequent follow - up visits on days 3 , 7 and 14 .\nmumbai , india ) tablet ( 200 mg ) and group b received ciprofloxacin ( ranbaxy laboratories ltd .\nstudy medications were dispensed twice during the study period : first during baseline visit for 3 days and next during day 3 visit for the next 4 days .\npatients were advised to take each of their respective study medications orally twice daily after food for the first 7 days .\ncompliance was assessed by the traditional pill count method at each follow - up visit and at the end of the study .\nall patients were advised to stop smoking and consumption of alcohol during the study period .\nall aes spontaneously reported by the subjects or elicited by the investigators were recorded and causality analysis was done as per the world health organization - uppasala monitoring centre ( who - umc ) criteria .\ndata in ordinal scale were analyzed by friedman 's test for intragroup comparison and by mann \nadults of either sex , aged between 18 and 60 , were considered . clinically documented cases of tubo - tympanic - type csom , defined as long - standing chronic suppuration of middle ear cleft and its muco - periosteal lining resulting in discharging ear and deafness presenting with clinical symptoms and signs of acute exacerbation of the disease and baseline otological symptom score [ table 1 ] of > 4 but\nsevere cases of aecsom for which hospitalization or parenteral antibiotic treatment is required and patients with otological symptom score of 4 and > 8 were also excluded from the study .\npatients with foul - smelling discharge and those who received antibiotic in the preceding 4 weeks of screening were left out .\nnumber of subjects achieving  treatment success  in each treatment group was considered to be the effectiveness parameter .\ntreatment success was based on changes in the otological symptoms scores at day 14 visit .\nit was subdivided into two categories : ( a )  clinical cure  if the otological symptom score was <3 at day 14 visit or ( b )  clinical improvement  if the otological symptom score was between 3 and 5 on day 14 .\n treatment failure  was declared if there was no change or increase in the baseline otological symptom score on day 14 .\npatients were evaluated clinically at baseline ( day 0 ) and at subsequent follow - up visits on days 3 , 7 and 14 .\nmumbai , india ) tablet ( 200 mg ) and group b received ciprofloxacin ( ranbaxy laboratories ltd .\nstudy medications were dispensed twice during the study period : first during baseline visit for 3 days and next during day 3 visit for the next 4 days .\npatients were advised to take each of their respective study medications orally twice daily after food for the first 7 days .\ncompliance was assessed by the traditional pill count method at each follow - up visit and at the end of the study .\nall patients were advised to stop smoking and consumption of alcohol during the study period .\nall aes spontaneously reported by the subjects or elicited by the investigators were recorded and causality analysis was done as per the world health organization - uppasala monitoring centre ( who - umc ) criteria .\ndata in ordinal scale were analyzed by friedman 's test for intragroup comparison and by mann \nof the 55 subjects screened , 46 fulfilled the selection criteria and were randomized - 23 to group a ( cefpodoxime ) arm and 23 to group b ( ciprofloxacin ) .\none subject was lost during follow - up in group b and did not attend the hospital after the first visit .\nthe mean age of patients was 35.8 years and 28.1 years in the cefpodoxime and ciprofloxacin groups , respectively .\n69.5% were male in the cefpodoxime group and 56.5% were male in the ciprofloxacin group .\nthe consort flowchart there was no statistically significant difference in the baseline demographic profile and baseline otological symptom score .\nchanges in otological symptom score from baseline have been shown in figures 2 and 3 and table 2 .\nchanges in otological symptom score in the cefpodoxime group ( group a).p < 0.05- days 3 , 7 , 14 vs day 0 changes in otological symptom score in the ciprofloxacin group ( group b ) .\np < 0.05- days 3 , 7 , 14 vs day 0 intergroup comparison of otological symptom score intragroup analysis of otological symptom score at baseline ( day 0 ) against day 3 , day 7 and day 14 scores showed a highly significant decrease in both groups [ figures 2 and 3 ] , and there was a clinically significant improvement in the signs and symptoms of the aecsom .\nthus , it can be suggested that both cefpodoxime and ciprofloxacin are effective in the treatment of aecsom .\nan intergroup analysis of the otological symptom scores showed that there was no statistically significant difference in the baseline , day 3 and day 7 and day 14 otological symptom score [ table 2 ] .\ntherefore , it can be suggested that both cefpodoxime and ciprofloxacin are equally effective in the treatment of aecsom .\ntable 3 shows the number and the percentage of patients categorized as  treatment success  or  treatment failure\ntwenty - two subjects of the 23 enrolled in the cefpodoxime group achieved  treatment success ,  i.e. either clinical improvement or clinical cure , and the remaining one subject was categorized as treatment failure .\nsimilarly , in the ciprofloxacin group , 20 subjects of the 22 evaluated showed  treatment success , \ni.e. either clinical improvement or clinical cure , and the remaining two were categorized as treatment failure .\nintergroup comparison of the percentage of subjects who were categorized as treatment success showed no statistically significant difference ( p = 0.25 ) .\ncomparison of treatment success rates there were one patient in the cefpodoxime group and two patients in the ciprofloxacin group who were categorized as treatment failure and had to be put on other antibiotics after the day 7 evaluation .\nsafety analysis was carried out as per the intention to treat ( itt ) analysis .\nthese aes were mild in nature and did not require any dose reduction or withdrawal of the study medications .\ntherefore , the safety and tolerability profile of both the study drugs were good without any reported cases of serious ae .\nseveral published studies have shown the effectiveness of ciprofloxacin for the treatment of aecsom in adult patients .\nfew studies have also proved the effectiveness of cephalexin and ceftriaxone in adult patients with aecsom .\nbut , there is no published comparative controlled trial that evaluated ciprofloxacin with an oral third - generation cephalosporin in adult patients with aecsom .\nthe results of our study showed that cefpodoxime and ciprofloxacin are equally effective in clinically diagnosed cases of aecsom , both in terms of effectiveness and in terms of safety .\nafter treatment with a 7-day course , the clinical success rates were comparable , i.e. 95.6% in the cefpodoxime group and 90.9% in the ciprofloxacin group .\nthese aes were nonserious in nature and did not require dose modification or withdrawal of drug therapy .\nbaba et al . conducted a clinical trial that showed that ceftriaxone was effective in 65% patients with acute otitis media and 72% patients with aecsom .\nanother trial by baba et al . reported that cephalexin has a 35.5% failure rate in patients with aecsom .\nclinical cure rate with cefpodoxime in our study is significantly higher compared with those two trials with other cephalosporins .\nvery few studies have evaluated the effectiveness of oral third - generation cephalosporins in patients with otitis media . a study reported by block et al .\ncompared the effectiveness of cefdinir with cefprozil , and the results showed that the overall clinical cure rate with cefdinir was 80% versus 82.5% with cefprozil in the treatment of pediatric acute otitis media .\nanother study by kafetzis showed that the overall clinical cure rate with cefixime was 85% in patients with acute otitis media .\nour study suggests that cefpodoxime has higher cure rates ( 95.6% ) compared with other oral third - generation cephalosporins\na double - blind study could not be conducted due to financial constraints and logistic problems .\nsecondly , we did not perform bacteriological culture of the cases as exhaustive studies have established that 90100% of chronic draining ears yield two or more isolates consisting of both aerobic and anaerobic bacteria .\nanother reason is that , very often , clinicians start antimicrobial therapy at outpatient setting before the bacteriological culture report arrives , which takes about 72 h. therefore , we conducted this study mainly to provide information to clinicians on the comparative effectiveness of these two antibiotics as initial antibiotics for aecsom patients based on clinical assessment scores .\nthe results of this study demonstrated that a 7-day course of cefpodoxime is comparable to ciprofloxacin in terms of both clinical effectiveness and safety for the treatment of aecsom in an outpatient setting .\nalthough cost of drug therapy was higher with cefpodoxime compared with ciprofloxacin , it should not be considered as a drawback .\nfuture trials are warranted to evaluate the bacteriological cure and relapse rates of these two drugs to provide additional supportive scientific evidence .", "human": " objective : to compare the effectiveness and safety of cefpodoxime and ciprofloxacin for the treatment of mild to moderate cases of acute exacerbation of chronic suppurative otitis media ( aecsom).materials and methods : adult patients diagnosed with aecsom were screened and patients fulfilling the inclusion criteria were randomized to receive either cefpodoxime 200 mg twice daily or ciprofloxacin 500 mg twice daily orally for 7 days . \n the primary outcome of this randomized , open - labeled , phase iv clinical trial ( registration number - ctri/2011/10/002079 ) was clinical success rate at day 14 visit and the secondary outcome was incidence of adverse events ( aes ) . \n forty - six patients were enrolled : 23 in the cefpodoxime group and 23 in the ciprofloxacin group.results:the clinical success rates were 95.6% in the cefpodoxime group versus 90.9% in the ciprofloxacin group . \n these rates are comparable , but no statistically significant difference was observed between the groups . \n few mild and self - limiting aes were observed and the tolerability of both the drugs was also good.conclusion:the results of this randomized , open - labeled phase iv clinical trial showed that a 7-day course of cefpodoxime is therapeutically comparable to ciprofloxacin in terms of both clinical effectiveness and safety for the treatment of patients with aecsom . ", "section_names": "INTRODUCTION\nMATERIALS AND METHODS\nInclusion criteria\nExclusion criteria\nEffectiveness parameters\nStudy visits\nGrouping\nStatistical analysis\nRESULTS\nDISCUSSION\nCONCLUSION", "bigbird_pegasus": "<s> background : cefpodoxime, an oral third - generation cephalosporin, has good antimicrobial activity against aerobic gram - positive and gram - negative bacteria. there are few studies that have evaluated the effectiveness of cephalosporins like cephalexin and ceftriaxone in acute exacerbation of chronic suppurative otitis media ( aecsom ), and results have shown that they can be considered as an effective agent for the treatment of aecsom.aim:the objective of this study was to demonstrate equivalence between cefpodoxime and ciprofloxacin with respect to their effectiveness in aecsom.materials and methods : a total of 55 patients with aecsom were treated with cefpodoxime ( test drug ) and ciprofloxacin ( comparator ) for 7 days.<n> patients were evaluated clinically at baseline ( day 0 ) and at subsequent follow - up visits on days 3, 7 and 14.<n> change in otological symptom score from baseline ( day 0 ) and at subsequent follow - up visits on days 3, 7 and 14 were analyzed by friedman's test for intragroup comparison and by mann whitney test for intergroup comparison.<n> safety analysis was carried out by friedman's test for intragroup comparison and by mann whitney test for intergroup comparison.results : clinical cure rate in the cefpodoxime group and the otological symptom score was similar. clinical cure rate of clinical cure rate of the otological symptom score and clinical cure rate of the otological symptom score was.<n> clinical cure rate of the clinical cure rate of the otological symptom score of the otological symptom score.<n> clinical cure rate.<n> clinical cure rate of the clinical cure rate..<n> clinical cure rate.<n> clinical cure rate..<n><n> clinical and clinical and clinical and clinical and clinical and clinical and clinical and clinical and clinical and<n><n><n><n><n><n><n><n><n><n><n><n><n><n> clinical and clinical and clinical and clinical and clinical and the clinical..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> was clinical and the clinical and the clinical and the clinical and the clinical and was clinical and clinical and clinical and clinical and clinical and clinical and clinical and clinical and<n><n><n><n><n><n><n><n><n> clinical and<n><n><n>", "longt5": "<pad> background : acute exacerbation of chronic suppurative otitis media ( aecsom ) is defined as long - standing chronic suppuration of middle ear cleft and its muco - periosteal lining resulting in discharging ear and deafness. ciprofloxacin has proven to be very active in vitro against a large number of gram - negative and gram - positive bacteria. cefpodoxime, an oral - generation cephalosporin, has good antimicrobial activity against aerobic gram - positive and gram - negative bacteria. there are few studies that have evaluated the effectiveness of cephalosporins like cephalexin and ceftriaxone in acute exacerbation of chronic suppurative otitis media ( aecsom ), and results have shown that they can be considered as an effective agent for the treatment of aecsom.objectives:the objective of this study was to demonstrate equivalence between cefpodoxime ( test drug ) and ciprofloxacin ( comparator ) with respect to their effectiveness in aecsom.materials and methods : the study was conducted between june 2011 and october 2011. the study was registered under clinical trials registry - india ( registration number - ctri/2011/10/002079).results : the mean age of patients was 35.8 years and 28.1 years in the cefpodoxime and ciprofloxacin groups, respectively. there was no statistically significant difference in the baseline demographic profile and baseline otological symptom score. there was a highly significant decrease in both groups, and there was a clinically significant improvement in the signs and symptoms of the aecsom. an intergroup analysis of the otological symptom scores showed no statistically significant difference in the baseline, day 3 and day 7 and day 14 otological symptom scores.conclusion:the results of this study demonstrated that a 7-day course of cefpodoxime is comparable to ciprofloxacin in terms"}
{"article": "flurodeoxyglucose ( f - fdg ) positron emission tomography / computed tomography ( pet / ct ) has become the imaging modality of choice for initial staging , follow - up and treatment response assessment in patients with hodgkin 's lymphoma and has proved superior to contrast enhanced ct ( cect ) in these settings .\nf - fdg pet / ct has accuracy of almost 100% in diagnosing primary splenic involvement during initial staging of lymphoma . however , in the post - therapy setting its role for evaluation of secondary splenic involvement is limited .\none of the pattern of splenic activity that help to detect splenic involvement on pet / ct is diffusely increased f - fdg uptake greater than that in the liver and bone marrow with or without corresponding ct lesions . in this context , we report a case of a patient with hodgkin 's lymphoma in remission presenting with f - fdg avid splenomegaly .\nthe present case report is about a 22-year - old male patient who presented with enlarged right cervical lymph node .\nf - fdg pet / cect performed for staging revealed metabolically active lymph nodes on either side of the diaphragm [ figure 1a , broken arrows ] , enlarged spleen with multiple hypodense hypermetabolic , lesions [ figure 1a , arrow ] ( suvmax= 9.4 ; spleen suvmax / liver suvmax ratio = 3.76 ) and bone lesion .\nhe was then given 6 cycles of chemotherapy and f - fdg pet / cect was done for response evaluation .\npet / ct showed complete metabolic response , with normal spleen uptake [ figure 1b , arrow ] ( spleen suvmax= 2.5 , liver suvmax= 2.6 s / l ratio = 0.96 ) . at 1-year\nlater routine follow - up the patient complained of mild fever , lethargy and listlessness . in view of previous history of hodgkin 's lymphoma ,\npet / ct revealed enlarged spleen with diffusely increased fdg uptake [ figure 2a  c , arrow ] ( suvmax= 5.3 ; liver suvmax= 2.3 s / l ratio = 2.30 ) .\nthe first differential in the given clinical scenario was splenic relapse of lymphoma , however , a second differential diagnosis of some infective / inflammatory process was considered .\non further evaluation , peripheral smear showed evidence of malaria parasite infection ( plasmodium vivax ) .\nfollow - up pet / ct after 7 months revealed normalization of size and f - fdg uptake of spleen [ figure 2d , arrow ] ( suvmax= 3.0 ; liver suvmax= 2.7 s / l ratio = 1.1 ) .\nhence , malaria and other relevant ( endemic ) infective possibilities ( kala - azar etc . ) should be considered and further investigation , if warranted , should be advised .\nf - flurodeoxyglucose ( f - fdg ) positron emission tomography/ computed tomography ( pet / ct ) done for staging and response evaluation .\n( a ) staging maximum intensity projection ( mip ) pet image showing multiple metabolically active lymph nodes in thorax , abdomen and pelvis ( broken arrows ) with splenic ( arrow ) and bone lesion ( left femur ) .\n( b ) mip pet image done for response evaluation demonstrates complete metabolic response with normal splenic fdg uptake ( arrow ) .\nphysiological gastric fdg uptake noted ( bent arrow ) f - flurodeoxyglucose ( f - fdg ) positron emission tomography / computed tomography ( pet / ct ) done for recurrence detection and follow - up .\n( a - c ) follow - up pet / ct performed 1 year after chemotherapy showing enlarged spleen with diffusely increased fdg uptake ( arrow ) .\n( d ) maximum intensity projection pet image performed after anti - malarial therapy , showing normalization of size and fdg uptake of spleen ( arrow ) . ( a and d )\nfocal fdg uptake noted in the pelvis is due to urinary fdg activity in the left ureter ( curved arrows )\npet / ct is a useful modality for staging and restaging of hodgkin 's lymphoma with high sensitivity and specificity .\nfurthermore , it is a sensitive modality for early detection of relapse in asymptomatic patients making surveillance f - fdg pet / ct clinically important .\nsplenic uptake on f - fdg pet can be due to a wide variety of causes such as lymphoma , anemia , granulocyte colony stimulating factor treatment , beta - thalassemia , inflammation and infections .\nsplenic uptake , greater than hepatic uptake , is a relatively reliable indicator of lymphomatous involvement of the spleen , in the absence of recent cytokine administration . in early stage hiv infection , diffusely increased splenic uptake is noted due to reactive stimulation of b - cells in the spleen .\npost - therapeutic reactive splenic uptake is also noted after administration of granulocyte colony - stimulating factor for myelosuppression or high - dose interferon - alpha-2b adjuvant therapy for melanoma . until date , only a single report by liu et al . have demonstrated f - fdg uptake in spleen in case of malaria .", "human": " 18flurodeoxyglucose ( 18f - fdg ) positron emission tomography / computed tomography ( pet / ct ) is nowadays routinely used in management of lymphoma patients . \n we here present a case of hodgkin 's lymphoma which showed 18f - fdg avid splenomegaly on pet / ct done for clinically suspected relapse . \n further evaluation by peripheral smear examination revealed malaria . \n the patient was then started on anti - malarial medications and follow - up pet / ct revealed resolution of hypermetabolic splenomegaly . \n this report highlights that in endemic regions malaria can cause 18f - fdg avid splenomegaly and might mimic relapse of lymphoma . ", "section_names": "INTRODUCTION\nCASE REPORT\nDISCUSSION", "bigbird_pegasus": "<s> flurodeoxyglucose ( 18f - fdg ) positron emission tomography / computed tomography ( pet / ct ) has become the imaging modality of choice for initial staging, follow - up and treatment response assessment in patients with hodgkin's lymphoma.<n> 18f - fdg pet / ct has accuracy of almost 100% in diagnosing primary splenic involvement during initial staging of lymphoma. however, in the post - therapy setting its role for evaluation of secondary splenic involvement is limited. in this context, we report a case of a patient with hodgkin's lymphoma in remission presenting with 18f - fdg avid splenomegaly.</s>", "longt5": "<pad> flurodeoxyglucose ( f - fdg ) positron emission tomography / computed tomography ( pet / ct ) has become the imaging modality of choice for initial staging, follow - up and treatment response assessment in patients with hodgkin's lymphoma. however, in the post - therapy setting its role for evaluation of secondary splenic involvement is limited. one of the pattern of splenic activity that help to detect splenic involvement on pet / ct is diffusely increased f - fdg uptake greater than that in the liver and bone marrow with or without corresponding ct lesions. in this context, we report a case of a patient with hodgkin's lymphoma in remission presenting with f - fdg avid splenomegaly.</s>"}
{"article": "rapid advances in the crystallographic \n determination of transmembrane \n ( tm ) protein structures , and especially of g - protein coupled receptors \n ( gpcrs ) , have established the lipidic cubic phase ( lcp ) as a suitable \n medium for growing high quality crystals of these proteins ( see ref ( 1,2 ) and citations therein ) .\nthe lcp consists \n of a highly curved lipid bilayer structure ( see figure 1b  c ) that is continuous in three dimensions ( 3d ) and \n separates in space two nonintersecting intertwined aqueous channels .\nbecause of the continuous nature of both the lipid and the water \n compartments , lcp has been described as a bicontinuous mesophase with \n its bilayer midplane tracing a triply periodic minimal surface ( tpms , \n characterized by zero mean curvature ) ( see refs ( 68 ) and citations therein ) .\nthe particular kind of lcp \n utilized during in meso crystallization trials is \n of pn3 m symmetry type , where each aqueous network \n of the lcp assumes a tetrahedral geometry ( see figure 2d  e ) .\n( a ) ball - and - stick representation \n of the monoolein ( 9.9 mag ) lipid . \n\ndouble bonded \n carbon atoms ( c9 and c10 ) in the hydrocarbon chain of 9.9 mag are \n highlighted .\nthe grouping of atoms in martini \n coarse - grained beads ( eth , gl1 , c1a , c2a , d3a , c4a , and c5a ) is highlighted \n by ellipsoids .\n( b , c ) comparison of the triply periodic minimal surface \n ( tpms ) of pn3 m symmetry calculated from the improved \n nodal approximation given in eqs 13 ( b ) , to a snapshot after 6 s - long coarse - grained \n md simulations of spontaneous self - assembly of 9.9 mag / water complex \n at 40% ( w / w ) water concentration and at 20 c temperature ( c ) . \n\nthe figure in c ( see also figures 2 and 3 ) shows the location of the c5a coarse - grained beads \n from the 9.9 mag lipid ( see a ) ; note the cubic phase structure .\nthe \n similarity evident in b and c underscores the close relation between \n the organization of the c5a beads ( representing the density of terminal \n methylene and methyl groups in 9.9 mag lipids ) and the tpms of the pn3 m cubic phase .\nthe rapid pace of new structural data acquisition using the features of the in meso method \n underscores the usefulness and success of the technology .\nthus , structural \n information obtained in this manner for several rhodopsin - like gpcrs \n ( reviewed in ref ( 6 ) ) and a gpcr - g protein complex , provided \n breakthrough insights about the structural basis for signal transduction \n through these 7-tm helical proteins .\nhowever , the present lack of \n a mechanistic understanding , at the molecular level , of the events \n that lead to in meso crystallization of membrane \n proteins , makes the success of the method somewhat enigmatic and results \n in the need for extensive trials to identify specific conditions , \n that is , the host and additive lipid , precipitant etc .\nsuch in meso trials begin with the target \n protein \n being reconstituted into the lcp , and a hypothetical descriptive mechanism \n based on the membrane curvature and hydrophobic mismatch has been \n proposed to address \n the crucial step during in meso crystallization  the \n preferential partitioning of proteins from the lcp to the lamellar \n phase . in the original trials ,\nthe lipid used to form the lcp was \n monoolein ( 9.9 mag , see figure 1a ) , however \n recent experiments have utilized shorter chain analogs of monoolein \n as well as mixtures of monoolein with cholesterol ( see refs ( 12 , 18,21)and citations \n therein ) .\nthe reconstituted proteins appear to be well - accommodated , \n functional , and mobile inside the lcp where they are believed to reside \n largely in a monomeric state .\nthe addition of a precipitant \n of suitable composition , which is \n the next step in the in meso trial , is proposed to \n result in local structural and compositional changes in the mesophase \n and likely in protein conformation as well , which alter the interactions between the \n proteins and the cubic phase lipid bilayer ; ultimately this drives \n the preferential partitioning of the proteins into the lamellar phase \n that presumably appears within the lcp .\nthe critical aspect of the nucleation and subsequent crystal growth \n process that is triggered in this manner , and ultimately determines \n the quality of the grown crystals , is that once they have diffused \n from the lcp to the lamellar phase the proteins form tight 3d oligomeric \n arrays .\nthe oligomerization of \n tm proteins in lipid bilayers has generally \n been suggested to involve the hydrophobic mismatch effects originating \n from the difference in the lengths of the hydrophobic core of the \n protein and the surrounding lipid hydrocarbon region .\nsuch mismatch effects have been shown from experiments to play a \n role not only in the spatial organization but also in the function \n of tm proteins , such as the gpcr rhodopsin .\nthe hydrophobic mismatch is considered to drive the membrane to \n deform in order to alleviate the energetically unfavorable hydrophilic / hydrophobic \n exposure this mismatch entails .\nwhen such membrane deformation can not \n achieve a complete hydrophobic adaptation , the  residual exposure  \n ( or  residual mismatch  ) to unfavorable interactions \n gives rise to an unfavorable contribution to the free energy of protein / membrane \n interaction .\nthe mitigation of this energy \n term through oligomerization has been suggested as an important mechanistic \n contribution to membrane - driven oligomerization of multihelical tm \n proteins , such as gpcrs , in lipid bilayers .\ntherefore , we investigated the potential role of differential hydrophobic \n exposure of such proteins in lipid bilayers of the cubic and lamellar \n phases as a possible determinant of the favorable outcome of in meso crystallization trials . here\nwe present the \n results of a molecular dynamics - based study \n of a gpcr reconstituted into an lcp environment that reveal differences \n in the hydrophobic / hydrophilic exposure of the gpcr to lipid \nthe quantitative results \n reflect the drive for differential oligomerization behavior of these \n proteins in the two lipid environments that essentially define the \n end points along the in meso crystallization pathway . \n with the ability to connect quantitatively the difference in gpcr \n oligomerization behavior in the two different media , to the curvature \n and mismatch alleviation capabilities of the two environments ,\nwe \n are able to predict lipid types that would enhance / diminish the difference \n in the residual exposure for a gpcr in the cubic and lamellar phases . given the recognized importance of protein \nmembrane interaction \n for the functional properties of gpcrs , molecular dynamics simulation \n studies using all - atom and coarse - grained representations have been carried out for the prototypical gpcr , \n rhodopsin , in lamellar membranes . to our knowledge\nthe present work \n is the first molecular dynamics - based study of a gpcr reconstituted \n into the lcp .\nthe results enable quantitative inferences about the \n energetically unfavorable hydrophobic  hydrophilic interactions \n that differentiate the behaviors of gpcrs in the two different lipid \n environments , lcp and lamellar membranes .\nwe attain these insights \n from comparative microsecond time - scale coarse - grained simulations \n with the martini force - field of rhodopsin in monoolein - based \n cubic and lamellar lipid bilayers . using our recently reported computational \n framework for quantifying residual mismatch energies from md trajectories\n, we evaluated the protein - dependent membrane \n deformations and their attendant energy cost , and identified specific \n tm regions and residues of rhodopsin that exhibit differential hydrophobic \n exposure in the lcp and lamellar bilayers .\nwe show that the bilayer \n of the lcp more efficiently shields the protein from unfavorable interactions , \n and that the reduced level of hydrophobic mismatch in the lcp is attributable \n to the specific , highly curved geometry of the cubic phase .\nbetter \n protection from unfavorable hydrophobic exposure of rhodopsin in the \n lcp phase is especially evident for residues in tm helix 1 ( tmh1 ) \n and tmh5 .\nlcp environment , the planar bilayer of the lamellar phase provides \n a more favorable setting for gpcr oligomerization as a prelude to \n nucleation and crystal growth .\nthus , our findings provide novel energy - based \n insights into driving elements of in meso crystallization \n mechanisms and lay the foundation for future quantitative exploration \n of rational approaches for the generation of structure - quality crystals \n of membrane proteins .\ncoarse - grained ( cg ) md simulations of the lipid \n cubic phases ( lcp ) with or without rhodopsin were done with the martini \n force field , grouping atoms into coarse - grained \n beads ( see figure 1a ) , and the gromacs 3.3.1 \n package as listed for the various molecular \n constructs in table 1 . as a host lipid for \n the lcp , we used monoolein ( 9.9 mag ) which consists of an 18 carbon \n fatty acid with a cis double bond between carbons \n 9 and 10 in ester linkage to the primary hydroxyl of glycerol ( figure 1a ) .\nsimulation times reported are effective \n times , taking into consideration typical for martini force - field based \n coarse - grained simulations factor of 4 .\nsimulations with protein were initiated \n from self - assembled lipid diamond cubic phase of 500 lipids by replicating \n the monoolein / water system 27 times ( 3 times in positive and negative x , y , z directions ) and inserting rhodopsin randomly into \n the expanded lcp phase . in the first phase of the study\n, we conducted extensive self - assembly \n simulations of randomly mixed cg 9.9 mag lipids and water molecules \n into a lipidic diamond cubic phase .\nas listed in table 1 and detailed in the results , the diamond lipid phase was \n successfully achieved in multiple simulations conducted at 20 c \n temperature and 40% ( w / w ) water weight percent .\nall the self - assembly \n simulations ( see table 1 ) were initiated from \n a random placement of 500 cg 9.9 mags ( a number that is within the \n experimentally determined range of 9.9 mag molecules in the unit cell \n of the diamond cubic phase ) , and a corresponding number ( determined \n by the desired percentage ) of cg water beads in a cubic box .\neach \n system was first equilibrated for a short period of time with the \n isotropic pressure coupling scheme and the lennard - jones ( lj ) parameters \n of all the atoms set to those of the beads representing water molecules \n in the martini force - field .\nthis setup , implemented as well in earlier \n cg self - assembly simulations of the lcp , allowed efficient adaptation of the volume of the simulation box \n to the number of cg molecules in the system , and ensured complete \n mixing of lipids and waters prior to self - assembly simulation . after this initial equilibration phase ,\nthe lj parameters for 9.9 \n mag lipids were reset to their proper values ( see details of force - field \n parametrization , below ) , and 6 s - long self - assembly md simulations \n were performed ( the simulation times reported throughout are effective \n times , taking into consideration the \n factor of 4 typical for martini force - field - based coarse - grained simulations ) , \n and using isotropic pressure coupling ( with 3.0 ps and 3e bar time constant and compressibility , respectively ) , \n and a 30 fs time step . to simulate rhodopsin in the diamond phase\n, we constructed the system \n by replicating 27 times ( along positive and negative x , y , \n z directions ) one of the cubic phase structures obtained \n from the self - assembly simulations conducted at 20 c and at \n 40% ( w / w ) water .\nthe diamond cubic phase in this enlarged construct \n remained stable in a microsecond - long cg md simulation ( data not shown ) . \n\na rhodopsin molecule was inserted at a random position in this large \n cubic phase ( at 122:1 9.9mag / rhodopsin molar ratio , corresponding \n to 4 mg / ml concentration , see figure s1 in the supporting information ) . after removing overlapping waters \n and 9.9 mag molecules and adding counterions for electroneutrality , \n a 4.8 s - long cg md simulation was carried out at 20 c . \n\nthe total number of cg beads in this large construct was 139  979 , \n which corresponds to 1  400  000 actual \n atoms .\nthe simulation utilized the isotropic pressure coupling \n scheme as above , and a 30 fs time step .\nrhodopsin \n was simulated in 9.9 mag lipid lamellar bilayers with the cg martini \n force - field .\nthe cg model of rhodopsin ( see below ) was inserted into \n a pre - equilibrated cg 9.9 mag lipid membrane containing 1772 lipids , \n and after solvation and ionization steps , a 3.2 s - long md simulation \n was carried out at 20 c temperature using a 40 fs integration \n time step and the semi - isotropic pressure coupling scheme .\nthe details of the martini cg \n force fields and the parametrization scheme employed for 9.9 mag lipid \n and rhodopsin can be found in the supporting methods section of supporting information .\nthe residual exposure energy is the energy \n cost of the hydrophobic mismatch that persists in the equilibrium \n state of the membrane - protein interaction , even after membrane remodeling \n around multi - tm proteins has taken place to reduce the hydrophobic \n mismatch .\nthis result \n of the anisotropy of the protein  membrane boundary when multi - tm \n proteins are inserted in the bilayer has been discussed in detail . for rhodopsin , the residual exposure of residues in the tm segments \n was quantified with the computational protocol described in ref ( 30 ) in both the lipid cubic \n and lamellar phases , using solvent accessible surface area ( sasa ) \n calculations with the naccess software and a probe radius of 1.4  .\nas described previously , sasa values \n were obtained either with the solute comprising the protein only ( saprot ) , or with the solute containing the protein and the hydrophobic \n core of the lipid bilayer ( samem)the latter being \n defined as the 9.9 mag bilayer region consisting of the gl1-c1a - c2a - d3a - c4a - c5a \n cg beads ( see above for the cg bead definition , depicted in figure 1a ) .\nthe residual exposure sares was then \n calculated as sares = saprot  samem for polar residues and as sares = samem for hydrophobic residues ( see ref ( 30 ) for details ) .\nthese accessible surface \n values were used to obtain the residual mismatch energy penalty gres associated with a particular residue as \n gres = ressares , where res = 0.028 kcal/(mol ) is a constant of proportionality related to the free energy \n of transfer of amino acids between aqueous and lipid environments . according to a well - accepted protocol , interfacial trp , arg , and\nlys residues were not penalized for residual \n mismatch due to their ability to adapt favorably to hydrophobic / hydrophilic \n interfaces . for a quantitative assessment of the spatial organization of the \n bicontinuous lipid / water structures assembled computationally , we \n utilized an analytical fit of the data obtained from the simulations . \n to obtain this fit we represented the location of the lipid bilayer \n midplane of the bicontinuous cubic phase by the triply periodic minimal \n surface ( tpms , surface with zero mean curvature):1where f(x , y , z ,  )\nis the improved nodal approximation given by:2with3 and x = x , y = y , z = z , and p , q , r = c , s ( c and s stand for cosine and sine , respectively ) .\nthe { h , k , l } in the above equations are the crystallographic miller \n indices , and  is a fitting parameter such that 1/ represents \n the linear size of the primitive unit cell .\nthis surface was shown \n to provide an accurate representation of the surface in the pn3 m symmetry group ( see , for example , ref ( 3 ) and citations therein ) . for each 9.9mag / water trajectory listed in table 1 , a fit to the analytical solution was performed on 20 separate \n frames spaced 350 ns apart . to this end\nwe extracted the coordinates \n { xi } of n c5a coarse - grained beads representing the location of \n the terminal methylene and methyl groups in the hydrocarbon tail of \n 9.9 mag lipids for each frame , and the fit was done by optimizing f(xi ,  ) = ci through \n a search for the translational and rotational transformations that \n minimized  = ( 1/n)i=1ci . the quality of the fit was assessed from \n the distribution of { ci } values obtained from the minimization procedure ; this distribution \n is centered around the theoretical mean , zero ( i.e. , the analytical \n solution of eq 1 ) .\nsuch a distribution was collected \n for each md trajectory by merging the { ci } coefficients obtained from fitting all 20 separate \n frames , and the quality was assessed as described above ( see distribution \n plots and captions in figure 4 and in figure \n s3 in the supporting information ) . to compare quantitatively the structural arrangement \n of the lcp bilayer near the protein , to that in the bulk cubic phase , \n we employed two complementary approaches . in the first , we obtained \n an analytical solution for the lipid bilayer midplane around the protein \n by fitting the simulation data ( coordinates of c5a beads ) to f(x , y , z ,  ) = ci , as described above in the tpms representation , \n except that for this purpose the { ci } coefficients were also considered as variable parameters \n that must be self - consistently minimized ( see above ) . in this manner\n, \n the extent of the deviation of the mean value of the { ci } distribution obtained from the solution \n for the pn3 m phase ( ci  0 , see above ) , \n measures the distortion of the diamond cubic phase due to the protein . the alternative approach we developed for quantifying the perturbation \n of lipid bilayer shape induced by the gpcr departs from the symmetry \n group definition and focuses on the lipid  water boundary . in \n this approach ,\ndifferent trajectory frames from the simulation of \n rhodopsin in lcp are aligned onto snapshots from the simulations of \n the large protein - depleted 9.9 mag / water system . using a locally defined \n scoring function ( see below ) , we assess how well the lipid bilayers \n of the protein - containing and protein - free systems align ( the large \n protein - free system was constructed by replicating 27 times the equilibrated \n system composed of 500 9.9 mag lipids/6800 water molecules , and subjecting \n it to microsecond long cg md simulation during which the pn3 m phase was maintained ; data not shown ) . to align the protein - free \n and protein - containing structures , we \n used water densities to first align 10 frames from the last 100 ns \n of the protein - free simulation , which served as a reference on which \n we aligned 10 frames from the last 100 ns of the protein - containing \n trajectory . only water beads at least 50  away from the protein \n were considered , in order to avoid degradation of the alignment quality \n due to deformations of the lipid cubic phase near the protein .\nthe alignments utilized the electron density (y ) at any point y of a set of beads with coordinates \n ri ; the density function was constructed \n as a superposition of gaussians , so that for a particular trajectory \n frame4where c and k are the amplitude and width of the gaussians , respectively , chosen \n to produce a 10  resolution density map .\nthe quality of the superposition of two frames was \n estimated by \n measuring the overlap of the water - containing and water - free regions \n using:5where x = { xj } ( j = 1,2, ... ,m1 , m1 + 1, ... ,n ) are coordinates of beads in \n the fitted frame which contains m1 water \n beads and n  m1 lipid beads ; w is the density \n of water in the reference frame obtained using eq 5 ; sj = 1 for j  m1 , and sj = 1 for j > m1 .\nthe best alignment was calculated by maximizing s with respect to the rotational and translational transformations \n applied to x. the local quality of the alignment \n was assessed by a normalized \n scoring function defined as:6where (xj ) represents the electron density of the \n beads in the reference frame .\nthe self - assembly of the 9.9 mag / water complex \n with 40% ( w / w ) water composition was probed at 20 c , which are \n conditions similar to those used in the original in meso crystallization trials of gpcr proteins ( see ref ( 14 ) and citations therein ) . \n figures 2 and 3 show several views of \n 9.9 mag / water complexes obtained under these conditions produced by \n the 6 s - long self - assembly simulation of 500 9.9 mag lipids . \n in figure 2 , panels a  c offer views \n of the unit simulation cell , whereas figure 3 depicts various snapshots of the same system replicated 27 times \n ( 3 times in each orthogonal direction ) .\ntypically , in our simulations \n the initially randomly mixed 9.9 mag / water system became organized \n as illustrated in figures 23 within the first 350 ns of simulation , and remained \n stable for the remainder of the 6 s trajectory .\n( a , b ) views of the unit \n simulation cell containing 9.9 mag / water \n complex at 40% ( w / w ) water concentration and at 20 c temperature , \n after 6 s of self - assembly simulation .\n( a ) entire system where \n different components are colored as following : 9.9 mag lipid headgroup \n beads , blue ; 9.9 mag lipid hydrocarbon tail beads , red ; and water \n beads , cyan .\n( b ) separately 9.9 mag hydrocarbon chain beads from the \n same perspective as in a. ( c ) view of the tetrahedral arrangement \n of the water channel from a. the four arms of the tetrahedral geometry \n are visible .\n( d ) snapshot of two nonintersecting continuous intertwined \n water channels ( in gold and cyan , respectively ) .\nthe representations \n are for the  expanded  system obtained by replicating \n the simulated system 9 times ( in positive x , y , and z directions ) .\nviews of the 9.9 mag / water complex from figure 2 replicated 27 times ( 3 times in positive and negative x , y , and z directions ) reveal bicontinuous \n diamond cubic phase nature of the self - assembled structure .\ndifferent \n panels show : the entire system ( a ) , 9.9 mag headgroup and water cg \n beads ( b ) , 9.9 mag hydrocarbon chain beads ( c ) , only water beads ( d ) . \n\nthe bicontinuous cubic phase nature of the self - assembled \n structure \n is apparent from inspection of the spatial organization of both lipid \n and water components .\nindeed , the hydrophobic core of the 9.9 mag \n lipids ( shown in red in figures 23 ) traces a single highly curved continuous surface \n in 3d , surrounded by 9.9 mag headgroups ( dark blue shades in figures 23 ) adjacent to aqueous \n compartments ( cyan colors in figures 2a , c and 3 ) .\nthe aqueous part of the system consists of two \n nonintersecting three - dimensional continuous networks of water channels \n ( figure 2d ) , which makes the assembled structure \n a bicontinuous cubic phase .\nfigure 2c \n shows that in each of the water \n compartments four aqueous channels meet in a tetrahedral arrangement . \n\na similar arrangement can be observed as well for the surface traced \n by the hydrocarbon chains of 9.9 mag lipids ( see figures 2b and 3c ) .\nthus , the assembled structure \n resembles closely the doubly bicontinuous lipidic diamond cubic phase . \n\none general feature of such mesophases is that the surface traced \n by the midplane of the lipid bilayer , which separates the two aqueous \n compartments , can be approximated by the triply periodic minimal surface \n ( tpms ) that has a special property : it is characterized at every point \n by zero mean curvature .\nconsequently , the tpms is saddle - shaped ( figure \n s2 , supporting information ) .\nthis saddle - shaped \n geometry of the 9.9 mag / water assembly resulting from our calculations \n can be appreciated , for example , by tracing the surface formed by \n the 9.9 mag hydrophobic core ( see figures 23 ) . for a quantitative assessment \n of the adherence of the bicontinuous \n structure from our simulations to the organization of the pn3 m diamond cubic phase\n, we performed a fit of the simulation \n data to the analytical solution , as described in methods .\nthe quality of the fit was assessed quantitatively \n from the distribution of the fitting coefficients { ci } ( see methods ) shown in figure 4 .\nclearly , the distribution is centered around zero mean , and is \n relatively narrow ( with a standard deviation of 0.4 ) , suggesting \n that the surface traced by the c5a beads is consistent with the tpms \n of the pn3 m cubic phase ( see eqs 13 ) .\ndistribution of { ci } coefficients from the fitting \n of the c5a bead positions from the \n simulations to the analytical tpms approximation ( see methods ) .\nthe  test established the significance of the fit \n with probability p < 0.05 .\nas indicated in table 1 , \n the self - assembly \n of 9.9 mag / water mixture was investigated in two additional simulations \n performed at t = 20 c and 40% ( w / w ) water content . \n in all cases 9.9\nmag and water molecules aggregated in doubly bicontinuous \n diamond lipid cubic phases , similar to that described in figures 23 ( see figure s3 \n in the supporting information ) . to explore the organization \n of a gpcr inside the cubic mesophase we simulated the prototypical \n class - a gpcr , rhodopsin , in 9.9 mag - containing lipidic cubic phase \n in a large system constructed as described in methods .\nthe simulation results were used as described below to compare \n quantitatively the interactions of rhodopsin with bilayers of the \n cubic and lamellar phases , as a basis for interpreting the mechanistic \n role of the hydrophobic mismatch in triggering the nucleation process \n during the in - meso crystallization .\nresidues in the rhodopsin tm bundle that participate \n in unfavorable interfacial hydrophobic / hydrophilic interactions with \n the lipid bilayers of the cubic and lamellar phase were identified , \n as described in methods , with a sasa - based \n approach .\nthe last 1.5 s intervals \n from the respective cg md trajectories for rhodopsin in the 9.9 mag \n lcp ( 4.8 s ) , and in the 9.9 mag lipid lamellar phase ( for 3.2 \n s ) were used for the residual exposure analysis ( see methods for definitions ) , and the corresponding \n residual exposure energies were evaluated as described .\ntable 2 lists rhodopsin \n tm residues that were found to exhibit different hydrophobic exposures \n in the lcp and lamellar phase simulations , alongside their respective \n residual exposure energy penalties ( gres ) .\nall other residues in the tm bundle experienced a residual \n penalty of < 1 kbt ( kb denoting the boltzmann constant ) in both lpc \n and lamellar phases .\nanalysis was carried out on the \n last 1.5 s time interval of the respective trajectories where \n sasa values and corresponding residual exposure energies remained , \n within fluctuations , unchanged .\nnumbering shown in parentheses corresponds \n to the generic residue numbering scheme for gpcrs defined by ballesteros \n and weinstein .\ndifferent residual exposure in the two lipid environments \n became \n evident for residues in the extracellular ( ec ) end of tmh1 , and the \n intracellular side ( ic ) of tmh5 ( table 2 ) . \n\nspecifically , the pro34/gln36 pair on \n tmh1 ( superscript numbers identify the residues by the ballesteros \n and weinstein generic residue numbering scheme for gpcrs ) , and phe228 in tmh5 were found \n to generate a lower residual exposure energy penalty in the lcp than \n in the lamellar phase .\nespecially remarkable is the difference in \n gres for the hydrophobic pro34 residue , that is , 4.7 kbt in the lamellar bilayers , but < 1 kbt in the cubic phase .\nthis difference \n results from pro34 being largely exposed to the lipid \n polar headgroups and/or water environment in the planar membrane , \n but shielded from such unfavorable interactions in the lcp .\nthe large residual exposure predicted for pro34 in \n the lamellar 9.9 mag bilayers is consistent with findings from our \n earlier all - atom md simulations of rhodopsin in planar membranes composed \n of dicn:1pc ( n = 14 , 16 , 18 , 20 ) lipids ; \n the largest residual exposure for pro34 was found in \n the bilayers with the thinnest hydrophobic core , that is , dic14:1pc and dic16:1pc membranes .\ndue to the substantial \n difference between the hydrophobic length of tmh1 in rhodopsin ( 37  , measured along \n the membrane normal ) \n and the bulk hydrophobic thickness of the thinner bilayers ( 27.2 \n and 30.5  , respectively for dic14:1pc and dic16:1pc membranes ) , the mismatch was \n not alleviated by membrane deformations around the protein ( see ref ( 30 ) ) . here\n, the hydrophobic \n thickness of the 9.9 mag lamellar bilayers , calculated from the average \n distance between the lipid gl1 backbone beads on the two leaflets , \n is 31.5  , so that the hydrophobic mismatch between tmh1 and \n the bilayer is again substantial , and can be alleviated only partially \n by membrane deformation , as shown below .\nthe average thickness \n of the 9.9 mag lamellar bilayer around rhodopsin , \n calculated from the last 1.5 s of the md trajectory and the \n membrane thinning around tmh2the helix adjacent to tmh1is \n evident in figure 5 .\ninterestingly , we find \n that the bilayer deforms near the polar ser98 residue \n ( see figure 5d ) , which is apparently shielded \n from the unfavorable exposure to the hydrophobic lipid core by the \n local thinning of the lipid membrane .\nusually , the membrane - facing \n oh of ser residues in a tm bundle can avoid hydrophobic contact \n by forming hydrogen bonds with the helix backbone .\nwhen this is not \n feasible energetically , the bilayer thins around this residue . in \n our simulations\nwe find that in order to shield ser98 from unfavorable hydrophobic exposure , the thinning at tmh2 also \n constrains the lipids at the adjacent tmh1 ( see ref ( 30 ) for a discussion of this \n type of constraint ) , so that the membrane can not deform significantly \n and thus leaves the pro34 residue highly exposed ( see \n figure 5d and table 2 ) .\n( a  c ) views of membrane deformation patterns around the \n rhodopsin immersed into 9.9 mag lamellar bilayers .\nthe average positioning \n of membrane leaflets is identified by the two surfaces colored according \n to the local thickness of the bilayer ( see the bar for color definition ) . \n\nthe gpcr is shown in van der waals representation with the tm helices \n colored as follows : tm1 in gray , tm2 in orange , tm3 in white , tm4 \n in pink , tm5 in purple , tm6 in black , and tm7 in lime the rest of \n the protein ( loops , etc . )\n( d ) magnified view of the \n region containing residues pro34 and ser98 ( both rendered in green ) showing the membrane deformations in their \n vicinity .\nfigure 5 shows that the \n 9.9 mag planar bilayer \n deforms around other tm helices as well .\nspecifically , the membrane \n thins around tmh4 , alleviating the residual mismatch for this helix , \n and around tmh7 where the deformation efficiently accommodates the \n juxtaposed amphipathic helix 8 at the hydrophobic / hydrophilic interface . \n\noverall , the heterogeneous pattern of membrane deformations we observe \n around rhodopsin in the current simulations agrees with earlier findings \n from all - atom md simulations showing the pattern of membrane remodeling \n around rhodopsin and the homologous serotonin 5-ht2a gpcr .\nconsistent with those studies , \n we find here that the deformations of the lamellar 9.9 mag bilayer \n do not completely alleviate the hydrophobic mismatch with the receptor \n ( table 2 ) .\nthe different organization of the \n two lipid phases around the gpcr , as presented below , explains why \n the residual exposure was larger for rhodopsin in the lamellar 9.9 \n mag bilayer than in the 9.9 mag lcp .\nfigure 6 shows the \n organization of the lipid cubic phase around rhodopsin in the initial \n configuration where the protein was randomly inserted in the lcp ( see \n also figure s1 in the supporting information ) , compared to the organization after 4.8 s of cg md simulations . \n\nc with d  f in figure 6 shows the substantial rearrangement of the lipids and solvent \n around rhodopsin during the long md trajectory .\nspecifically , it appears \n that the lcp tends to minimize hydrophobic / hydrophilic contacts with \n the gpcr as the water and lipid headgroup beads organize around polar \n regions of the protein ( yellow colors in figure 6 ) , whereas the lipid hydrocarbon chain beads surround the hydrophobic \n core of the protein ( see caption of figure 6 for tm definitions ) .\nsnapshots illustrating initial ( a  c ) , and final \n ( after 4.8 \n s simulations ) positioning ( d  f ) of rhodopsin ( in yellow / white ) \n inside the cubic phase .\na and d show the organization of water beads \n ( in cyan ) , b and e illustrate the organization of 9.9 mag lipid headgroup \n beads ( in pink ) , and c and f show the organization of 9.9 mag lipid \n hydrophobic core beads ( in purple ) . in all panels\nrhodopsin transmembrane \n ( tm ) helices are colored in white and the rest of the protein in yellow . \n\nshown are only water and 9.9 mag lipids that are within 20  \n of rhodopsin ; rhodopsin is oriented so that its intracellular and \n extracellular ends ( as defined in the lipid bilayer ) point toward \n the bottom and top of the panels , respectively .\nthe snapshots in figure 6 also show that \n rhodopsin equilibrates , as expected , around the saddle - point inside \n the lcp so that the tm bundle perpendicularly \n traverses a narrow but relatively flattened region of the lcp bilayer , \n much like the gpcr protein does in the lamellar bilayers .\nhowever , \n due to continuous and intrinsically saddle - shaped geometry of the \n diamond cubic phase , the lcp bilayer is dramatically curved near tmh1 \n and tmh5 , which effectively confines the protein to a small region \n of the lcp .\nthis special arrangement of the cubic mesophase around \n rhodopsin shields the gpcr in the lcp from the kind of unfavorable \n hydrophobic / hydrophilic interactions with the lipid bilayer seen in \n the lamellar membranes .\nthus , as illustrated in figure s4 ( in the supporting information ) and reflected in the \n residual energy penalties ( in table 2 ) , residues \n pro34 and phe228 are in contact with \n the hydrophobic core of the lcp bilayer and therefore do not incur \n a residual mismatch penalty , although gln36 experiences \n somewhat higher residual exposure in the lcp compared to the lamellar \n phase ( see figure s4 and table 2 ) .\nglamellar to be 2.7 kbt for the pro34/gln36 pair , and 1.8 kbt for phe228 ( table 2 ) .\nnotably , the shielding of ser98 that faced the 9.9 mag lipid bilayer in the lamellar phase \n simulations , occurs in the lcp simulations through interaction with \n the protein backbone . to relate the calculated residual mismatch \n energies to the organization \n of the lipidic cubic mesophase around the gpcr , we quantitatively \n\ncompared the structural arrangement of the lcp bilayer near the protein , \n to that in the bulk cubic phase . as described in methods ,\ntwo different approaches were used : in the first , \n we obtained an analytical fit of the lipid bilayer midplane shape \n around the protein by fitting the coordinates of 9.9 mag lipid c5a \n methyl terminus beads ( figure 1a ) from the \n simulations to f(x , y , z ,  ) = ci , considering \n { ci } coefficients as \n variable parameters that must be minimized during the fitting ( see methods ) .\nthe application of this procedure to spherical \n lipid shells situated at different distances from rhodopsin ( see figure 7a ) revealed that the organization of the lcp close \n to the gpcr is different from that expected for the pn3 m lipid bilayer ( ci  0 in figure 7a ) .\nhowever , \n already at distances 50  from the center of rhodopsin \n ( compare to 3540  linear dimension of a rhodopsin - like \n gpcr in bilayer x  y plane directions ) , the \n simulated structure relaxes to the organization of the diamond cubic \n phase ( ci \n = 0 , figure 7a ) .\nthe second approach confirms \n that the distorted lcp bilayer near the protein tends to relax toward \n the pn3 m phase arrangement at larger distances ( figure 7b ) . in this alternative approach\nwe locally quantify \n the shape of the lipid bilayer around the gpcr by aligning trajectory \n frames from the simulation of rhodopsin in lcp onto snapshots from \n the simulations of the pure lcp system , so as to optimize the overlap \n of the water - containing and water - free regions ( see methods ) . a scoring function defined locally ( see eq 5 ) is used to assess the quality of the alignment . \n\nas seen from figure 7b , this procedure revealed \n that the fit between the densities of c5a lipid beads in protein - containing \n and protein - free systems progressively improves with the radial distance \n from the gpcr ( increasing s in figure 7b ) .\nindeed , consistent with the result in figure 7a , the scoring function reaches its plateau 50  \n away from the protein , indicating that at these distances the lcp \n arrangement becomes similar to that expected for the pn3 m phase .\ndistance dependence of the relaxation of membrane deformation near \n rhodopsin in the cubic phase .\n( a ) analytical fit of the density of \n c5a 9.9 mag lipid beads from cg md simulation of rhodopsin in the \n lcp phase to the surface defined by the f(x , y , z ,  ) = ci equation ( see methods ) .\nthe mean values \n of the { ci } fitting coefficient \n distribution as a function of r , are shown for 10 \n  spherical lipid shells located at r = 20 , 30 , 40 , and 50  away the protein center - of - mass . \n\n( b ) reasults from the same measurements performed with an alternative \n approach based on the alignment of the lipid bilayer midplane in protein - containing \n and protein - free cubic phases ( see methods ) .\nthe quality of the fit upon alignment was determined for 10  \n spherical lipid shells located at distances r from \n the protein center - of - mass , and the panel shows the dependence of \n the scoring function s on r. note \n that the deformed cubic phase near rhodopsin relaxes to the arrangement \n that is characteristic of the pn3 m phase 50 \n  away from the protein .\ntaken together , our results establish a quantitative \n link between \n the residual mismatch penalty and the lipid bilayer deformations around \n the gpcr in the cubic phase .\nthus , the areas where the largest perturbations \n from the diamond cubic phase were observed included residues pro34 and phe228 ( see figure s5 in the supporting material ) , which are also the residues \n with the largest value of glcp  \n glamellar ( table 2 ) .\nthe main findings from this study offer \n unprecedented insight into \n molecular level processes related to in meso crystallization , \n which are likely leading to protein nucleation and eventually to crystal \n growth .\nthus , we found that the difference in the hydrophobic / hydrophilic \n exposure of the protein to the lipid bilayers of 9.9 mag lcp and lamellar \n phases is responsible for a lower residual mismatch ( and its corresponding \n energy penalty ) in the cubic mesophase compared to the lamellar membranes . \n\nthis indicates why gpcrs reconstituted into the lcp in the initial \n stages of the in meso trial are well accommodated \n inside the cubic phase , where they are believed to reside mostly in \n the monomeric form .\nindeed , from our findings there is insignificant \n drive toward rhodopsin oligomerization in the lcp .\nwe showed , however , \n why this drive is increased in the planar bilayer environment of the \n lamellar phase where there are several critical mechanistic factors \n that determine the probability for proteins to oligomerize .\none important \n energy component that has been established from both experiments and computations , involves the hydrophobic mismatch . \n\nin particular , a plausible mechanism to relieve the energy penalty \n due to residual exposure is protein oligomerization , whereby the tm \n segments incurring the highest energy penalty from the residual exposure \n come together in the lipid bilayer . for \n such hydrophobic - mismatch driven association to occur\n, the \n residual exposure penalty alleviated by the protein association must \n counteract other critical factors that could favor proteins in the \n monomeric state .\none such important consideration is the mobility \n of proteins , because constrained diffusion reduces the chance for \n protein  protein encounter . as shown in figure 8 , the spatial restriction encountered by the gpcr inside the \n lcp\n( see figure 6 ) significantly affects protein \n mobility , with the diffusion coefficient of the gpcr in the cubic \n phase being smaller ( dlcp = 1.1  \n 10 m / sec ) than that in the lamellar \n bilayers ( dlamellar = 5.5  10 m / sec ) .\nthe restricted diffusion mode \n for rhodopsin in the lcp environment is consistent with the suggested \n high energy cost in the lcp for gpcr - sized proteins to cross between \n different regions of the mesophase .\nthis \n energy penalty was quantified from phenomenological principles to \n be as high as 1220 kbt in the pn3 m phase with lattice parameter values in the 75110  \n range .\nthis estimated energy cost of protein \n diffusion in the lcp is significantly higher than the residual mismatch \n penalty we calculated for rhodopsin in the cubic phase ( table 2 ) . when considered together , the relatively low \n residual exposure energy for the gpcr in the lcp is not likely to \n be sufficient to compensate for the high energy barrier for protein \n mobility in the lcp and drive protein association .\nthe prediction \n is , therefore , that in the cubic mesophase gpcr proteins will remain \n largely in the monomeric state .\nmean - square - displacement ( msd ) as a function of \n time calculated for rhodopsin in the 9.9 mag lipidic cubic phase ( lcp ) \n and in the 9.9 mag lamellar membrane ( lamellar ) .\ncorresponding diffusion \n coefficient values , calculated from the linear fit performed in [ 0 \n s;1 s ] time interval , are dlcp = 1.1  10 m / sec and dlamellar = 5.5  10 m / sec .\nin contrast to the lcp , the lamellar membrane environment \n is more \n favorable for gpcr oligomerization : the residual energy penalty for \n the rhodopsin tm bundle in the lamellar bilayers is 8 kbt ( table 2 ) and is significantly higher compared to that in the lcp , \n indicating a stronger drive for gpcr oligomerization in the lamellar \n membranes .\na higher propensity for association in the planar bilayers \n is also supported by our calculations of the protein mobility in the \n two lipid environments , whereby we find a 5-fold larger diffusion \n coefficient for the gpcr in the lamellar bilayers ( figure 8) .\ntaken together , results from our simulations \n suggest that planar \n 9.9 mag lipid membranes provide a more suitable setting for oligomerization \n of the gpcr proteins .\nnotably , this prediction is based on results \n for oligomerization in a plane of the lipid bilayer .\nthis 2d nucleation \n process together with the formation of protein - enriched lamellar stacks \n in 3d should ultimately drive the emergence \n of a bulk crystal .\nthe question remains regarding the mechanism \n that drives the proteins \n from the lcp to the lamellar membranes and the potential role of the \n differential residual interactions between the protein and the bilayers \n of the two lipidic phases in the nucleation process .\nwe note that \n the nucleation is triggered by the addition of the precipitant which \n is known to cause transient water depletion from the lcp interior , resulting in structural changes in the cubic \n phase bilayer .\nour current study has not attempted to quantify the \n effects of the precipitant , but it is reasonable to speculate that \n dehydration of the cubic phase will only increase the unfavorable \n residual interactions between the gpcr and the lcp bilayer .\nthis is likely to increase the drive for protein \n oligomerization inside the lcp upon precipitant addition , which could \n lead to the formation of locally flattened lamellar bilayers as a \n prelude to protein crystallization . in order to address quantitatively \n the structural perturbations due to precipitant , such as changes in \n curvature of the lcp bilayer ,\nit is critical to calculate the corresponding \n deformation energies in the presence of the protein .\nhowever , the \n representation of the complex geometry of the lcp around the insertion \n ( figures 67 ) \n in the numerical approach developed in the current work for quantifying \n the lcp shape ( i.e. , fitting the md data to the analytical solution ) \n is not sufficiently refined to serve in the calculation of reliable \n energies\nwe note , however , that recent experimental studies showed that , compared to 9.9 \n mag , in meso trials conducted on the gpcr - gs protein \n complex with a shorter chain mag analog , 7.7 mag ( acyl chain 14 carbon \n atoms long with the cis double bond between carbon atoms 7 and 8) \n resulted in better quality crystals .\nthus , results from our \n current studies as well as from recently reported all - atom simulations \n of gpcrs in membranes of different thicknesses , explain why 7.7 mag would provide a better platform in \n which gpcrs can aggregate more extensively : based on our findings \n we can predict that , due to the expected 78  \n difference in the hydrophobic thickness of planar 9.9 mag and 7.7 \n mag membranes , the residual exposure of the gpcr will be substantially \n higher in the thinner 7.7 mag lamellar bilayers . as an example\n, we \n recently reported that the rhodopsin tm bundle will exhibit a 12 kbt higher residual energy penalty \n in dic14:1pc than in dic18:1pc bilayers .\na more complete quantitative elucidation of \n the gpcr nucleation process in relation to the residual mismatch energy \n component requires further studies that would take into consideration \n the effect of the different precipitants on various lipids .\nthe structurally specific predictions of the regions where the \n residual mismatch with lipid bilayers of cubic and lamellar phases \n differed for the rhodopsin tm bundle made it possible to probe the \n resulting predictions and general character of the findings by examining \n crystallographic data . in particular , we showed here that the intracellular \n ( ic ) end of tmh1 ( pro34 ) , and the extracellular ( ec ) \n part of the tmh5 including phe228 have higher residual \n exposure in lamellar membranes , which leads to the prediction ( e.g. , \n see shan et al . )\nthat in the planar bilayers \n rhodopsin will exhibit strong hydrophobic - mismatch driven tendency \n for oligomerization through tmh1 and tmh5 . to assess this hypothesis \n in the context of structural information available for gpcrs , we examined \n crystallographic contact interfaces for 12 different structures of \n rhodopsin - like gpcrs obtained by means of the in meso technology ( 2 receptor  pbd codes : 2rh1 , 3pds , 3sn6 ; a2a receptor  \n pdb codes : 3eml , 3qak ; chemokine \n cxcr4 receptor  pdb codes : 3odu , 3oe0 , 3oe6 , 3oe8 , 3oe9 ; dopamine d3 receptor \n  pdb code : 3pbl , and histamine h1 receptor  pdb code : 3rze ) .\nfor all these \n gpcr structures , we analyzed the content of the unit crystallographic \n cell and quantified for each tm helix ( 1 ) the frequency of its occurrence \n at the crystallographic contact interface and ( 2 ) the number of residue \n interactions each tm helix forms at the contact interface .\ncanonical  interfaces were considered , \n where the crystallographic contacts were formed exclusively through \n tm  tm interactions between monomers in parallel orientations .\nremarkably , we found that tmh1 and tmh5 , the two helices implicated \n in the largest residual mismatch in our simulations of rhodopsin with \n 9.9 mag lamellar bilayers , contribute to the most common contact interfaces \n in the crystallographic structures of the homologous gpcrs .\nmore specifically , \n as illustrated in figure s6a ( see supporting information ) , all but 4 of the 14 distinct intermolecular tm \ntm interfaces \n identified in this analysis , involve tmh1 and/or tmh5 . furthermore , \n examining the residues involved in the interactions at the contact \n interfaces revealed that the tmh1 stretch of residues in positions \n 1.291.34 ( that would include pro34 in the homologous \n rhodopsin gpcr ) contribute significantly to the formation of the crystallographic \n interface . during the final preparation of this manuscript , \n two new crystal \n structures of rhodopsin - like gpcrs ,\nthe -opioid receptor ( kor ) \n and the -opioid receptor ( mor ) were reported to be obtained \n by means of in meso crystallization .\nconsistent with the data presented above , the crystallographic interface \n of kor consists of tm1 , tm2 and h8 , with the n - terminal end of tm1 \n ( region harboring the residue homologous to pro34 in \n rhodopsin ) forming extensive dimeric contacts . for mor , two crystallographic \n interfaces were reported : the more prominent interface consisted of \n tm5/tm6 helices with the i256 residue ( aligning with \n the residue next to phe228 in rhodopsin ) residing at \n the dimer interface , and more limited contacts formed by tm1 , tm2 \n and h8 . taken together ,\nour findings support the mechanistic \n inferences \n that ( 1 ) the reduced level of hydrophobic mismatch in the lcp is attributable \n to the specific highly curved geometry of the cubic phase that provides \n for more coverage from unfavorable hydrophobic exposure ; ( 2 ) compared \n to the lcp , lamellar structures provide a more favorable setting in \n which gpcrs can oligomerize as a prelude to nucleation and crystal \n growth ; and ( 3 ) the extent of the residual mismatch penalty is likely \n one of the critical mechanistic factors that determines not only the \n drive for gpcr proteins to oligomerize during in meso crystallization , but also the structural elements that are likely \n to participate in contact interfaces .\nthese findings provide \n novel energy - based insights into in meso crystallization \n mechanisms and lay a foundation \n for future computational explorations involving other class - a gpcrs \n toward designing rational approaches for generation of structure - quality \n crystals of membrane proteins .", "human": " recent successes in the crystallographic determination \n of structures \n of transmembrane proteins in the g protein - coupled receptor ( gpcr ) \n family have established the lipidic cubic phase ( lcp ) environment \n as the medium of choice for growing structure - grade crystals by the \n method termed  in meso  . \n the understanding of in meso crystallogenesis is currently at a descriptive level . \n to enable an eventual quantitative , energy - based description of the \n nucleation and crystallization mechanism , we have examined the properties \n of the lipidic cubic phase system and the dynamics of the gpcr rhodopsin \n reconstituted into the lcp with coarse - grained molecular dynamics \n simulations with the martini force - field . quantifying the differences \n in the hydrophobic / hydrophilic exposure of the gpcr to lipids in the \n cubic and lamellar phases \n , we found that the highly curved geometry \n of the cubic phase provides more efficient shielding of the protein \n from unfavorable hydrophobic exposure , which leads to a lesser hydrophobic \n mismatch and less unfavorable hydrophobic  hydrophilic interactions \n between the protein and lipid  \n water interface in the lcp , compared \n to the lamellar phase . since hydrophobic mismatch \n is considered a \n driving force for oligomerization , the differences in exposure mismatch \n energies between the lcp and the lamellar structures suggest that \n the latter provide a more favorable setting in which gpcrs can oligomerize \n as a prelude to nucleation and crystal growth . \n these new findings \n lay the foundation for future investigations of in meso crystallization mechanisms related to the transition from the lcp \n to the lamellar phase and studies aimed at an improved rational approach \n for generating structure - quality crystals of membrane proteins . ", "section_names": "Introduction\nTheory and Methods\nResults\nDiscussion", "bigbird_pegasus": "<s> the lipidic cubic phase ( lcp ) has emerged as a new paradigm for growing crystals of g - protein coupled receptors ( gpcrs ) and other transmembrane ( tm ) proteins.<n> the lcp consists of a bicontinuous lipid bilayer that is nonintersecting intertwined aqueous channels and tracing a triply periodic minimal surface.<n> because of the continuous nature of both the lipid and the water compartments, lcp has been described as a prototypical bicontinuous mesophase with its bilayer midplane tracing a triply periodic minimal surface, characterized by zero mean curvature.<n> the particular kind of lcp utilized during crystallization trials is of pn3 m symmetry type, where each aqueous network of the lcp assumes a tetrahedral geometry.<n> because of the rapid pace of new structural data acquisition using the features of the lcp method, we investigated the effect of residual exposure energy from molecular dynamics ( md ) simulations of the lcp on the quality of the grown crystals of several gpcr - like proteins.<n> our results indicate that the residual exposure energy of the lcp is an important determinant of the structural organization of the membrane - driven oligomerization behavior of these proteins, and likely of other tm proteins.</s>", "longt5": "<pad> the lipidic cubic phase ( lcp ) is a suitable medium for growing high quality crystals of transmembrane ( tm ) proteins. the lcp is composed of a highly curved lipid bilayer structure that is continuous in dimensions ( 3d ) and separates in space two nonintersecting intertwined aqueous channels. we investigated the potential role of differential hydrophobic exposure of such proteins in lipid bilayers of the cubic and lamellar phases as a possible determinant of the favorable outcome of in meso crystallization trials. we found that the reduced level of hydrophobic mismatch in the lcp is attributable to the specific highly curved geometry of the cubic phase that provides for more coverage from unfavorable hydrophobic exposure. better protection from unfavorable hydrophobic exposure of rhodopsin in the lcp phase is especially evident for residues in tm helix 1 ( tmh1 ) and tmh5. lcp environment, the planar bilayer of the lamellar phase provides a more favorable setting for gpcr oligomerization as a prelude to nucleation and crystal growth. thus, our findings provide novel energy - based insights into driving elements of in meso crystallization mechanisms and lay the foundation for future quantitative exploration of rational approaches for the generation of structure - quality crystals of membrane proteins.</s>"}
{"article": "after obtaining approval from institutional ethics committee , a cross - sectional questionnaire - based study was undertaken from august 25 , 2014 , to september 25 , 2014 , including 200 pharmacies in various residential ( r ) and commercial ( c ) areas of bengaluru .\ntwo hundred and twenty - five pharmacies were screened for the study by convenient sampling .\na total of 25 pharmacies ( r-12 , c-13 ) were not included as they were either not willing to participate or were closed at the time of visit . a total of 200 pharmacies , 100 each in various residential and commercial areas of bengaluru willing to participate were selected for the study .\nit was pretested on twenty pharmacies , and cronbach 's alpha of 0.71 was obtained .\nthe questionnaire had two sections , practice , and knowledge with 14 and 4 questions , respectively .\ninformed consent was taken in an attached consent form describing the objectives of the study and participants were assured of confidentiality to elicit an unbiased response .\nthe prevalidated semi - structured questionnaire was administered to the pharmacist or to the person - in - charge in case of nonavailability or absence of the chief pharmacist by the investigators .\nthe data collected in the form of completed questionnaires was categorized , coded , and analyzed .\ndata were expressed as percentages / proportions , tests of proportions were done with chi - square wherever deemed necessary , and p < 0.05 was considered statistically significant .\nthe data collected in the form of completed questionnaires was categorized , coded , and analyzed .\ndata were expressed as percentages / proportions , tests of proportions were done with chi - square wherever deemed necessary , and p < 0.05 was considered statistically significant .\ndispensing without prescription at pharmacies was 45% of the total dispensing encounters , with analgesics ( 90% ) being the most commonly dispensed drugs without prescription followed by antipyretics ( 68% ) , antihistaminics ( 49% ) , and antacids ( 46% ) [ figure 1 ] .\nclasses of drugs dispensed without prescription dispensing without prescription was higher among pharmacies located in residential areas ( 46.64% ) as compared to commercial areas ( 43.64% ) , which was statistically significant ,  = 15.2 , p < 0.001 , and df = 1 [ table 1 ] .\ndispensing encounters without prescription in residential and commercial areas of bengaluru ( n=200 ) only about 19% of the pharmacists checked for all the particulars ( patient particulars , date of prescription , drug name , drug dose and frequency , signature of the doctor , and register number of the doctor ) in the prescription before dispensing the drugs .\nalmost all of them ( 98% ) maintained an inventory , computerized ( 41% ) , and manual ( 57% ) while 2% did not [ table 2 ] .\ndispensing practices at pharmacies in bengaluru ( n=200 ) although 97% ( 194 ) of the pharmacies had a refrigerator , 31% ( 66 ) of these did not have power back - up .\nsixty - two percent ( 124 ) checked the pharmacy for drugs nearing expiry on a monthly basis .\nthe pharmacists advising patients about the various aspects of medication use voluntarily , on patient request or no advice given is shown in figure 2 .\nmedication counseling in pharmacies in bengaluru ( n = 200 ) only 50.5% were aware of schedule h. about 60.5% did not know that prescription in duplicate and stringent dispensing records have to be maintained while dispensing schedule x and h1 drugs [ table 3 ] . among\nwho knew , 22% thought that they have to be maintained for schedule x drugs only , 4.5% for schedule h1 drugs only , and very few ( 13% ) knew that these have to be maintained for both .\nknowledge of the pharmacists in bengaluru ( n=200 ) the majority of them did not know about look alike sound alike ( lasa ) drugs and generic substitution ( 88% and 73.5% , respectively , [ table 3 ] ) .\ndispensing without prescription at pharmacies was 45% of the total dispensing encounters , with analgesics ( 90% ) being the most commonly dispensed drugs without prescription followed by antipyretics ( 68% ) , antihistaminics ( 49% ) , and antacids ( 46% ) [ figure 1 ] .\nclasses of drugs dispensed without prescription dispensing without prescription was higher among pharmacies located in residential areas ( 46.64% ) as compared to commercial areas ( 43.64% ) , which was statistically significant ,  = 15.2 , p < 0.001 , and df = 1 [ table 1 ] .\ndispensing encounters without prescription in residential and commercial areas of bengaluru ( n=200 ) only about 19% of the pharmacists checked for all the particulars ( patient particulars , date of prescription , drug name , drug dose and frequency , signature of the doctor , and register number of the doctor ) in the prescription before dispensing the drugs .\nalmost all of them ( 98% ) maintained an inventory , computerized ( 41% ) , and manual ( 57% ) while 2% did not [ table 2 ] .\nalthough 97% ( 194 ) of the pharmacies had a refrigerator , 31% ( 66 ) of these did not have power back - up .\nsixty - two percent ( 124 ) checked the pharmacy for drugs nearing expiry on a monthly basis .\nthe pharmacists advising patients about the various aspects of medication use voluntarily , on patient request or no advice given is shown in figure 2 .\nonly 50.5% were aware of schedule h. about 60.5% did not know that prescription in duplicate and stringent dispensing records have to be maintained while dispensing schedule x and h1 drugs [ table 3 ] . among\nwho knew , 22% thought that they have to be maintained for schedule x drugs only , 4.5% for schedule h1 drugs only , and very few ( 13% ) knew that these have to be maintained for both .\nknowledge of the pharmacists in bengaluru ( n=200 ) the majority of them did not know about look alike sound alike ( lasa ) drugs and generic substitution ( 88% and 73.5% , respectively , [ table 3 ] ) .\nindia , with an abysmal doctor - population ratio of 1:1218 ( minimum recommended by the who being 1:1000 ) is struggling to cope with the health - care needs of a growing population .\npeople rely on alternative health - care professionals such as chemists , traditional medicine practitioners , and faith healers directly to meet their health needs and to reduce personal costs .\nhence , pharmacists are one of the crucial focal points for health care in the community .\nthey have a large outreach to the public as the number of people visiting pharmacy outlets is possibly greater than other health - care units .\nthis although provides pharmacists with an opportunity for greater involvement in the health - care system , their fragmentary knowledge and improper dispensing practices may have undesired effects .\nindiscriminate dispensing of antibiotics , sub - therapeutic quantities of antibacterials , inappropriate combination of drugs , and injectables under suboptimal conditions have also been reported in the previous studies .\nhence , this study was undertaken to evaluate the drug dispensing practices at pharmacies and the knowledge of pharmacists in bengaluru .\nthe most important finding in this study was a high proportion ( 45% ) of dispensing encounters without prescription .\nthis dispensing pattern is similar to another study conducted in tamil nadu , india , where 58% of the pharmacists dispensed drugs without prescription but better than practices in other countries such as egypt ( 72% ) , tanzania ( 77% ) , and vietnam ( 99% ) where higher rates of dispensing without prescriptions were documented . while lack of universal access to health care could be a major factor , convenience , reduced time to procure medicines , and cost consumption\nfurthermore , a higher proportion of dispensing encounters without prescription in the residential areas was observed as compared to the commercial areas .\napart from the reasons cited above , this could be due to a farther location of health - care facilities .\nanalgesics , antipyretics , antacids , cold and cough remedies , vitamins , nutrition supplements , and antibiotics constituted commonly dispensed drugs without prescription , in that order .\nsimilar patterns were also seen in the egypt and tanzania studies while in the vietnam study and another study conducted in india , antibiotics , vitamins , and nutrition supplements were most commonly dispensed . in another study conducted in saudi arabia , almost all the pharmacists dispensed antibiotics without prescription .\nanalgesics and antipyretics are the most commonly used drugs for relief of fever , common aches , and pains .\nalthough aspirin and paracetamol can be dispensed without prescription , they can lead to adverse outcomes under certain conditions and hence , there is a need for them to be dispensed at right doses with proper counseling of end users .\nother analgesics such as ibuprofen and diclofenac are prescription drugs . while antacids are among over - the - counter ( otc ) drugs , most of the cold and cough remedies and all the antibiotics are schedule h drugs .\nsome authors have also questioned the appropriateness of widespread use of cold and cough remedies , some vitamin preparations and their irrational combinations .\nthis scenario prevails even in the face of existing regulations as most pharmacies do not adhere to them . with bias\nbeing a known caveat of questionnaire surveys the actual situation could still be worse . in the uk ,\na prescription is valid for 6 months from the date of prescription , unless the medicine prescribed contains a controlled drug , in which case it is valid antibiotics and other drugs as otc medications . under the federal law ,\nprescriptions for schedule iii substances expire after 6 months and 5 refills are allowed within the 6-month period , whereas prescriptions for schedule ii controlled substances can not be refilled . in this study\n, it was found that 77% of the pharmacists dispensed drugs for older prescriptions also .\nthis could be due to no specific regulations in place regarding duration of validity of a prescription in our country .\nalthough antibiotics are an essential tool for modern medicine in combating most of the infections , antibiotic resistance remains to be a worldwide problem .\nwhile misuse of antibiotics is a key factor contributing to antibiotic resistance , failure to take an antibiotic as prescribed adds no less . only one - third of the pharmacists insisted on dispensing full course of the antibiotics prescribed and this improper dispensing can contribute to the growing health hazard of antibiotic resistance , which adds to health - care costs and\nthe gpp guidelines by the indian pharmaceutical association require the pharmacist , on receiving the prescription , to confirm the identity of the client , review the prescription for completeness , and check for correctness of the prescribed medications .\nthis is to ensure right dispensing and thus avoid contributing to medication errors at large , the stakes of which are high .\nhowever , in this study , 81% of the pharmacists said they would not check for all the particulars .\n, all of them did check for expiry of the medications before dispensing . maintaining an inventory , especially a computerized one ,\nin this study , we found that 41% of the pharmacies had a computerized inventory , 57% had manual inventory , and 2% did not maintain one . according to the gpp guidelines pharmacies should preferably be equipped with computers for inventory management .\nherbal medicines have emerged as a common choice of therapy for self - care as they are perceived to be free of side effects .\nthis practice is also enforced by irrational claims and aggressive promotions by manufacturers and media , peer views , and lack of well - documented unbiased studies on herbal drug use in disease conditions .\na study conducted in lagos , nigeria , showed that community pharmacies frequently supplied herbal medicines .\nfifty - seven percent of the pharmacies included in this study also dispensed herbal medicines . in the uk ,\nhuman medicines regulations 2012 allows only long - established and quality - controlled herbal medicines to be sold .\nit has also implemented the traditional herbal medicines registration scheme for authorizing the marketing of herbal products .\nmedication counseling is the duty of the modern community pharmacists through which they can significantly contribute to medication safety and patient compliance .\nthe gpp guidelines require the pharmacist to provide professional counseling with regard to the use of medicines , their side effects , and precautions , if any . recognizing the importance of medication counseling , the north carolina board of pharmacy since 1993 made a rule to offer patient counseling on all new prescriptions .\nhowever , a low rate of voluntary medication counseling by the pharmacists was noted in this study .\nthis could possibly be improved by modifying the attitude of pharmacists through educational interventions , incentives , and regulations .\ndrug storage practices , essential for maintaining efficacy of some drugs , were not in accordance with the gpp guidelines which states that pharmacies should be equipped with refrigerated storage facilities validated from time to time for products requiring storage at cold temperature . also having a refrigerator in the pharmacy is a licensing requirement .\nabout 3% of the pharmacies did not have a refrigerator and about 31% of the pharmacies which had a refrigerator did not have power back - up for the same .\nthis scenario is better than another study conducted in pakistan where the majority of the pharmacies did not have an alternative power supply for the refrigerator .\ngeneric substitution is the mutual substitution of medicinal products having the same active ingredient , in the same dose and pharmaceutical form .\nthis concept especially becomes important in case of biologicals and drugs with narrow therapeutic index .\ndisasters such as breakthrough seizures in epileptics due to disregard to the concept of generic substitution are well known .\nnevertheless , unaware of its implications , 56% said they would dispense an alternative brand of the same drug in case of nonavailability of the brand prescribed , irrespective of which drug it was .\nalthough guidelines for the same are in place in few countries , lack of such robust system in our country and unawareness can compound the problems faced in therapeutics .\nindian pharmaceutical industry is now the third - largest in the world with more than 20,000 registered units .\nthe potential for error due to confusing names among health - care personnel has also significantly increased .\npharmacists should , therefore , be cautious while dispensing such drugs and take steps to avoid dispensing errors such as sticking warning labels and avoid keeping lasa drugs in close proximity . however\n, in this study , the majority ( 88% ) did not know about lasa drugs . in all the pharmacies drugs\nrampant use of antibiotics and other drugs as otc medications can lead to serious adverse drug reactions and antibiotic resistance .\nhence , schedule h and schedule x of the drugs and cosmetic rules , 1945 , came into being .\nschedule h includes substances that could be sold by retail on the prescription of a registered medical practitioner only .\nschedule x drugs are those for which a retailer has to preserve the prescription for a period of 2 years .\nwhile schedule x has worked , schedule h implementation has been lax , necessitating the schedule h1 , with 46 drugs in its purview .\nschedule h1 came into effect from march 1 , 2014 , and contains prescription only drugs for which a copy of the prescription has to be preserved .\nonly about half of the pharmacists were aware of schedule h and 17.5% were updated with current regulations on schedule h1 .\nsixty - five percent of the pharmacists are not aware that prescription in duplicate and stringent dispensing records have to be maintained while dispensing schedule x drugs .\nknowledge and updated drug information is a must for people involved in drug dispensing to assure the quality of dispensing .\nhowever , most of them obtain their drug information in informal ways such as industry representatives and peers .\nthus , given the gap in knowledge of pharmacists and their unawareness of current regulations , their dispensing practices may undo the beneficial effects of the health - care system .\nhowever , a drug dispensing audit at pharmacies could have avoided the bias associated with a questionnaire - based study .\nfurthermore , simple random sampling instead of convenient sampling could have been more representative of all pharmacies in bengaluru city .\nthis study revealed improper dispensing practices at pharmacies in both residential and commercial areas of bengaluru city with a high proportion of dispensing encounters without prescription , a higher rate of older prescription refills and inadequate medication counseling , and storage practices .\nit also highlights lacunae in the knowledge of pharmacists about schedule h and current regulations pertaining to scheduled drugs .\na similar scenario seems to prevail elsewhere in india and in other developing countries of the world .\nhence , structured educational campaigns , generation , and implementation of otc list , and regulatory enforcement can better equip pharmacists for their main role of promoting rational drug use .", "human": " objectives : pharmacists are one of the crucial focal points for health care in the community . \n they have tremendous outreach to the public as pharmacies are often the first - port - of - call . with the increase of ready - to - use drugs , \n the main health - related activity of a pharmacist today is to assure the quality of dispensing , a key element to promote rational medicine use.materials and methods : a cross - sectional study of 200 pharmacies , 100 each in various residential ( r ) and commercial ( c ) areas of bengaluru , was conducted using a prevalidated questionnaire administered to the chief pharmacist or the person - in - charge by the investigators.results:dispensing without prescription at pharmacies was 45% of the total dispensing encounters and significantly higher ( 2 = 15.2 , p < 0.001 , df = 1 ) in pharmacies of residential areas ( 46.64% ) as compared to commercial areas ( 43.64% ) . \n analgesics were the most commonly dispensed drugs ( 90% ) without prescription . \n only 31% insisted on dispensing full course of antibiotics prescribed and 19% checked for completeness of prescription before dispensing . \n although 97% of the pharmacies had a refrigerator , 31% of these did not have power back - up . \n only about 50% of the pharmacists were aware of schedule h.conclusion:this study shows a high proportion of dispensing encounters without prescription , a higher rate of older prescription refills , many irregularities in medication counseling and unsatisfactory storage practices . \n it also revealed that about half of the pharmacists were unaware of schedule h and majority of them about current regulations . \n hence , regulatory enforcement and educational campaigns are a prerequisite to improve dispenser 's knowledge and dispensing practices . ", "section_names": "Materials and Methods\nStatistical Analysis\nResults\nDispensing Practices\nStorage Practices\nMedication Counseling\nKnowledge\nDiscussion\nConclusion\nFinancial Support and Sponsorship\nConflicts of Interest", "bigbird_pegasus": "<s> objectives : to assess the drug dispensing practices and knowledge of pharmacists in bengaluru city.materials and methods : a cross - sectional questionnaire - based study was undertaken from august 25, 2014, to september 25, 2014, including 200 pharmacies in various residential ( r ) and commercial ( c ) areas of bengaluru.<n> two hundred and twenty - five pharmacies were screened for the study by convenient sampling.<n> a total of 200 pharmacies, 100 each in residential and commercial areas of bengaluru willing to participate were selected for the study.<n> semi - structured questionnaire was administered to the pharmacist or to the person - in - charge in case of nonavailability or absence of the chief pharmacist by the investigators.<n> data were expressed as percentages / proportions, tests of proportions were done with chi - square wherever deemed necessary, and p <unk> 0.05 was considered statistically significant.results:disregarding prescription ( 45% ) at pharmacies was the most common dispensing encounter, followed by antipyretics ( 68% ), antihistaminics ( 49% ), and antacids ( 46% ). among pharmacies located in residential areas ( 46.64% ), the higher rate of dispensing without prescription ( p <unk> 0.001 ) was seen.<n> almost all of the pharmacies ( 98% ) maintained an inventory, computerized ( 41% ), and manual ( 57% ).<n> the most of the pharmacists were not aware of look alike look alike drugs., the most of the patients. the most of the patients, the patients of the patients., the patients..., the patients........, the patients., the patients..., the patients of the patients......, the patients.., the patients of the patients of the patients were the patients of the patients of the patients....................<n> the patients of the patients of the patients of the patients of the patients of the patients of patients....<n> were the patients..<n><n>", "longt5": "<pad> background : pharmacists are one of the crucial focal points for health care in the community. they have a large outreach to the public as the number of people visiting pharmacy outlets is possibly greater than other health - care units.objectives:this study was undertaken to evaluate the drug dispensing practices at pharmacies and the knowledge of pharmacists in bengaluru.materials and methods : a cross - sectional questionnaire - based study was undertaken from august 25, 2014, to september 25, 2014, including 200 pharmacies in various residential and commercial areas of bengaluru.results:among 200 pharmacists, analgesics ( 90% ) being the most commonly dispensed drugs without prescription followed by antipyretics ( 68% ), antihistaminics ( 49% ), and antacids ( 46% ). dispensing without prescription was higher among pharmacies located in residential areas ( 46.64% ) as compared to commercial areas ( 43.64% ), which was statistically significant, = 15.2, p <unk> 0.001, and df = 1. only about 19% of the pharmacists checked for all the particulars in the prescription before dispensing the drugs. almost all of them maintained an inventory, computerized ( 41% ), and manual ( 57% ) while 2% did not. only 50.5% were aware of schedule h. about 60.5% did not know that prescription in duplicate and stringent dispensing records have to be maintained while dispensing schedule x and h1 drugs.conclusion:this study revealed improper dispensing practices at pharmacies in both residential and commercial areas of bengaluru city, a high proportion of dispensing encounters without prescription, a higher rate of older prescription refills and inadequate medication counseling, and storage practices. it also highlights lacunae in the knowledge of pharmacists about schedule h and current regulations pertaining to scheduled drugs. hence, structured educational campaigns, generation, and implementation of otc list, and regulatory enforcement can better equip pharmacists for their main role of promoting rational drug use.</s>"}
{"article": "from msm who attended the amsterdam municipal health service sti outpatient clinic in 2000 and 2001 , randomly selected stored specimens of c. trachomatis dna  positive ( as assessed by ligase chain reaction , abbott laboratories , chicago , il , usa ) rectal samples were tested for the c. trachomatis variant by real - time pcr ( 6 ) . from 2002 to 2005 , msm with symptomatic proctitis ( i.e. , purulent discharge , rectal ulceration , bleeding , or edematous mucosa ) and msm without symptoms were included . from the san francisco region , 51 lgv  positive isolates from symptomatic msm were analyzed ( 7 ) .\nthe isolates were collected in medical clinics ( e.g. , ambulatory care , emergency room , screening , acute care ) from 1979 to 1985 ( table ) .\nlgv was assessed at the time of collection , according to phenotypic properties observed during cell culture .\nalthough the growth characteristics of lgv serovars can be distinguished from serovars d  k , cell culture for c. trachomatis is no longer available in most clinical settings . * in 2002 and 2003 , 45 lgv l2b variants of 109 isolates have been described in detail ( 5 ) . c. trachomatis serovar typing was performed as described previously ( 5 ) .\nbriefly , amplification of the ompa gene ( 1.1 kb ) was performed in a nested pcr format .\nthe ompa nucleotide sequences were subsequently analyzed by automated dna sequencing on an abi 310 sequencer ( pe biosystems , foster city , ca , usa ) .\nthe sequences obtained from c. trachomatis  infected msm in 2000 and 2001 in amsterdam and from msm in san francisco were compared to the recently identified l2b variant to determine if the strain was present earlier .\nthe table presents the results of this analysis . in the amsterdam c. trachomatis dna  positive rectal samples ,\nlgv strains were detected by real - time pcr in 2 of 67 samples in 2000 and in 4 of 28 samples in 2001 .\nsequencing showed that in all 6 lgv strain  positive samples , the l2b variant was present .\nalso in 2002 and 2003 , 109 l2b - positive samples of 403 c. trachomatis dna  positive rectal samples were identified , of which 45 were strain l2b , and these have been described in a previous publication ( 5 ) .\nall 51 san francisco specimens ( from 51 patients ) were positive for lgv variants by real - time pcr . by sequencing variable segment 2 of the ompa gene ( vs-2 )\n, we identified 15 as serovar l1 , 18 as serovar l2 prototype , and 18 as the l2b variant .\nwe sequenced the complete ompa gene of 5 of these 18 l2b variants that originated in san francisco ; all were identical to the recently described l2b variant circulating in amsterdam .\nfour nucleotide changes were found when compared to reference serovars l2 , l2a , and the variant l2  , including 1 change that encoded the previously undescribed change at amino acid 162 , aatagt ( 5 ) .\nthe l2b lgv variant identified as the cause of all the lgv proctitis in the recent outbreak among msm in amsterdam appears to have been circulating in amsterdam in 2000 .\nmoreover , we showed that this l2b variant was present in the 1980s in san francisco with exactly the same mutations in the complete ompa gene .\nhowever , since we only sequenced the ompa gene , and although the sequence was identical in old and new l2b strains , we can not exclude the possibility that it could involve different strains of c. trachomatis that differ in other parts of the genome , although this is unlikely .\nsince lgv causes potentially severe infections with possibly irreversible sequelae if adequate treatment is not begun promptly , early and accurate diagnosis is essential .\nsequence - based nucleic - acid tests that can discriminate between lgv serovars and less invasive c. trachomatis species can help detect cases and prevent further transmission of lgv . in conclusion , our results suggest that we are dealing with the same lgv variant > 25 years later , and the current lgv outbreak in industrialized countries has most likely been a slowly evolving epidemic with an organism that has gone unnoticed in the community for many years and is now being detected by new technologies .\nthe numbers detected in 2005 in amsterdam suggest that a considerable reservoir exists , which emphasizes the need for ongoing public health awareness .", "human": " we traced the chlamydia trachomatis l2b variant in amsterdam and san francisco . \n all recent lymphogranuloma venereum cases in amsterdam were caused by the l2b variant . \n this variant was also present in the 1980s in san francisco . \n thus , the current \" outbreak \" is most likely a slowly evolving epidemic . ", "section_names": "The Study\nConclusions", "bigbird_pegasus": "<s> lactococcus trachomatis strain l2b, a variant first identified in 2002, is the cause of rectal ligation among men who have sex with men in amsterdam, the united states.<n> sequence analysis showed that the same variant was present in the 1980s in san francisco. early and accurate diagnosis is essential.</s>", "longt5": "<pad> we identified a new variant of c. trachomatis in amsterdam and in san francisco from 2000 to 2005 in amsterdam and in san francisco from 2002 to 2005 in amsterdam and in san francisco from 2005 to 2005.</s>"}
{"article": "descriptive investigation of a cluster of 5 sfts cases following exposure to an index patient who died from the disease was performed . a 77-year - old male farmer who died from sfts\nfive other cases in the cluster included a 32-year - old male intensive care unit ( icu ) physician ( case 1 ) , a 48-year - old male icu consultation physician ( case 2 ) , a 42-year - old younger son of the index patient ( case 3 ) , and a 45-year - old older son of the index patient ( case 4 ) , as well as a 43-year - old male mortuary beautician ( case 5 ) .\nthe investigation included a review of circumstances and medical records , specimen collection , virus isolation , real - time polymerase chain reaction for viral rna detection , and sequencing and serological tests ( capture enzyme - linked immunosorbent assay [ elisa ] for immunoglobin [ ig ] m antibody , antigen sandwich elisa for igg antibody , and microneutralization tests [ mnt ] ) .\nas for risk assessment of transmission factors , all contactors of the index patient during the period from the beginning ( 25 september 2010 ) to the end ( 8 october 2010 ) were classified through 3 types of contacts , including blood , droplet , and possible airborne contacts . the investigation was reviewed and approved by the ethics committee of china center for disease control and prevention ( cdc ) , which uses international guidelines to ensure confidentiality , anonymity , and informed consent .\nthe index patient was from an sfts - endemic region and first had onset of illness on 25 september 2010 ; was admitted to a local hospital on 28 september with a high fever of 39.5c and vomiting ; and the infection was identified through initial laboratory testing of thrombocytopenia , leukocytopenia , and elevated aspartate aminotransferase level .\nthe patient was diagnosed as a suspected sfts case , and transferred to the intensive care unit the next day , where he received ribavirin , dexamethasone , omeprazole , and cryoprecipitation for therapy . on 2 october 2010 ,\nhis condition deteriorated with hypersomnia , shortness of breath , and mouth mucosal bleeding . on 3 october\n, he appeared confused and showed dyspnea , then was intubated and mechanical ventilated . on 4 october ,\nthe patient was in shock and comatose , developed disseminated intravascular coagulation and multiple organ dysfunction syndrome , and died the next day .\nan important observation was that the index patient had unique hemorrhagic symptoms , including bleeding from mouth mucosa , gastrointestinal lumen , and lungs , which was rare in previously identified sfts patients .\nthe patient s fever remained high ( 39c40c ) until death , although lowered somewhat by giving dexamethasone .\nclinical laboratory values ( table 1 ) showed unusually high level of tissue enzymes , blood urea nitrogen , and creatinine , which might indicate impaired liver , heart , and kidney functions .\nconsistent with the largely reduced platelet count , the index patient had a significantly elongated activated partial thromboplastin time , which represented a largely impaired coagulation function .\nimmediately after death , the corpse was transferred to the patient s home in a local village for a funeral ceremony , then transferred to a crematorium 3 days later .\nlaboratory analysis of a cluster of severe fever with thrombocytopenia syndrome patients in china alt , alanine aminotransferase ; ast , aspartate aminotransferase ; ldh , lactate dehydrogenase ; aptt , activated partial thromboplastin time .\n , negative ; + , weak positive ; + + + , strong positive .\nviral rna copies were calculated according to standard reaction curves , which were established using serially diluted in vitro rna transcripts as standard samples .\nvirus load was determined based on an average conversion coefficient between virus copies and virus titer presented as 50% tissue culture infective dose ( tcid50/ml ) .\nserum samples collected in the acute phase were subjected to immunoglobin ( ig ) m detection with igm antibody capture enzyme - linked immunosorbent assay ( elisa ) , with horseradish peroxidase  conjugated recombinant severe fever with thrombocytopenia syndrome bunyavirus ( sftsv ) nucleoprotein as the detection agent .\nserum samples collected in the convalescent phase were subjected to igg detection with sandwich elisa by using recombinant sftsv nucleoprotein as the detection agent .\nvalues for igm antibodies , igg antibodies , and mnt are the reciprocals of the serum dilution .\nrisk factors were assessed using logistic regression analysis ; p  <  .05 was considered to be statistically different .\nepidemiologic investigations began with interviews with 5 secondary sfts patients and 58 other individuals who had exposure to the index patient from onset of the illness until cremation .\nwe found that all 5 secondary cases had possible blood contact through skin or mucosa .\ncase 1 , the local icu doctor , performed the intubation for the index patient , resuscitating the patient before his death .\ncase 2 , the consultant doctor , traveled from a nonendemic area to the local hospital for a medical consult with the patient , and the patient s blood dropped on his hand when he was helping an icu nurse draw blood without wearing gloves .\ncase 3 , the younger son of the index patient , was a long - distance truck driver not living in the same village , and directly touched the blood flowing from the deceased patient s mouth and nose when he cried on the corpse .\ncase 4 , the older son of the index patient , was also a long - distance truck driver , and took care of the dead body and was wiping off the blood from the face of the corpse .\ncase 5 , a local mortuary beautician , did the make - up for the corpse with gloves and mask , but took them off twice during the procedure . the above 5 cases all developed the disease 715 days after exposure , with only 3 of them having contact with blood after death . in comparison with the index patient\n, all 5 secondary cases had minor clinical features ( table 1 ) , without obvious hemorrhagic manifestations , so they did not receive dexamethasone therapy . except for the major risk factor of blood contact , droplet contact ( n  =  4 ) , which included 3 medical staff who were involved in the intubation and the index patient s daughter who cared for him before death ,\nin addition , the risk factor of possible airborne transmission ( being in the icu room or funeral room without mask protection ) was also assessed among all 63 exposed individuals . of them , the medical doctors and nurses ( n  =  16 ) were with protection ; and the others were without ( n  =  47 ) , including icu patients who were staying in the same room ( n  =  8) , family members (\nn  =  3 ) , and visitors to the funeral room where the corpse was kept ( n  =  35 ) .\nthe multivariate analysis ( logistic regression analysis ) showed that blood contact was the most likely mode of transmission ( p  <  .001 ; table 1 ) .\nit is noticeable that the serum collected from the index patient on the day he died contained a relatively high amount of sftsv , which reached about 3.55    10 viral rna copies / ml ( calculated as 9.67    10 50% tissue culture infective dose [ tcid50]/ml ) .\nthis number was about 100  000-fold higher than viral copies detected in the serum samples of the 5 secondary patients , which ranged from 10 to 10 copies / ml ( table 1 ) .\nall 5 patients had virus - specific igm antibodies in the acute phase , and elevated virus - specific immunoglobin g ( igg ) antibodies in the convalescent phase . the index patient , however , had minimal or undetectable levels of virus specific igm antibodies on day 11 after onset of fever ( table 1 ) . compared with the entire genomic sequence of the virus strain isolated from the index patient ,\ncases 2 and 3 were nearly 100% identical , and provided genetic evidence for the epidemic findings on the possible transmission of sftsv from the index patient to secondary patients .\nhere , we reported the person - to - person transmission of sftsv with a cluster of 6 sfts patients that occurred in shandong province of eastern china .\ninvestigation studies revealed that all 5 secondary infected patients had possible contact with the index patient s blood .\nof them , only case 1 ( icu doctor ) had evidence of droplet contact contamination ( during intubation ) but not blood contact , but we included him also as a blood contactor because he performed intubation without protective face shield and goggles , therefore he had an extremely high risk of blood contact through unprotected skin and mucosa .\nthe risk assessment revealed that blood contact was the major risk factor for the human - to - human transmission of sftsv .\nadditionally , 3 secondary patients who only had contact with the index patient after death were still infected , which indicated that sftsv - infected blood may remain infectious for a long time , even after patient death .\nit is notable that the level of virus copies in the index patient s serum was extremely high , but with no detectable igm or igg antibodies , which suggested that his immune responses to limit the replication of sftsv were severely impaired .\nthe patient had no immune system disease , thus the minimal immune responses might be due to the early and sustained application of glucocorticoid , which has a side effect of repressing immune functions ; clinical physicians should take note of this finding .\nclinically , sfts is easily confused with hemorrhagic fever with renal syndrome caused by hantavirus   and human anaplasmosis .\nthe hantavirus - specific igm antibodies were not detected in the sfts patients serum samples ( data not show ) . due to the limitation of our study , we were not able to detect rickettsia infection , which was previously reported in outbreaks of nosocomial infections\n. however , the methods we used for diagnosis of sfts patients were well validated , and the human - to - human transmission of sftsv we described in this study could not simply be classified as being nosocomial transmission ; specially , 3 of the 5 secondary cases that occurred in the household .\nadditionally , the lessons of person - to - person transmission of sftsv we learned from this study highlighted the necessity of establishing standard precautions for avoiding direct contact and blood - based transmission .\nthis work was supported by the china mega - project for infectious diseases ( 2008zx10004 - 001 , 2009zx10004 ) from the ministry of science and technology and ministry of health of the people s republic of china .\nconflicts that the editors consider relevant to the content of the manuscript have been disclosed .", "human": " severe fever with thrombocytopenia syndrome bunyavirus is a newly discovered bunyavirus with high pathogenicity to human . \n the transmission model has been largely uncharacterized . \n investigation on a cluster of severe fever with thrombocytopenia syndrome cases provided evidence of person - to - person transmission through blood contact to the index patient with high serum virus load . ", "section_names": "METHODS\nRESULTS\nDISCUSSION\nFinancial support.\nPotential conflicts of interest.", "bigbird_pegasus": "<s> to investigate severe fever with thrombocytopenia syndrome ( sfts ), we investigated a cluster of 5 sfts cases following exposure to an index patient who died from the disease.<n> the investigation showed that person - to - person transmission of sfts virus was likely through blood contact.</s>", "longt5": "<pad> we investigated the person - to - person transmission of severe fever with thrombocytopenia syndrome bunyavirus ( sftsv ) in a cluster of 6 patients in shandong province of eastern china. all 5 secondary patients had possible blood contact through skin or mucosa. blood contact was the major risk factor for human - to - human transmission of sftsv.</s>"}
{"article": "six a17 bac and one fosmid library were used to create mt3.5 ( table s1 ) .\nmost were processed by sanger paired - end sequencing of 3 - 6 kb shotgun libraries .\nsequences were downloaded in february / march 2009 with scaffolding performed by aligning all bac and fosmid ends against contigs and then anchored and ordered primarily by optical mapping .\nseparately , 25 gb of illumina sequence was generated using short ( 375 nt ) inserts plus 2.1 gb from a 5 kb mate - pair library , then assembled using clcbio ( www.clcbio.com ) and soap ( http://soap.genomics.org.cn/ ) .\nfive tissues were used for rna - seq analysis with ~10 million illumina 36 bp reads per library ( table s12 ) .\nthree tissues were used for small rna analysis with ~3 million reads per illumina library ( figures s17-s18 , table s16 , datafile s9 ) .\nsix a17 bac and one fosmid library were used to create mt3.5 ( table s1 ) .\nmost were processed by sanger paired - end sequencing of 3 - 6 kb shotgun libraries .\nsequences were downloaded in february / march 2009 with scaffolding performed by aligning all bac and fosmid ends against contigs and then anchored and ordered primarily by optical mapping .\nseparately , 25 gb of illumina sequence was generated using short ( 375 nt ) inserts plus 2.1 gb from a 5 kb mate - pair library , then assembled using clcbio ( www.clcbio.com ) and soap ( http://soap.genomics.org.cn/ ) .\nfive tissues were used for rna - seq analysis with ~10 million illumina 36 bp reads per library ( table s12 ) .\nthree tissues were used for small rna analysis with ~3 million reads per illumina library ( figures s17-s18 , table s16 , datafile s9 ) .", "human": " legumes ( fabaceae or leguminosae ) are unique among cultivated plants for their ability to carry out endosymbiotic nitrogen fixation with rhizobial bacteria , a process that takes place in a specialized structure known as the nodule . \n legumes belong to one of the two main groups of eurosids , the fabidae , which includes most species capable of endosymbiotic nitrogen fixation 1 . \n legumes comprise several evolutionary lineages derived from a common ancestor 60 million years ago ( mya ) . \n papilionoids are the largest clade , dating nearly to the origin of legumes and containing most cultivated species 2 . \n medicago truncatula ( mt ) is a long - established model for the study of legume biology . \n here we describe the draft sequence of the mt euchromatin based on a recently completed bac - assembly supplemented with illumina - shotgun sequence , together capturing ~94% of all mt genes . a whole - genome duplication ( wgd ) \n approximately 58 mya played a major role in shaping the mt genome and thereby contributed to the evolution of endosymbiotic nitrogen fixation . \n subsequent to the wgd , the mt genome experienced higher levels of rearrangement than two other sequenced legumes , glycine max ( gm ) and lotus japonicus ( lj ) . \n mt is a close relative of alfalfa ( m. sativa ) , a widely cultivated crop with limited genomics tools and complex autotetraploid genetics . as such \n , the mt genome sequence provides significant opportunities to expand alfalfa s genomic toolbox . ", "section_names": "METHODS SUMMARY\nDNA sequencing\nRNA sequencing\nSupplementary Material", "bigbird_pegasus": "<s> micrornas ( mirnas ) are small rnas that post - transcriptionally regulate gene expression at the post - transcriptional level1 - 3. here, we report the development of a small rna - sequencing platform called mt3.5 ( mt = microrna target ; http://mt3.5.org ), capable of delivering high - content rna sequences directly to the genome of individual cells.<n> mt3.5 was applied to the transcriptome of saccharomyces cerevisiae and revealed unexpected features of the mirna machinery.<n> small rna - sequencing data from mt3.5 - enriched tissues were used to identify new mirna targets.<n> we also present candidate mirna targets that have not yet been identified in other species.<n> our results demonstrate that mt3.5 is a robust tool for the analysis of mirna targets in eukaryotes.</s>", "longt5": "<pad> rna - seq is an important tool for understanding the molecular basis of rna - seq sequencing in tissues. however, it is not well understood whether the rna - seq data are deposited in the gene expression omnibus ( geo ) under accession number gse6577. here, we present a method for rna - seq analysis of rna - seq data from a17 bac and a fosmid libraries. we show that rna - seq is a useful tool for rna - seq analysis of rna - seq data.</s>"}
{"article": "stainless steel alloys have remained the material of choice despite the emergence of the more recent titanium , composite and polycarbonate orthodontic brackets .\nstainless steel alloy contains 8%-12% nickel , 17%-22% chromium and other elements such as copper , iron molybdenum , manganese , silicon and sulfur[3 - 5 ] in the oral environment , orthodontic brackets are subjected to mechanical and chemical damaging which results in susceptibility to corrosion .\ncorrosion leads to loss of substance from the material , change in its structural characteristics , or loss of structural integrity . due to the electrolytic capabilities of saliva\nvarious types of brackets are commercially available and each demonstrates a unique pattern of corrosion . in soldered brackets ,\nthis corrosion is due to the presence of dissimilar metals ( i.e. the silver solder and the stainless steel ) , a phenomenon termed galvanic corrosion .\nmetal injection molding ( mim ) brackets are manufactured as a single unit and therefore do not demonstrate galvanic corrosion .\ncorrosion can have detrimental effects on the surface of stainless steel brackets due to the continuous loss of metal ions .\ncorrosion can increase the surface roughness of the bracket which leads to elevated friction forces between the bracket and the archwire .\nthis increase in friction results in unfavorable distribution of forces and reduces the effectiveness of archwire guided orthodontic tooth movement.[7 - 8 ] moreover , by means of increased stress , the friction would further accelerate the corrosion process .\nthe release of metal ions following the corrosion of brackets has concerned clinicians and has instigated research in this field . among these metal ions ,\nfurthermore , direct and prolonged contact of orthodontic appliances and the resulting corrosion products have been shown to cause local pain and swelling in the adjacent tissues .\nedema , gingivitis , gingival hyperplasia , perioral stomatitis , dna instability and altered cellular metabolism are among other reported side effects .\ncorrosion also has detrimental effects on the teeth , and permanent staining around the bracket base has been reported .\ndue to the wide diversity of options regarding bracket selection , orthodontists look for brackets which possess satisfactory biomechanical properties while presenting with a reasonable price .\nit was mentioned that corrosion has a detrimental effect on the physical properties of brackets and causes unwanted biological side effects ; therefore , brackets with minimal corrosion tendencies are more desirable . the present study aimed to investigate five different brands of stainless steel brackets and compare their tendency towards corrosion by measuring ion release in an in - vitro setting . \n\nfive different brackets ( dentaurum , 3 m , ortho organizer , cobas and o.r.g ) were selected based on their popularity among faculty members of the orthodontic department .\n( table 1 ) ten central incisor brackets were selected from each brand . in order to simulate conventional orthodontic treatment , 8 mm of 0.016  stainless steel archwire ( dentaurum , germany )\nwas tied in each bracket using 10 mm of 0.25 mm ligature wire ( dentaurum , germany ) .\nonce the brackets were prepared , they were placed in poly - ethylene capped vials containing 10 ml of artificial saliva at a ph of 7.2 .\nthe vials were incubated at 37c for 6 weeks and then they were subjected to thermocycling with 500 temperature cycles from 5c to 55c to simulate the effect of temperature changes in the oral cavity .\nthe brackets were immersed in each bath for 30 seconds with 2 seconds at air temperature in - between the immersions . \n \nthe details of the brackets selected for the study \n  after thermal - cycling the solutions from the vials were analyzed to determine the amount of nickel , chromium , manganese , and iron using an inductively coupled plasma ( icp ) spectrometer ( icp - oes ; varian , vista - pro model , mulgrave , victoria , australia ; 1400w applied power ) . for the purpose of analysis , the icp device had to be calibrated for each of the metal ions .\ncalibration was performed using standard stock solutions ( 100 mg / ml ) prepared by dissolving nitrate salts of the aforementioned ions in distilled deionized water .\nthe standard stock solutions were then diluted to render the concentrations necessary ( 0.1- 10 mg / ml ) . once the icp device was calibrated and a standard calibration curve obtained , the samples were analyzed and the readings were recorded . before each reading a drop of 65% nitric acid\nthe addition of nitric acid facilitates the stabilization of the released ions by producing nitrate salts .\na vial containing only the artificial saliva was used as the device blank so that the ions present in the saliva itself do not compromise the readings . \n \nstatistical analyses were performed using spss software for windows ( version 11 ; spss inc , chicago , iii ) .\nthe kruskal - wallis test was used to analyze the differences among mean ion concentrations in the 5 groups .\nthe median levels of ion release were measured for chromium , iron , manganese and nickel using an icp device ( figure 1 ) .\nthe overall amount of ion release was greatest in the cobas bracket , while ortho organizer and org brackets demonstrated minimal corrosion . \n \nion release from brackets made by 5 different manufacturers measured in milligram per liters ( mg / l ) \n  the level of chromium release was highest in the cobas bracket followed by 3 m , dentaurum , org and ortho organizer .\nit should be noted that the difference between cobas and 3 m was statistically insignificant ( p > 0.05 ) as was the difference between org and ortho organizer ( p > 0.05 ) .\niron release presented the same order that was observed for chromium ; however , the levels were generally higher for iron especially in the cobas bracket . \n  considering manganese , it can be observed that the levels are higher in 3 m followed by cobas , dentaurum , org and ortho organizer .\nthe differences between all brackets except dentaurum and org were statistically significant ( p < 0.05 ) .\nnickel release however was more pronounced in cobas followed by 3 m , org , ortho organizer and dentaurum . \n \nonly the cobas bracket demonstrated statistically significant differences with the other brackets ( p > 0.05 ) . from the ions that were analyzed ,\niron was released the most , followed by nickel , manganese and chromium ( figure 2 ) .   a : total iron release , rendered by adding the median values for the analyzed brackets .\nb : percentage of total ion release attributed to each bracket if we consider looking at the brackets separately , iron release was found to be greater than the other ions in every bracket .\ndue to the importance of the biocompatibility of orthodontic armamentaria , in the present study we chose five popular brackets among orthodontists and determined their susceptibility to corrosion by measuring ion release in anin - vitro environment .\nthe brackets and wires in this study were all manufactured from 18 - 8 stainless steel ( 18% chromium , 8% nickel ) . based on the results of this study , we found that except for manganese , the cobas bracket had the highest level of ion release .\nfurthermore , we observed that among the studied brackets , iron was released more than the other ions .\nand in contrast with the findings of huang et al . in which nickel release was more profound .\nmoreover the amount of ion release in our samples was higher compared to similar studies.[3,16 - 17 ] this difference in ion release may be due to the fact that we chose to tie a segment of archwire to the bracket to better simulate conventional orthodontic treatment .\nfirst , by increasing the amount of alloy available to be subjected to corrosion and second , the potential for galvanic corrosion increases since the alloy for the archwire is different from the alloy used in the bracket .\nanother reason for greater levels of ion release may be due to the technique used for detection of ions .\nthe values obtained in the present study closely match the values presented by kuhta et al . who elected to use an icp device for ion detection . \n \nthe results of the present study indicated that soldered brackets do not necessarily demonstrate less resistance to corrosion when compared to brackets made by metal injection molding ( mim ) .\nwhen the org ( soldered ) and the dentaurum ( mim ) bracket are compared we observed that , except for iron which was released more by the dentaurum bracket , the other ions were not significantly different . while it has been argued that soldered brackets present a tendency towards galvanic corrosion , mim brackets have increased porosity rendering them susceptible to another kind of chemical breakdown , termed pitting corrosion .\nthis may be the reason why similar studies also found no measurable advantage regarding the utilization of mim brackets .\nthe presence of an archwire may be a confounding factor which may induce galvanic corrosion to mim brackets that cancels out any possible differences . \n \nthe results of the present study indicated that iron was released more than the other ions , followed by nickel .\nwhile this was the overall pattern , in the 3 m bracket , it was observed that manganese was released more than nickel .\nthis finding is in contrast to the findings of karnam et al . who reported that nickel was the major ion released from orthodontic brackets .\nthe findings of this study also suggest that there were no statistically significant differences between the 3 m and dentaurum brackets in any of the ions studied .\nthese differences could be due to study design , addition of an archwire element , testing conditions and measurement methods .\nit is noteworthy that in the present study , an icp - ms was used to measure the released ions .\nicp - ms has shown lower detection limit compared to atomic absorption spectrometry used in similar studies .\nanother advantage of the icp device over atomic absorption is that it can measure several ions simultaneously without interference from other ions .\nthis study in agreement with previous findings declares that the values of ions released from orthodontic brackets falls short of the permissible daily doses determined by the world health organization .\nthe maximum tolerable dose of nickel , iron , manganese and chromium for a 60-kg individual is 1.2 , 15 , 10 and 50 - 200 mg / day , respectively .\nhowever the chronic nature of metallic exposure resulting from orthodontic treatment is a cause for concern .\nit has been reported that chronic exposure to metal ions can cause alterations in cell morphology and metabolism leading to inflammation and dna instability.[21 - 26 ] iron ions in particular have been demonstrated to cause mitochondrial dysfunction in cells with active mitochondrial activity .\nthey have also been linked with lysosome instability which could result in cell death and apoptosis . regarding irreversible damage to oral tissues resulting from orthodontic treatment however ,\nhafez et al . concluded that 6 months after the removal of the orthodontic appliance , no difference was observed between the orthodontic patients and the controls . \n \nthe findings of this study are based on an in - vitro experimental design , and therefore suffer from the inadequacies related to the simulation of the in - vivo environment .\na bracket in the oral environment is subjected to many kinds of chemico - thermal insults including rapid changes in ph , the intake of hot and cold beverages and mechanical challenges . while in many senses\nthe in - vitro design is a drawback , in measuring ion release such a setup is rather useful .\nnot all of the ions released from orthodontic brackets are found in the oral fluids .\nsome of the ions are absorbed into the oral and gingival tissues , while others are ingested and could disperse into distant organs .\nthe advantage of the in - vitro design is that it presents the total ions released from the bracket , which could better show the true effect of this phenomenon .\nanother drawback to this study is that we did not evaluate the effects of different wire - bracket combinations and only used a single wire for all of the brackets .\nbased on the findings of the present study , regarding ion release levels , the org and ortho organizer brackets were superior while dentaurum and 3 m did not demonstrate any significant differences . \n", "human": " statement of the problem : stainless steel brackets release metallic ions following the process of corrosion in the oral environment . \n these released ions have potential adverse effects on health , friction between wire and bracket , staining , strength of brackets . choosing a bracket with favorable corrosive properties ; therefore , should be a goal of every practitioner . \n \n purpose : the goal of this study is to compare the amount of corrosion among five different brands of brackets using inductively coupled plasma ( icp ) mass spectrometry . \n materials and method : five different brands of brackets ( dentaurum , 3 m , ortho organizer , cobas and o.r.g ) were chosen and ten brackets were selected from each brand . \n a piece of stainless steel wire was ligated to each bracket . \n the bracket - archwire complex was then immersed in artificial saliva . \n subsequently , the samples were analyzed using an icp device and the levels of iron , chromium , nickel , and manganese ions were measured . \n \n results : the findings of this study demonstrated that iron was released the most from the tested brackets , followed by nickel . \n we also found that the cobas bracket had the most ion release among the tested brackets ( p < 0.05 ) , while ortho organizer and org performed favorably . \n there was no significant difference between dentaurum and 3 m ( p > 0.05 ) . \n \n conclusion : based on the results , ortho organizer and org brackets are suggested in terms of resistance to corrosion . \n ", "section_names": "Introduction\nMaterials and Method\nResults\nDiscussion\nConclusion", "bigbird_pegasus": "<s> statement of the problem : due to the electrolytic capabilities of saliva various types of brackets are commercially available and each demonstrates a unique pattern of corrosion. the release of metal ions following the corrosion of brackets has concerned clinicians and has instigated research in this field.<n> purpose : the present study aimed to investigate five different brands of stainless steel brackets and compare their tendency towards corrosion by measuring ion release in an in - vitro setting.<n> materials and method : five different brackets ( dentaurum, 3 m, ortho organizer, cobas and o.r.g ) were selected based on their popularity among faculty members of the orthodontic department.<n> ten central incisor brackets were selected from each brand. in order to simulate conventional orthodontic treatment,<n> 8 mm of 0.016 stainless steel archwire was tied in each bracket using 10 mm of 0.25 mm wire ( dentaurum, germany ). in order to measure ion release,<n> an inductively coupled plasma spectrometer ( icp - oes ; varian, vista - pro model, mulgrave, victoria, australia ) was used.<n> data was analyzed using the kruskal - wallis test.<n> results : the overall amount of ion release was greater in the cobas followed by 3 m, org, ortho organizer and ortho organizer and dentaurum.<n> the org and dentaurum ( dentaurum ( dentaurum, org, org, org and ortho organizer and ortho organizer.<n> the amount of the amount of total iron.<n> the amount of the ion.<n>, the amount of, the amount of the.<n>.<n>.<n>.<n>.<n>.<n>.<n>.........<n>...<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>....<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.", "longt5": "<pad> objective : the aim of this study was to investigate five different brands of stainless steel brackets and compare their tendency towards corrosion by measuring ion release in an in - vitro setting.materials and methods : five different brands of stainless steel brackets ( dentaurum, 3 m, ortho organizer, cobas and o.r.g ) were selected based on their popularity among faculty members of the orthodontic department. in order to simulate conventional orthodontic treatment, 8 mm of 0.016 stainless steel archwire was tied in each bracket using 10 mm of 0.25 mm ligature wire. then the brackets were placed in poly - ethylene capped vials containing 10 ml of artificial saliva at a ph of 7.2. the vials were incubated at 37c for 6 weeks and then they were subjected to thermocycling with 500 temperature cycles from 5c to 55c to simulate the effect of temperature changes in the oral cavity. the solutions from the vials were analyzed to determine the amount of nickel, chromium, manganese and iron using an inductively coupled plasma ( icp ) spectrometer.results:the overall amount of ion release was greatest in the cobas bracket, while ortho organizer and org brackets demonstrated minimal corrosion. iron release presented the same order that was observed for chromium ; however, the levels were generally higher for iron especially in the cobas bracket. manganese was found to be higher in 3 m followed by cobas, dentaurum, org and ortho organizer. iron release was found to be greater than the other ions in every bracket.conclusion:according to the findings of the present study, regarding ion release levels, the org and ortho organizer brackets were superior while dentaurum and 3 m did not demonstrate any significant differences.</s>"}
{"article": "one of the common predicaments experienced by patients undergoing tooth preparation and cementation on vital tooth for crown and bridge restorations is dentinal hypersensitivity.1 the phenomenon of dentinal hypersensitivity is best explained by brannstroms hydrodynamic theory , which states that  when exposed , dentinal tubules are stimulated by changes in temperature or osmotic pressure resulting in displacement of tubular fluid .\nthis fluid movement is conveyed to the nerve fibers in the pulp , causing stimulation that is interpreted as pain or hypersensitivity .\n vital teeth that are prepared for restorations are at a risk of developing hypersensitivity because a large number of tubules are exposed during the tooth preparation . when teeth are prepared for complete crowns , approximately 1.2 - 1.5 mm of tooth structure is removed to ensure appropriate crown contours and adequate occlusal clearance.2 richardson et al . reported that approximately 1 - 2 million\ndentinal tubules are exposed during an average tooth preparation for a posterior crown.3 desiccation and frictional heat generated by the preparation also increases the chances of hypersensitivity.4 during the procedure of crown cementation , the cement is forced into the patent dentinal tubules before the luting agent sets , and displaces an equal amount of dentinal fluid , thus leading to excessive hydrostatic pressure and resultant irritation of pulpal tissues.1,5 the smear layer evident after tooth preparation was demonstrated to be ineffective against luting agent irritation . before cementation of the final prosthesis dentin can still become sensitive as a result of microleakage of the temporary restoration and the resultant formation of bacterial byproducts.6 oxalates , resin bonding agents , and formulations containing sodium fluoride or potassium ions have been documented to have desensitizing property by blocking the dentinal tubules.7 however , the effects of these agents are limited , and the hypersensitivity can recur in the future.8 tooth sensitivity after cementation of crowns , therefore , is a pertinent issue .\nthe use of low power low potency desensitizing laser treatment before cementation of crowns has shown to occlude exposed dentinal tubules and relieve the hypersensitivity for longer periods than any other desensitizing agents , and this procedure is growing in popularity the world over.9 it has been proved by sipahi et al .\nthat application of low - power low - potency desensitizing laser treatment has an effect on the tensile bond strength of full veneer crowns luted with glass - ionomer cement.10 however , the effect of laser desensitizing treatment on the crown retention , when resin cements are used , has not been documented .\nthis is of importance , because of the growing popularity of these cements due to their better physical and mechanical properties.11 the purpose of this study therefore was to assess , evaluate and compare the effect of desensitizing laser treatment on the bond strength of self - adhesive resin cement to glass - ionomer luting cement .\nthe teeth were mounted into a metal jig filled with softened impression compound with the aid of a surveyor , so as to enable the specimen to be mounted parallel to its long axis .\ntooth preparation of all the samples is planned . for bringing about standardization in the tooth preparation\n, it was mandatory for all the specimens to have a uniform taper , uniform length , and width . in order , to obtain uniform taper for the preparation a specially designed clamp\nwas fabricated , which was able to secure a high - speed air - rotor hand - piece to the surveyor .\nthe metal jig with the mounted tooth specimens were secured to the surveying table maintaining parallelism to the floor prior to starting the preparation .\na round end tapered diamond bur was used to prepare the occlusal surface of the premolars , to a depth of 1 mm below the central groove ( figure 1 ) . the axial reduction of teeth done up to a uniform depth of 1.5 mm with the help of depth - cut diamond bur and tapered chamfer bur . crown preparation using surveyor .\nthe surface area of the preparations thus obtained was calculated using a formula for truncated cone,12 which is described below : truncated cone area ac = 3.141  l ( r1 + r2 ) mm flat surface area a0 = 3.141  r2 mm surface area of preparation at = ac + a0 mm ac - area of axial surface a0 - area of occlusal ( flat ) surface at - total surface area l - length of the prepared surface , the axial surface r1 - radius of the base of the prepared tooth , i.e. at cervical region r2 - radius of the prepared tooth at the occlusal end only the samples with closely matching surface area were selected .\nthe 48 specimens thus selected were then randomly distributed into different groups as follows ( figure 2 ) .\nimpressions of all the 48 prepared samples were made on a special tray using putty wash impression technique using polyvinyl siloxane impression material .\nthe impressions were then poured in type iv stone to obtain the master cast following the impression procedure the specimens were stored in isotonic saline .\na loop of approximately 5 mm diameter was then attached onto the occlusal surfaces of the patterns using 0.8 mm thick sprue wax .\nthis loop in the cast metal crown was to engage a hook during the retention testing on the universal testing machine .\nthe wax pattern and dies were then assigned numbers corresponding to the respective prepared specimens so that each of the casting can be identified to its respective receptor tooth .\nfollowing casting and sandblasting ( figure 3 ) the sprues were cut , and each casting trimmed , finished , and examined under magnification for any internal surface irregularities .\nprior to cementation of the full veneer metal crowns , the prepared tooth surfaces of the 24 teeth samples , grouped for laser treatment were treated with erbium , chromium : yttrium , selenium , galium , garnet ( er , cr : ysgg ) laser at 0.5 w potency for 15 s without air or water spray ( figure 4 ) . after laser application , some of the samples were examined under environmental scanning electron microscopy ( e - sem ) for dentinal tubule obliteration ( figure 5 ) . environmental scanning electron microscopy .\nthe cementation of the crowns was done according to the manufacturer 's instructions and was performed by a single operator to prevent interoperator variation .\none hour following the cementation procedure , all the samples were stored in an isotonic saline solution for 24 h prior to testing .\nthe retention testing of all the samples was performed on the instron automated universal testing machine .\nimpressions of all the 48 prepared samples were made on a special tray using putty wash impression technique using polyvinyl siloxane impression material .\nthe impressions were then poured in type iv stone to obtain the master cast following the impression procedure the specimens were stored in isotonic saline .\na loop of approximately 5 mm diameter was then attached onto the occlusal surfaces of the patterns using 0.8 mm thick sprue wax .\nthis loop in the cast metal crown was to engage a hook during the retention testing on the universal testing machine .\nthe wax pattern and dies were then assigned numbers corresponding to the respective prepared specimens so that each of the casting can be identified to its respective receptor tooth .\nthe patterns were sprued , invested and casting done using nickel - chromium alloy . following casting and sandblasting ( figure 3 )\nthe sprues were cut , and each casting trimmed , finished , and examined under magnification for any internal surface irregularities .\nprior to cementation of the full veneer metal crowns , the prepared tooth surfaces of the 24 teeth samples , grouped for laser treatment were treated with erbium , chromium : yttrium , selenium , galium , garnet ( er , cr : ysgg ) laser at 0.5 w potency for 15 s without air or water spray ( figure 4 ) .\nafter laser application , some of the samples were examined under environmental scanning electron microscopy ( e - sem ) for dentinal tubule obliteration ( figure 5 ) . environmental scanning electron microscopy .\nthe cementation of the crowns was done according to the manufacturer 's instructions and was performed by a single operator to prevent interoperator variation .\none hour following the cementation procedure , all the samples were stored in an isotonic saline solution for 24 h prior to testing .\nthe retention testing of all the samples was performed on the instron automated universal testing machine .\nthe samples after storage in isotonic saline solution for 24 h , the tensile bond strength of each specimen in the study were tested in a universal testing machine .\nstatistical analysis was done with the help of descriptive statistics , independent samples t - test and two - way anova analysis using spss ( version 16.0 ) and minitab software 's ( version 11.0 ) for windows ( tables 1 - 3 , graph 1 ) .\nmean tensile bond strength values for glass - ionomer luting cement on specimens with and without laser application .\nmean tensile bond strength values for self - adhesive resin luting cement on specimens with and without laser application .\nresults of the 2-way anova analysis for the mean tensile bond strength of control and experimental groups with glass ionomer and self - adhesive resin cement .\nresults of the 2-way anova analysis for mean tensile bond strength of control and experimental groups with glass ionomer and self - adhesive resin luting cements .\ndentinal hypersensitivity is an age old complaint experienced by patients during the cementation of crown and bridge restorations on vital abutment teeth.1 brannstrom in his hydrodynamic theory had stated that , when dentinal tubules are exposed in vital teeth they are stimulated by changes in the temperature or osmotic pressure resulting in displacement of tubular fluid .\nthis fluid movement is conveyed to the nerve fibers in the pulp , causing stimulation that is interpreted as pain or hypersensitivity .\nthe cements used during the luting of the prosthesis bring about these stimuli , resulting in postcementation hypersensitivity.1,5,13 many a tried and tested methods are currently available as dentine desensitizing agents , among which oxalates , resin bonding agents and formulations containing sodium fluoride or potassium fluoride are more commonly used.7 however , the effects of these agents are temporary leading to recurrence.8 with the advent of lasers into dentistry , desensitizing laser treatment has gained in popularity as an effective means to counter dentinal hypersensitivity .\nthe use of lasers for treating dentinal hypersensitivity was first attempted by harper et al . in 1992.14  the precise mechanism of ablation of hard tissues with the er , cr : ysgg laser remains unclear .\none of the theories put forward suggests that when the laser interacts with the dentinal tissue it is absorbed by the water and hydroxyapatite .\nthis expansion during the change of state of water causes cracking of the dentinal tissue .\nas the steam expands , it also forces the cracked material away from the ablation zone .\nsince this reaction happens at a rapid pace , it is explosive in nature , and hence it is termed  microexplosion.9 as a result of this micro explosion , dentinal debris similar to a smear layer forms on the surface of the dentin , there by blocking the exposed dentinal tubules .\nlaser application also lead to decrease in diameter , and size of the dentinal tubules by shrinking it.15 an e - sem study done to understand the tubule - occluding effect of desensitizing laser treatment on prepared dentin surfaces by sipahi et al . observed that the application of desensitizing laser at 0.5 w potency without air and water can be done to reduce hypersensitivity of prepared abutment teeth in prosthodontics.9 according to this study , desensitizing laser application causes blockage and reduction in the size of patent dentinal tubules by deposition of dentinal debris created by micro explosion .\nthese observations can raise queries regarding the effect of desensitizing laser application on the bond strength of commonly used luting cements , viz : glass - ionomer and resin cements to treated dentin .\nhave also observed that the tensile bond strength of glass - ionomer luting cement to the abutment tooth decreased by 15% after laser application.10 however , there are not many studies currently available on the bond strength of self - adhesive resin cements to desensitizing laser treated teeth .\nit is imperative to understand the bond strength of self - adhesive resin cement to laser irradiated teeth , as these cements are gaining in popularity as a luting agent due to their improved mechanical and physical properties.11 this study therefore was done to assess and compare the tensile bond strength of crowns luted with glass - ionomer and resin cements to laser irradiated prepared abutment tooth , and control group . within the limitations of this study\n, it was found that laser treatment on dentine appreciably decreased the tensile bond strength of crowns luted with glass - ionomer cements .\nhowever , the bond strength of self - adhesive resin cement remained unaffected with a marginal increase in strength , it was not statistically significant .\nthe results of the present study with glass - ionomer cement are concurrent with the findings of a previous study by sipahi et al.10 the mechanism of adhesion of glass - ionomer cement to dentinal surface is through an ionic bond between negatively charged polyacid chains of the ionomer matrix and the positively charged calcium on the tooth surface.16 these polyacids also form hydrogen bonds and undergo ion exchange in the collagen and the inorganic components of the tooth structure , particularly to calcium , carboxylate and phosphate ions of the tooth surface.17 the formation of dentinal debris formed during laser application as observed in sem picture in this study probably would have interfered with the above mentioned chemical bondage of glass - ionomer cement with the exposed dentinal surface leading to loss of bond strength .\nthe desiccation of collagen fibrils due to laser application may also be another reason , leading to decreased bond strength due to the weak hydrogen bonds and poor ion exchange in the dentinal collagen.18 the bond strength of the samples luted with self- adhesive resin cements remaining unaffected or showing a marginal increase in bond strength may be due to the following reasons . \n the ability of resin cement to partially decalcify the smear layer and the dentin leading to the formation of short - resin tags into the remaining dentinal tubules after laser application.19improved chemical bondage due to increased calcium ions on dentinal surface during laser application20 leading to enhanced chelating reactions.21 \n  the ability of resin cement to partially decalcify the smear layer and the dentin leading to the formation of short - resin tags into the remaining dentinal tubules after laser application.19 improved chemical bondage due to increased calcium ions on dentinal surface during laser application20 leading to enhanced chelating reactions.21 the above observations are in accordance with the study conducted by yazier et al .\non the effect of erbium : yttrium , aluminum , garnet and neodymium : yttrium , aluminum , garnet laser hypersensitivity treatment parameters on the shear bond strength of self - etch adhesives.22 the exact mechanism behind the bond strength being unaffected or having a marginal increase have to be studied and interpreted further .\nthe e - sem pictures of the laser irradiated samples in this study showed that a dentinal smear layer was produced due to microexplosion during laser application , which obliterated the patent dentinal tubules .\nthese findings could be the reason as to how the laser application brings about desensitization .\na few micro - cracks were found in some of the samples ; possibly due to an accidental increase in duration of laser exposure.23 which reiterates the fact that one has to be judicious while handling and using technology like laser to be an effective tool in dentistry .\nfrom the observation and discussion postulated from this study , it can be concluded that self - adhesive resin cement should be a preferred luting medium to glass - ionomer cement , for abutments , which has undergone desensitizing laser treatment .\nthe possible mechanism of dentin desensitization brought about by laser treatment could also be studied and understood from the e - sem pictures of the samples used for the study .\nwithin the limitations of this in vitro study the following conclusions were drawn : \n glass - ionomer luting cement showed a statistically significant reduction in the tensile bond strength values after desensitizing laser treatment at 0.5 w for 15 s duration to prepared teeth as compared to the control group.tensile bond strength of self - adhesive resin luting cement showed a marginal increase in values after desensitizing laser application , which was not statistically significant.since combination of er , cr : ysgg laser for desensitization of dentin and the self - adhesive resin cement for luting crowns showed a marginal increase in bond strength values after laser application , these crowns could be recommended for luting crowns in laser treated abutments.scanning electronic microscopic study revealed that application of the er , cr : ysgg laser at a power of 0.5 w for 15 s to exposed dentinal surface resulted in obliteration of dentinal tubules and formation of a smear layer formed by dentinal debris , which possibly describes the desensitizing property of lasers . \n \nglass - ionomer luting cement showed a statistically significant reduction in the tensile bond strength values after desensitizing laser treatment at 0.5 w for 15 s duration to prepared teeth as compared to the control group .\ntensile bond strength of self - adhesive resin luting cement showed a marginal increase in values after desensitizing laser application , which was not statistically significant . since combination of er , cr : ysgg laser for desensitization of dentin and the self - adhesive resin cement for luting crowns showed a marginal increase in bond strength values after laser application , these crowns could be recommended for luting crowns in laser treated abutments . scanning\nelectronic microscopic study revealed that application of the er , cr : ysgg laser at a power of 0.5 w for 15 s to exposed dentinal surface resulted in obliteration of dentinal tubules and formation of a smear layer formed by dentinal debris , which possibly describes the desensitizing property of lasers .", "human": " background : dentinal hypersensitivity is a very common complaint of patients undergoing crown and bridge restorations on vital teeth . of the many desensitizing agents used to counter this issue , desensitizing laser treatment is emerging as one of the most successful treatment modality . \n however , the dentinal changes brought about by the desensitizing laser application could affect the bond strength of luting cements.materials and methods : freshly extracted 48 maxillary first premolars , which were intact and morphologically similar were selected for the study . \n the specimens were divided into two groups , an untreated the control group and a desensitizing laser - treated group , which were exposed to erbium , chromium : yttrium , selenium , galium , garnet laser at 0.5 w potency for 15 s. each of the above two groups were again randomly divided into two subgroups , on to which full veneer metal crowns , which were custom fabricated were luted using glass - ionomer and resin luting cements , respectively . \n tensile bond strength of the luting cements was evaluated with the help of a universal testing machine . \n statistical analysis of the values were done using descriptive , independent samples test , and two - way anova test.results:the tensile bond strength of crowns luted on desensitizing laser treated specimens using self - adhesive resin cement showed a marginal increase in bond strength though it was not statistically significant.conclusion:the self - adhesive resin cements could be recommended as the luting agent of choice for desensitizing laser treated abutment teeth , as it showed better bond strength . ", "section_names": "Introduction\nMaterials and Methods\nFull veneer metal crown fabrication\nSurface treatment of teeth (Application of desensitizing laser)\nCementation of the crowns\nRetention testing\nResults\nDiscussion\nConclusion", "bigbird_pegasus": "<s> background : the aim of this study was to assess the effect of laser desensitizing treatment on the retention of temporary crown and bridge restoration when resin cements are used.materials and methods : a total of 48 sound premolars were selected for the study group.<n> teeth were prepared with the patent dentinal tubules intact.<n> teeth were randomly divided into two groups.<n> the first group was cemented with glass - ionomer cement.<n> the second group was cemented with self - adhesive resin cement.<n> desensitizing laser application was performed before glass - ionomer and self - adhesive resin cement application.<n> after cementation of the temporary restoration the teeth were stored in an isotonic saline solution for 24 h prior to testing.<n> a master cast of the teeth was then poured in type iv stone to obtain the master cast, which was then attached onto a special tray using putty wash impression material.<n> this loop in the cast metal crown was to be mounted parallel to the occlusal surfaces of the respective cast.<n> this loop in the master cast was then attached onto the occlusal surfaces of the respective cast.<n> the specimens were examined under environmental scanning electron microscopy ( e - sem ) for dentinal tubule obliteration.<n> the tensile bond strength values for glass - ionomer and self - adhesive resin cements luted with glass - ionomer and self - adhesive resin cements.<n> e -.<n> the e -.<n> the tensile.<n> the tensile bond of the.<n>.<n>.<n> the tensile.<n> the tensile.<n> the tensile bond of the.<n>.<n>.<n>.<n><n><n><n>.<n>.<n>.<n>.....<n>...<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>..<n>.<n>..<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>", "longt5": "<pad> objectives : the aim of this study was to assess, evaluate and compare the effect of desensitizing laser treatment on the bond strength of self - adhesive resin cement to glass - ionomer cement.materials and methods : forty - eight extracted human premolars were prepared using a metal jig filled with softened impression compound with the aid of a surveyor, so as to enable the specimen to be mounted parallel to its long axis. the specimens were randomly distributed into different groups. impressions of all the 48 prepared samples were made on a special tray using putty wash impression technique using polyvinyl siloxane impression material. the impressions were then poured in type iv stone to obtain the master cast. prior to cementation of the full veneer metal crowns, the prepared tooth surfaces of the 24 samples, grouped for laser treatment were treated with erbium, chromium : yttrium, selenium, galium, garnet laser at 0.5 w potency for 15 s without air or water spray. after laser application, some of the samples were examined under environmental scanning electron microscopy for dentinal tubule obliteration. the retention testing was performed on the instron automated universal testing machine. statistical analysis was done with the help of independent samples t - test and two - way anova analysis using spss ( version 16.0 ) and minitab software's ( version 11.0).results : glass - ionomer cement showed a statistically significant reduction in the tensile bond strength values after desensitizing laser treatment at 0.5 w for 15 s duration to prepared teeth as compared to the control group. however, the bond strength of self - adhesive resin cement showed a marginal increase in values after desensitizing laser application, which was not statistically significant.conclusion:the application of the er, cr : ysgg laser at a power of 0.5 w for 15 s to exposed dentinal surface resulted in obliteration of dentinal tubules and formation of a sm"}
{"article": "\n vitamin d deficiency is a global health problem even in sunny regions as the middle eastern countries ( 1).vitamin d is a steroid hormone and plays a key role in minerals metabolism , specially calcium and phosphorus , as well as in bone strength ( 2 ) .\nthe active type of this vitamin is synthesized in the skin , liver and kidneys .\nin addition to its multi - functions in the body , vitamin d reinforces the immune system .\nreceptors for vitamin d exist in most organs including pancreas , stomach , genital system , skin , brain etc ( 3 - 8 ) .\n25-hydroxy vitamin d ( 25(oh ) d ) level is the best index to determine vitamin d status in the body , with a half - life of 2 - 3 weeks ( 9 ) .\nadequate exposure to sunlight and dietary intake of foods rich in vitamin d are necessary to satisfy the daily need of the body and prevent hypovitaminosis d ( 10,11 ) . \n \n\nmany studies have indicated the association of serum 25(oh ) concentrations with serum levels of other vital elements . from the several elements found in the body , only a few number as zinc , copper , magnesium , iron and calcium play important roles in the body 's chemical and physiological functions .\nzinc has several important roles in the human body ; for instance , it is used in the process of synthesizing insulin and some enzymes as superoxide dismutase .\nzinc is a trace element , which after iron , has the highest amount in the body .\nit is mainly accumulated in the muscles but can also be found in the blood cells , retina , bones , skin , kidneys , liver and the pancreas .\nzinc is the second most vital element after iron and its deficiency during pregnancy may cause serious feto - maternal complications ( 12 ) including impaired cognitive development in the infant during the first six months of life , immunological complication in fetus , low birth weight , prematurity , miscarriage , fetal or infant death , postdate pregnancy , premature rupture of membranes , cleft palate and neural tube defects in the fetus ( 13 ) .\na study on 150 iranian pregnant women showed that 37% of them were vitamin d deficient and 23% were zinc deficient , with a statistically significant association between serum zinc and 25 ( oh ) d levels ( 14 ) .\nsuch experience is scarce in the pediatric age group . \n \n given the high prevalence of hypovitaminosis d and zinc deficiency , as well as their possible interactions , this study aimed to assess the relationship of serum zinc and 25 ( oh)d levels in adolescents . \n\n\n this study was conducted as a sub - study of  the national survey of school students high risk behaviors  , which was performed as the third survey of the school - based surveillance system entitled :  childhood and adolescence surveillance and prevention of adult non - communicable disease study ( caspian - iii )  .\ncaspian - iii is a school - based nationwide health survey that includes 5,528 students aged 10 - 18 years from 27 provinces in iran . \n \n in this case - control study , as a sub - study of the caspian iii study , 165 students with hypovitaminosis d as the case group and 165 normal students without hypovitaminosis d as the control group were randomly selected from the sample of frozen sera ( 70c ) of the participants in which 25-hydroxy vitamin d ( 25(oh ) d ) was checked ( 15 ) .\nserum concentration of 25(oh ) d was analyzed quantitatively by direct competitive immunoassay chemiluminescene method applying liason 25 oh vitamin d assay total ( diasorin , inc . ) , with a coefficient of variation of 9.8%.25 ( oh ) d levels of less than 10ng / ml as vitamin d deficiency and levels between 10 and 30ng / ml as vitamin d insufficiency ( 16 ) .\nsera of the two groups of participants with or without vitamin d deficiency were randomly selected . zinc level of the samples was determined by atomic absorption spectrophotometer using hollow cathode lamps of zn . \n \n\nsera were analyzed for glucose and lipid profile including total cholesterol , high - density lipoprotein cholesterol ( hdl - c ) , ldl cholesterol ( ldl - c ) and triglycerides ( tg ) , as well as liver function tests including serum glutamate oxaloacetate transaminase ( sgot ) and serum glutamate pyruvate transaminase ( sgpt ) using pars azmoon reagent kits ( tehran , iran ) . \n \n\nthe research and ethics committee of isfahan university of medical sciences , isfahan , iran , approved this study . \n \n statistical analysis : the relationship between serum vitamin d and zn levels was measured through linear regression analysis considering zn as an independent variable and 25(oh ) d as a dependent variable .\nchicago , il , usa ) by applying t test , one - way analysis of variance ( anova ) , and pearson s correlation tests . to assess the relationship between serum zn concentration and vitamin d level , logistic regression was used to calculate odds ratios ( or ) for vitd level between various quartiles of serum zn concentration ;\n\n the mean age of the participants was not significantly different among groups with and without hypovitaminosis d ( 14.74 2.52 vs.14.74  2.66 years , respectively , p>0.05 ) .\nno significant difference was observed in the baseline characteristics of the participants of the two groups ( table 1 ) . \n \n\nbmi : body mass index , sbp : systolic blood pressure , dbp : diastolic blood pressure , hdl - c : high density lipoprotein - cholesterol , ldl - c : low density lipoprotein - cholesterol , tg : triglyceride , fbg : fasting blood glucose , sgot : serum glutamate oxaloacetate transaminase , sgpt : serum glutamate pyruvate transaminase , sd : standard deviation \n \n the serum meansd level of 25(oh ) d was 6.341.47ng / ml in the group with hypovitaminosis d and 39.276.42ng / ml in the control group ( p<0.001 ) .\nthe meanzn level in hypovitaminosis d group was significantly lower than in controls ( 1.15 0.26 vs. 1.430.32g / ml , respectively , p<0.0001 ) . \n \n\nthe pearson correlation of serum zn concentration and vit d with metabolic factors and existence of metabolic disease showed that zn levels had a significant positive correlation ( p<0.001 ) with vit d level . \n \n\nas demonstrated in table 2 , the or of higher levels of vit d levels was higher in the second ( q2 ) and fourth ( q4 ) quartiles significantly as compared to the reference quartile ( q1 ) . \n\n\n the main aim of this study was to determine the relationship between serum vitamin d and serum zn levels in children and adolescents .\nwe found a positive correlation between serum zn and serum vitamin d levels , and this finding was consistent with a previous study conducted on children ( 14 ) .\nthis might have been caused by the prominent effects of lifestyle factors as inadequate exposure to sunlight , air pollution and poor nutrition . aside from hazardous effects on the respiratory system and pollution\ncaused diseases , living in populated cities means less sunlight for children , especially during cold seasons when there is higher air pollution and weaker sunlight intensity ( 16,17 ) . \n \n\na nationwide study in iranian adolescents demonstrated a high prevalence of hypovitaminosis d and an association of serum 25(oh ) d levels with cardiometabolic risk factors .\nit showed an inverse association of 25(oh)d with systolic blood pressure , diastolic blood pressure , total cholesterol and low - density lipoprotein cholesterol .\nin contrast , this association was significantly positive with high - density lipoprotein cholesterol , but not with fasting plasma glucose and mets ( 19 ) . \n \n\nthe first evidence of zn deficiency in humans was reported from central part of iran ( 21 ) .\nzn deficiency has several etiologies ; one of them might be the consumption of white flour and white rice as the main dishes in iran .\nthe zn intake from these diets is high at 15 mg a day , but it is not available because of the high phytate content of this kind of diet .\nphytate , the phosphorus storage compound of plant seeds , bind zn and other bivalent ions in insoluble complexes , making them unavailable to human and other monogastric species ( 22 ) . \n \n\niron , when present in large amounts in the diet , also inhibits zn absorption .\nepidemiological studies in iran showed a considerably high prevalence of zn deficiency , as high as 31.1% among school students and 28.1% in children ( 23 ) .\nthe most important causes of zn deficiency are soil content of zn , dietary deficiency ( phytate containing whole grains ) , malabsorption due to impaired transport across intestinal absorptive surface , damaged or absent intestinal absorptive surface , increased loss , increased utilization , and chronic disease ( 24 ) .\nthe vitamin d receptor ( vdr ) binds zinc , and the activity of vitamin d dependent genes in cells is influenced by intracellular zinc concentrations .\nit is also important to ensure that the calcium from foods or supplements is used in your bones .\nhence , low level of both zn and vitd can affect many important body functions ( 25 ) .\nhowever , studies in animals have shown positive effects of vitd on zinc increases ( 26 ) the effects of zinc and vitd on absorption - desorption and eventually the amount of each other , but their basic metabolic pathways in humans are not clear . \n \n\nour results revealed that hypovitaminosis d was accompanied with low serum zn level . comparing our results with those of other studies\n, it could be concluded that hypovitaminosis d is probably due to inadequate exposure to sunlight .\nin addition , it seems inappropriate diet and lack of absorbable zn in our foods lead to zn deficiency in our schoolchildren . finally , conducting future studies to identify the factors affecting vitamin d and zinc deficiency in schoolchildren , their relationship and the real causes of simultaneous lack of vitd and zinc\nstudy limitations and strengths : the main limitation of this study was its cross - sectional nature . moreover , we did not obtain the detailed dietary intake of the participants . the strengths of the study were its novelty in the pediatric age group and recruiting a nationally representative sample . \n", "human": " \n background : vitamin d ( vitd ) deficiency is a common worldwide problem . some previous studies have \n shown that both zinc ( zn ) and vitd deficiency are prevalent in iran . \n this study aimed to assess the relationship \n of serum zn and vitamin d levels in a nationally representative sample of iranian children and adolescents . \n\n \n methods : this case - control study was conducted as a sub - study of a school - based surveillance program entitled \n \" the caspian - iii study \" . \n an equal number of individuals with and without hypovitaminosis d including \n 330 participants aged 10 to 18 years were selected . \n the correlation of serum 25 hydroxy vitamin d ( 25(oh ) d ) , \n cardiometabolic factors and zn concentrations was determined . statistical analysis was done using one - way \n analysis of variance ( anova ) , pearson 's correlation , linear regression , and logistic regression . \n\n \n results : the mean age was not significantly different in participants with and without hypovitaminosis d \n ( 14.742.52 vs. 14.742.66 years , respectively , p>0.05 ) . \n the mean 25(oh ) d level was 6.341.47ng / ml in the \n group with hypovitaminosis d and 39.276.42ng / ml in controls . \n the mean zn level was significantly lower in \n the hypovitaminosis d group than in controls ( 1.150.26 vs. 1.430.32g / ml , respectively , p<0.001 ) . \n the pearson 's \n analysis showed a positive and significant correlation between zn and 25(oh ) d serum levels ( p<0.0001 ) . \n \n odds ratios analysis for vitd level between various quartiles of serum zinc concentration for all participants \n showed that the odds of higher levels of vitd increased by higher levels of zn . \n\n \n conclusion : we found significant associations between low serum concentrations of zinc and 25(oh ) d. \n food fortification or mineral supplementation should be considered in future health programs . \n ", "section_names": "Introduction\nMethods\nResults\nDiscussion", "bigbird_pegasus": "<s> background : hypovitaminosis d may cause serious feto - maternal complications, including impaired cognitive development in the infant during the first six months of life, and zinc deficiency during pregnancy may cause serious feto - maternal complications.objectives:given the high prevalence of hypovitaminosis d and zinc deficiency, as well as their possible interactions, this study aimed to assess the relationship of serum zinc and 25-hydroxy vitamin d ( 25(oh ) d ) levels in adolescents.patients and methods : this study was conducted as a sub - study of the national survey of school students high risk behaviors, which was performed as the third survey of the school - based surveillance system entitled : childhood and adolescence surveillance and prevention of adult non - communicable disease study ( caspian - iii ).<n> this study was conducted as a sub - study of the national survey of school students high risk behaviors, which was performed as the third survey of the school - based surveillance system entitled : childhood and adolescence surveillance and prevention of adult non - communicable disease study ( caspian - iii ).<n> zinc level of the samples was determined by atomic absorption spectrophotometer using hollow cathode lamps of zn.results:the mean zn level in hypovitaminosis d group was significantly lower than in controls ( 1.15 0.26 vs. 1.430.32g / ml, respectively, p<unk>0.001. the pearson correlation of serum zn and vit d levels with vit d vit d levels.<n>. the.<n>. the relationship between serum.<n>.<n>.<n>.<n>.<n> the mean serum z z z z z z z z z z z z levels of.<n>.<n>..<n>.......<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>.<n>", "longt5": "<pad> background : vitamin d deficiency is a global health problem even in sunny regions as the middle eastern countries. vitamin d deficiency is a global health problem even in sunny regions as the middle eastern countries.objectives:this study aimed to assess the relationship of serum zinc and 25-hydroxy vitamin d ( 25(oh)d ) levels in adolescents.patients and methods : in this case - control study, 165 students with hypovitaminosis d as the case group and 165 normal students without hypovitaminosis d as the control group were randomly selected from the sample of frozen sera of the participants in which 25-hydroxy vitamin d ( 25(oh)d ) was checked. zinc level of the samples was determined by atomic absorption spectrophotometer using hollow cathode lamps of zn.results:the serum meansd level of 25(oh)d was 6.341.47ng / ml in the group with hypovitaminosis d and 39.276.42ng / ml in the control group ( p<unk>0.001 ). the meanzn level in hypovitaminosis d group was significantly lower than in controls ( 1.15 0.26 vs. 1.430.32g / ml, respectively, p<unk>0.0001 ). the odds ratio of higher levels of vit d levels was higher in the second ( q2 ) and third ( q4 ) quartiles significantly as compared to the reference quartile ( q1).conclusions : hypovitaminosis d was accompanied with low serum zn level.</s>"}
{"article": "stroke is the second leading cause of death worldwide , and the leading cause of neurological disability in adults in developed countries.1 \n 2 recognised risk factors include high blood pressure , heart disease , diabetes , obesity , smoking , alcohol and physical inactivity , but further environmental factors are likely to be relevant to stroke risk .\nexposure to psychosocial stress has been identified by several recently conducted studies as a possible stroke risk.35 psychosocial stress , particularly with chronic exposure , is a feasible risk for stroke through its influence on the hypothalamic pituitary adrenal ( hpa ) axis and sympathetic nervous system , which can result in inflammation and altered metabolic and cardiac autonomic control.6 moreover , stress may be related to lifestyle factors relevant to stroke risk , such as cigarette smoking , physical inactivity and alcohol intake.7 to date , the association between psychosocial stress and stroke has been investigated incompletely.8 recent case - control studies investigating this may have been limited by potential reporting bias , and exclusion of subjects who experienced fatal stroke , as the measure of exposure to stress was collected after onset of stroke.4 \n 9 \n 10 while some prospective studies have been performed,3 \n 5 limited duration of follow - up has not allowed examination of chronic exposure , which may be of particular relevance .\nstress susceptibility  or stress resilience  is an important determinant of the consequences of exposure to stress.11 \n 12 a poorly controlled stress response ( potentially signalled by low stress resilience ) results in a prolonged physiological response to stressful exposures , thus increasing the possible longer - term adverse consequences of psychosocial stress .\nstress resilience may be a useful and underused measure for investigating the consequences of chronic stress in relation to stroke risk . here\n, we examine the association of stress resilience in adolescence with subsequent stroke risk in middle age within a general population - based cohort of male swedish residents . stress resilience was measured during the assessment for military conscription over 10  years prior to stroke and , therefore , not subject to differential reporting bias .\na secondary aim was to examine whether other risk factors might mediate associations of stress resilience with stroke risk . at the end of follow - up\nthe subjects were still relatively young , under age 60  years , so the study is of stroke risk during working age rather than the later ages when stroke is more common .\nthe study cohort consists of male swedish residents born between 1952 and 1956 , who were eligible for military conscription and included in the swedish military conscription register.13 at this time , conscription and the associated examinations were mandatory for all male citizens of the appropriate age ( 18 and 19  years , with a small number at later ages ) . during the years covered by this study , only men with significant disability or a severe chronic disease were exempted from conscription ( approximately 23% annually).14 the assessments included extensive and highly standardised physical and psychological examinations by physicians and psychologists .\nstroke risk was assessed from 1987 ( when the swedish national inpatient register15 attained full coverage ) to 2010 . from among a total of 284  198 men\nidentified , we excluded 2564 subjects with unreliable data such as errors in the personal identification number or uncertain vital status . those with implausible values for height ( less than 144  cm ) , weight ( above 178  kg ) , body mass index , bmi , ( below 15 ) , systolic blood pressure ( below 50 or above 230  mm  hg ) and diastolic blood pressure ( below 30 or above 135  mm  hg ) , were also excluded from the analysis ; in total 225 men.16 after excluding individuals who emigrated , died , or had a diagnosis of stroke before study entry in 1987 , the sample comprised 271  767 men .\nmen with missing data for stress resilience , potential confounding factors ( year of birth , geographic region , systolic and diastolic blood pressure , bmi , cognitive function , physical working capacity , parental socioeconomic index and household crowding ) were also excluded ( 37  196 men ; including 722 men with a stroke diagnosis at some time ) .\nthe sample available for the main analysis comprised 237  879 men , 84% of the potential target population .\nthe men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness , tolerance of stress and disposition to anxiety.18 during this assessment , the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life ; including psychosocial dimensions , such as social maturity , leisure interests , psychological motivation , and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low ( 13 ) , medium ( 46 ) and high ( 79 ) .\ndetails of the test are available in swedish,19 and it has been used in published research.16 \n 17 to ensure consistent evaluation , a central authority supervised the instruction and training of participating psychologists , supported by a written manual . height and weight were used to calculate bmi , which was categorised using the who criteria .\nsystolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer .\nphysical working capacity was assessed using the cycle ergonometric test . after a normal resting electrocardiogram ,\n5  min of submaximal exercise was performed at different work rates depending on body mass , directly followed by a maximal test with gradually increasing load until volitional exhaustion , or an estimate was derived from a nomogram for men who did not complete the full duration .\nthe cognitive test was a written assessment and comprised four domains : linguistic understanding , spatial recognition , general knowledge and ability to follow mechanical instructions : the results were transformed into a single score with a value ranging from 1 to 9 . from the medical assessment at conscription , we identified diagnoses , and we used the international classification of diseases eighth revision , icd-8 , icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription . using the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 .\nthe codes used for stroke were 430434 and 436 in icd-8 , 430 , 431 , 433 , 434 and 436 in icd-9 ; and i60 , i61 , i63 , i64 in icd 10 . for ischaemic stroke , they were 432434 in icd-8 , 433 , 434 in icd-9 , and i63 in icd-10 ; for intracerebral haemorrhagic stroke 431 in icd-8 , 431 and 432 in icd-9 , and i61 in icd-10 .\nthe government organisation , statistics sweden , provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census .\nthe head of household 's occupation was classified as manual , agricultural , farm owners / mangers , office workers , business owners / mangers , and others .\nhousehold crowding was divided into two categories to indicate a ratio of less than two persons per room , or more or equal to two persons per room .\ncox regression was used to examine the association of stress resilience in adolescence with subsequent stroke risk between ages 31 and 58  years .\nthe follow - up period began on 1 january 1987 and ended at first stroke , death , emigration or 1 january 2010 , whichever occurred first .\nsubjects with a diagnosis of stroke before 1987 were excluded ( n=218 ) . non - fatal and fatal stroke were examined together and separately . in the analyses of aetiological subtypes ( ischaemic and intracerebral haemorrhagic stroke ) , first event by each subtype was used .\nassociations were examined using an unadjusted ( model 1 ) and three further adjusted models . in model 2 , adjustment was for demographic and socioeconomic factors for the family of origin : birth year , geographical region , parents socioeconomic index , and household crowding .\nmodel 3 was additionally adjusted for characteristics in adolescence : cognitive function ( continuous ) , systolic and diastolic blood pressure ( continuous ) , and cardiovascular disease at conscription . in model 4\nlifestyle factors in adolescence ( here represented by physical fitness and body mass ) were also added to the model : bmi ( in 4 categories ) and physical working capacity score ( continuous ) .\nthe proportional hazards assumption for stress resilience in relation to stroke was tested graphically , as well as using a test based on schoenfeld residuals , and no evidence was found that it was violated . as this was assessed using age as the underlying time scale , it indicates that the association between stress resilience and stroke was constant and did not diminish with increasing age .\nthe study cohort consists of male swedish residents born between 1952 and 1956 , who were eligible for military conscription and included in the swedish military conscription register.13 at this time , conscription and the associated examinations were mandatory for all male citizens of the appropriate age ( 18 and 19  years , with a small number at later ages ) . during the years covered by this study , only men with significant disability or a severe chronic disease were exempted from conscription ( approximately 23% annually).14 the assessments included extensive and highly standardised physical and psychological examinations by physicians and psychologists .\nstroke risk was assessed from 1987 ( when the swedish national inpatient register15 attained full coverage ) to 2010 . from among a total of 284  198 men\nidentified , we excluded 2564 subjects with unreliable data such as errors in the personal identification number or uncertain vital status . those with implausible values for height ( less than 144  cm ) , weight ( above 178  kg ) , body mass index , bmi , ( below 15 ) , systolic blood pressure ( below 50 or above 230  mm  hg ) and diastolic blood pressure ( below 30 or above 135  mm  hg ) , were also excluded from the analysis ; in total 225 men.16 after excluding individuals who emigrated , died , or had a diagnosis of stroke before study entry in 1987 , the sample comprised 271  767 men .\nmen with missing data for stress resilience , potential confounding factors ( year of birth , geographic region , systolic and diastolic blood pressure , bmi , cognitive function , physical working capacity , parental socioeconomic index and household crowding ) were also excluded ( 37  196 men ; including 722 men with a stroke diagnosis at some time ) .\nthe sample available for the main analysis comprised 237  879 men , 84% of the potential target population .\nthe men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness , tolerance of stress and disposition to anxiety.18 during this assessment , the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life ; including psychosocial dimensions , such as social maturity , leisure interests , psychological motivation , and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low ( 13 ) , medium ( 46 ) and high ( 79 ) .\ndetails of the test are available in swedish,19 and it has been used in published research.16 \n 17 to ensure consistent evaluation , a central authority supervised the instruction and training of participating psychologists , supported by a written manual . height and weight were used to calculate bmi , which was categorised using the who criteria .\nsystolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer .\nphysical working capacity was assessed using the cycle ergonometric test . after a normal resting electrocardiogram ,\n5  min of submaximal exercise was performed at different work rates depending on body mass , directly followed by a maximal test with gradually increasing load until volitional exhaustion , or an estimate was derived from a nomogram for men who did not complete the full duration .\nthe cognitive test was a written assessment and comprised four domains : linguistic understanding , spatial recognition , general knowledge and ability to follow mechanical instructions : the results were transformed into a single score with a value ranging from 1 to 9 . from the medical assessment at conscription , we identified diagnoses , and we used the international classification of diseases eighth revision , icd-8 , icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription . using the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 .\nthe codes used for stroke were 430434 and 436 in icd-8 , 430 , 431 , 433 , 434 and 436 in icd-9 ; and i60 , i61 , i63 , i64 in icd 10 . for ischaemic stroke , they were 432434 in icd-8 , 433 , 434 in icd-9 , and i63 in icd-10 ; for intracerebral haemorrhagic stroke 431 in icd-8 , 431 and 432 in icd-9 , and i61 in icd-10 .\nthe government organisation , statistics sweden , provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census .\nthe head of household 's occupation was classified as manual , agricultural , farm owners / mangers , office workers , business owners / mangers , and others .\nhousehold crowding was divided into two categories to indicate a ratio of less than two persons per room , or more or equal to two persons per room .\nthe men underwent a psychological examination to assess their potential ability to cope with war - time stress,17 based on the ability to control and channel nervousness , tolerance of stress and disposition to anxiety.18 during this assessment , the potential conscripts met a psychologist for a semistructured interview which covered areas relevant to general everyday life ; including psychosocial dimensions , such as social maturity , leisure interests , psychological motivation , and emotional stability.18 this interview was used to produce a stress resilience score from 1 to 9 which we grouped into low ( 13 ) , medium ( 46 ) and high ( 79 ) .\ndetails of the test are available in swedish,19 and it has been used in published research.16 \n 17 to ensure consistent evaluation , a central authority supervised the instruction and training of participating psychologists , supported by a written manual . height and weight were used to calculate bmi , which was categorised using the who criteria .\nsystolic and diastolic blood pressure was measured after rest in recumbent men using a sphygmomanometer .\nphysical working capacity was assessed using the cycle ergonometric test . after a normal resting electrocardiogram ,\n5  min of submaximal exercise was performed at different work rates depending on body mass , directly followed by a maximal test with gradually increasing load until volitional exhaustion , or an estimate was derived from a nomogram for men who did not complete the full duration .\nthe cognitive test was a written assessment and comprised four domains : linguistic understanding , spatial recognition , general knowledge and ability to follow mechanical instructions : the results were transformed into a single score with a value ranging from 1 to 9 . from the medical assessment at conscription , we identified diagnoses , and we used the international classification of diseases eighth revision , icd-8 , icd-8 codes 393458 to indicate diagnosis of any cardiovascular disease at the time of conscription .\nusing the swedish national inpatient register15 exlude and the cause of death register,20 we identified the dates of first fatal and non - fatal stroke diagnoses during the period 19692010 .\nthe codes used for stroke were 430434 and 436 in icd-8 , 430 , 431 , 433 , 434 and 436 in icd-9 ; and i60 , i61 , i63 , i64 in icd 10 . for ischaemic stroke , they were 432434 in icd-8 , 433 , 434 in icd-9 , and i63 in icd-10 ; for intracerebral haemorrhagic stroke 431 in icd-8 , 431 and 432 in icd-9 , and i61 in icd-10 .\nthe government organisation , statistics sweden , provided socioeconomic and demographic data including information on vital status and emigration from the total population register.21 childhood social and material circumstances were estimated using data from the 1960 census .\nthe head of household 's occupation was classified as manual , agricultural , farm owners / mangers , office workers , business owners / mangers , and others .\nhousehold crowding was divided into two categories to indicate a ratio of less than two persons per room , or more or equal to two persons per room .\ncox regression was used to examine the association of stress resilience in adolescence with subsequent stroke risk between ages 31 and 58  years .\nthe follow - up period began on 1 january 1987 and ended at first stroke , death , emigration or 1 january 2010 , whichever occurred first .\nsubjects with a diagnosis of stroke before 1987 were excluded ( n=218 ) . non - fatal and fatal stroke were examined together and separately . in the analyses of aetiological subtypes ( ischaemic and intracerebral haemorrhagic stroke ) , first event by each subtype was used .\nassociations were examined using an unadjusted ( model 1 ) and three further adjusted models . in model 2 , adjustment was for demographic and socioeconomic factors for the family of origin : birth year , geographical region , parents socioeconomic index , and household crowding .\nmodel 3 was additionally adjusted for characteristics in adolescence : cognitive function ( continuous ) , systolic and diastolic blood pressure ( continuous ) , and cardiovascular disease at conscription . in model 4\nlifestyle factors in adolescence ( here represented by physical fitness and body mass ) were also added to the model : bmi ( in 4 categories ) and physical working capacity score ( continuous ) .\nthe proportional hazards assumption for stress resilience in relation to stroke was tested graphically , as well as using a test based on schoenfeld residuals , and no evidence was found that it was violated . as this was assessed using age as the underlying time scale , it indicates that the association between stress resilience and stroke was constant and did not diminish with increasing age .\nall analyses are based on the 237  879 conscripts with complete information for the required variables , after exclusion of individuals who emigrated , died , or had a diagnosis of stroke before the beginning of follow - up in 1987 . during the follow - up period of 19872010 ,\n3411 men ( 1.4% ) received an inpatient diagnosis of stroke ( or stroke was recorded as the underlying cause of death ) .\nthe stroke incidence rate was 64 per 100  000 person - years in our study population , compared with 101 per 100  000 person - years in the excluded subset with missing data on covariates .\nmen with low resilience tended to have lower physical capacity , lower cognitive function scores , higher blood pressure , were underweight , overweight or obese , more often had a diagnosis of cardiovascular disease at conscription , and had parents with a lower socioeconomic index and experienced greater household crowding in childhood .\npopulation ( n=237  879 ) characteristics by stress resilience levels cvd , cardiovascular disease ; sei , socioeconomic index .\nthe associations with stroke for stress resilience and the other measures are reported in table 2 .\nthe lowest stress resilience group ( 21.8% with scores 13 ) compared with the highest ( 23.7% with score 79 ) was associated with increased risk of all stroke types .\nthe intermediate category of stress resilience lay between the low and high groups , indicating a graded association .\nwhen adjusted for the demographic and socioeconomic factors in childhood , the association attenuated slightly but remained statistically significant . additional adjustment for health and development characteristics in adolescence\nfurther adjustment for physical fitness indicated by bmi and physical capacity had the most notable impact on the hrs , but despite the reduction in magnitude , statistical significance remained .\nblood pressure was modelled as continuous variables to ensure the most effective adjustment : the magnitude of the associations appears small as the hrs are for each unit change per mm  hg , but statistical significance for associations with stroke remained after adjustment for all other measures .\n/ material background factors ( birth year , region , parental sei and household crowding ) .\nmodel 3 . adjusted for 2 + characteristics in adolescence ( cognitive function , diastolic and systolic blood pressure and cvd diagnosis at conscription ) .\nmodel 4 . adjusted for 2 + 3 + physical fitness in adolescence ( physical working capacity and bmi ) .\ntable  3 presents the outcomes for the stroke subgroups , fatal ( n=308 ) , ischaemic ( n=2060 ) and intracerebral haemorrhagic ( n=676 ) stroke .\nall showed a significant association with stress resilience , with higher magnitude associations for fatal than non - fatal stroke ; and for haemorrhagic than ischaemic stroke .\nin adjusted models , a similar pattern as for all stroke appeared , but the association of stress resilience and ischaemic stroke was more notably attenuated by adjustment for bmi and physical capacity .\nstress resilience and stroke subdivided by stroke characteristics model 2 . adjusted for socio / material background factors ( birth year , region , parents sei , household crowding ) .\nmodel 3 . adjusted for 2 + characteristics in adolescence ( cognition , systolic and diastolic blood pressure , cvd diagnosis at conscription ) .\nmodel 4 . adjusted for 2 + 3+physical fitness in adolescence ( physical working capacity and bmi ) .\nlow stress resilience in adolescence was associated with a higher risk of stroke in men of working age between 31 years and 58  years , a relatively young age group to experience stroke .\nthis association was independent of childhood socioeconomic circumstances , as well as health and developmental characteristics in adolescence .\nthe association was attenuated more notably ( but not eliminated ) by adjustment for bmi and physical working capacity as indicators of physical fitness in adolescence , likely to signal future lifestyle characteristics .\nour results from a general population - based cohort of men are consistent with recent studies suggesting a role for psychosocial stress in influencing stroke risk.35 \n 9 \n 10 similarly , poorer adaptation to social adversity  possibly signalling lower stress resilience  has also been linked with an increased risk of stroke.22 stress resilience in adolescence does not measure exposure to stress but does indicate susceptibility , such that the adversities of daily life may have a greater impact and conspire to produce a more chronic pattern stress arousal over adult life . another study has found associations with stress independent of lifestyle factors.4 this difference with our findings may be due to methodological variations , as we have a measure of resilience rather than stress exposure , it was collected prospectively , many years before stroke , and we adjusted for some characteristics in adolescence that may themselves be consequences of low stress resilience , as discussed below .\nwe hypothesise that low resilience to psychosocial stress could indicate exposure to psychosocial stress in earlier life , resulting in poorer control of the stress response that can continue across the life course .\nanimal studies have demonstrated that early life stress can alter hpa axis function in a way that can persist over the life course , producing persistent low resilience to stress.23 \n 24 stress resilience may also be a characteristic of personality type , and thus , a persistent trait .\nfor example , low resilience may reflect something like type a behaviour which , although controversial , has previously been related to increased cardiovascular risk.25 it has been demonstrated that adverse socioeconomic conditions in childhood increase stroke risk26 ; so we adjusted for such factors , with little impact on the association of stress resilience with stroke .\nmarkers of early life exposure to stress have been linked with poorer cognitive development27 and higher blood pressure.28 thus , cognitive function and blood pressure may represent consequences of earlier stressful exposures and poorer stress resilience , and adjusting for these factors may have produced conservative estimates of association ; arguably an over - adjustment .\nmarkers of stressful exposures in early life are also linked with unhealthy weight gain,29 which may influence physical exercise or be a consequence of low exercise levels.30 thus , even in adolescence , bmi and fitness could , in part , be a consequence of lower stress resilience and earlier stressful exposures .\nwe believe the results suggest that a significant proportion of the association of stress and stress resilience with stroke risk is due to lifestyle risk factors .\nthis is consistent with recent findings from a british cohort study with older participants , where the association of psychological distress with cvd risk was largely explained by behavioural / lifestyle processes.31 our findings suggest such processes have a long natural history , beginning in childhood or adolescence .\nour results were consistent among the different stroke subtypes ( fatal , non - fatal , ischaemic and intracerebral haemorrhagic stroke ) although there may be pathological heterogeneity .\nprevious studies investigating the association between psychosocial stress and stroke subtypes are few , but the results are mostly consistent with our findings suggesting a more notable association for fatal than for non - fatal stroke , and for haemorrhagic than ischaemic stroke\n. the stronger association with haemorrhagic than ischaemic stroke could also be a consequence of a greater aetiological heterogeneity in ischaemic stroke . physical working capacity and bmi in adolescence most notably attenuated that association of stress resilience with ischaemic stroke , suggesting more significant mediation through lifestyle factors .\nas this is a study of stress resilience measured in adolescence , it is possible that stressful exposures in adult life might represent a higher risk of stroke , particularly chronic exposures among the less stress resilient .\noverweight , obesity and poorer physical capacity in adolescence are likely to signal an accumulation of behavioural / lifestyle health risks that continue through adulthood.32 \n 33 other lifestyle risks in the years between conscription and stroke , such as smoking , alcohol and diet , are also likely to be relevant mediating factors .\nfurther mediating factors might include type 2 diabetes , a stroke risk which tends to have its onset in adulthood some years after the time of conscription , which has also been linked with psychosocial stress.34 \n 35 as behaviours and diagnoses occurring between conscription and stroke are intermediate in the causal pathway , we have not included them in the model .\nunfortunately , we have no data on smoking , diet or alcohol consumption , which could have added further to our understanding of lifestyle risks .\nthus , major mediation between poor stress resilience and stroke risk may be through lifestyle factors and fitness , suggesting interventions for psychosocial stress and behaviour might be most effective in lowering stoke risk among younger men .\nthe use of prospectively recorded data from several linked registers , and the long - term follow - up subsequent to the measure of susceptibility , increases the validity and reliability of the study , as well as avoiding bias due to reverse causation or poor recall .\nthe study population is largely representative of the male general population as only a small proportion of swedish men were exempted from enlistment examinations .\nextensive physical and psychological examinations were conducted in adolescence , so the information was objectively measured and were able to adjust for a variety of powerful stroke risk factors including , bmi and physical capacity which are objective physiological measures .\nthe duration between conscription examination and start of follow - up means it is unlikely that prodromal characteristics of an impending stroke were driving the stress resilience measure , and it was possible to identify pre - existing cardiovascular diagnoses and adjust for blood pressure .\nthe potential limitations of the study include the inclusion of only men , as women also suffer from stroke .\nthis was necessary as the measure of stress susceptibility was collected during military conscription , which at the time was almost exclusively available to men . as stress resilience\nwas only measured once , we can not be definitive about stability of this characteristic over time and how this may interact with stressful exposures . in these data ,\nthe association of stress resilience with stroke risk did not vary by age , indicating that this measure of stress resilience is a relatively stable characteristic over time , at least in terms of stroke risk .\nthere is a possibility of misclassification of the stress resilience measure if potential conscripts attempted to obtain exemption from military service through\nfalse answers , if they exist , would most likely dilute the resilience measure and result in less precise estimates .\nthe temporal relationship of stress resilience and physical fitness in adolescence can not be established , but we hypothesise that poor stress resilience has an adverse influence on physical fitness . as stressful exposures were not examined , it is possible that the magnitude of associations with stress resilience is conservative\n. a proportion of the cardiovascular diagnoses at conscription when the men in our cohort were 1819 years old may not be directly relevant to stroke risk .\nwe included this information in the models to ensure that poorer stress resilience was not a function of pre - existing cardiovascular disease , where a proportion of these diseases may increase subsequent stroke risk .\nmost stroke onset occurs at a higher age than in our study , so early stroke may be somewhat atypical and the aetiology may differ from stroke at older ages.36 however , stroke incidence in younger adults ( younger than 55  years of age ) is increasing.37 stroke at young ( working ) age is a particular concern , as a reduction of working capacity increases the personal , social as well as economic burden of the disease .\nthis is of public health significance , as stroke at early ages has the potential for greater lifetime burden of disability , and because some risks may be modifiable .\nthe proportion of stroke diagnoses in the analytic sample is lower than among those who were not included .\nthis is for two reasons , and the first is that men who had a stroke at an early age , close in time to the conscription examination , were excluded deliberately to avoid associations due to reverse causation .\nsome men in poor health , with very low levels of physical fitness , or low cognitive function at the time of the conscription examination , were identified as unsuitable for military service by the assessors and may not have completed all the examinations ( including for stress resilience ) . as these men  excluded due to missing values on the assessments  may have the greatest risk of stroke , we may have underestimated the proportion at risk and conceivably produced a conservative estimate of stroke risk .\nthe validity of some diagnoses recorded in the swedish national inpatient register can be questionable , but the reliability of stroke diagnoses is satisfactory.38 \n 39\nthe use of prospectively recorded data from several linked registers , and the long - term follow - up subsequent to the measure of susceptibility , increases the validity and reliability of the study , as well as avoiding bias due to reverse causation or poor recall .\nthe study population is largely representative of the male general population as only a small proportion of swedish men were exempted from enlistment examinations .\nextensive physical and psychological examinations were conducted in adolescence , so the information was objectively measured and were able to adjust for a variety of powerful stroke risk factors including , bmi and physical capacity which are objective physiological measures .\nthe duration between conscription examination and start of follow - up means it is unlikely that prodromal characteristics of an impending stroke were driving the stress resilience measure , and it was possible to identify pre - existing cardiovascular diagnoses and adjust for blood pressure .\nthe potential limitations of the study include the inclusion of only men , as women also suffer from stroke .\nthis was necessary as the measure of stress susceptibility was collected during military conscription , which at the time was almost exclusively available to men . as stress resilience\nwas only measured once , we can not be definitive about stability of this characteristic over time and how this may interact with stressful exposures . in these data , the association of stress resilience with stroke risk did not vary by age , indicating that this measure of stress resilience is a relatively stable characteristic over time , at least in terms of stroke risk .\nthere is a possibility of misclassification of the stress resilience measure if potential conscripts attempted to obtain exemption from military service through\nfalse answers , if they exist , would most likely dilute the resilience measure and result in less precise estimates .\nthe temporal relationship of stress resilience and physical fitness in adolescence can not be established , but we hypothesise that poor stress resilience has an adverse influence on physical fitness .\nas stressful exposures were not examined , it is possible that the magnitude of associations with stress resilience is conservative\n. a proportion of the cardiovascular diagnoses at conscription when the men in our cohort were 1819 years old may not be directly relevant to stroke risk .\nwe included this information in the models to ensure that poorer stress resilience was not a function of pre - existing cardiovascular disease , where a proportion of these diseases may increase subsequent stroke risk .\nmost stroke onset occurs at a higher age than in our study , so early stroke may be somewhat atypical and the aetiology may differ from stroke at older ages.36 however , stroke incidence in younger adults ( younger than 55  years of age ) is increasing.37 stroke at young ( working ) age is a particular concern , as a reduction of working capacity increases the personal , social as well as economic burden of the disease .\nthis is of public health significance , as stroke at early ages has the potential for greater lifetime burden of disability , and because some risks may be modifiable .\nthe proportion of stroke diagnoses in the analytic sample is lower than among those who were not included .\nthis is for two reasons , and the first is that men who had a stroke at an early age , close in time to the conscription examination , were excluded deliberately to avoid associations due to reverse causation .\nsome men in poor health , with very low levels of physical fitness , or low cognitive function at the time of the conscription examination , were identified as unsuitable for military service by the assessors and may not have completed all the examinations ( including for stress resilience ) .\nas these men  excluded due to missing values on the assessments  may have the greatest risk of stroke , we may have underestimated the proportion at risk and conceivably produced a conservative estimate of stroke risk .\nthe validity of some diagnoses recorded in the swedish national inpatient register can be questionable , but the reliability of stroke diagnoses is satisfactory.38 \n 39\nthe association with stress resilience suggests that stress may be implicated in the aetiology of stroke , which is , in part , explained by poorer physical fitness among the less stress resilient .\nwe hypothesise that the most effective interventions to prevent stroke would focus on behaviour and lifestyle factors , as well as psychosocial stress .", "human": " objectiveexposure to psychosocial stress has been identified as a possible stroke risk , but the role of stress resilience which may be relevant to chronic exposure is uncertain . \n we investigated the association of stress resilience in adolescence with subsequent stroke risk.methodsregister-based cohort study . \n some 237  879 males born between 1952 and 1956 were followed from 1987 to 2010 using information from swedish registers . \n cox regression estimated the association of stress resilience with stroke , after adjustment for established stroke risk factors.resultssome 3411 diagnoses of first stroke were identified . lowest stress resilience ( 21.8% ) compared with the highest ( 23.7% ) was associated with increased stroke risk , producing unadjusted hr ( with 95% cis ) of 1.54 ( 1.40 to 1.70 ) . \n the association attenuated slightly to 1.48 ( 1.34 to 1.63 ) after adjustment for markers of socioeconomic circumstances in childhood ; and after further adjustment for markers of development and disease in adolescence ( blood pressure , cognitive function and pre - existing cardiovascular disease ) to 1.30 ( 1.18 to 1.45 ) . \n the greatest reduction followed further adjustment for markers of physical fitness ( bmi and physical working capacity ) in adolescence to 1.16 ( 1.04 to 1.29 ) . \n the results were consistent when stroke was subdivided into fatal , ischaemic and haemorrhagic , with higher magnitude associations for fatal rather than non - fatal , and for haemorrhagic rather than ischaemic stroke.conclusionsstress susceptibility and , therefore , psychosocial stress may be implicated in the aetiology of stroke . \n this association may be explained , in part , by poorer physical fitness . \n effective prevention might focus on behaviour / lifestyle and psychosocial stress . ", "section_names": "Introduction\nMethods\nStudy population\nMeasures\nSwedish military service conscription data\nStroke\nSocioeconomic and demographic characteristics\nStatistical analysis\nResults\nDiscussion\nStrengths\nLimitations\nConclusions", "bigbird_pegasus": "<s> backgroundstress susceptibility or stress resilience is an important determinant of the consequences of exposure to stress, and may be a useful and underused determinant for investigating the consequences of chronic stress in relation to stroke risk.methodsin a population - based cohort of men born between 1952 and 1956, stress resilience was measured during the assessment for military conscription over 10 years prior to conscription and, therefore, not subject to differential reporting bias.<n> a secondary aim was to examine whether other risk factors might mediate associations of stress resilience with stroke risk.<n> stress resilience was measured using a semistructured interview, and categorised into low ( 13 ), medium ( 46 ) and high ( 79 ).<n> cox regression was used to examine the association of stress resilience with stroke risk.resultsof the 237 879 men free from stroke at baseline, an estimated 4.9% ( 95% confidence interval [ ci ] : 3.1 to 6.0 ) developed stroke over a median of 20 years of follow - up.<n> high stress resilience was associated with an increased risk of ischemic heart disease ( hazard ratio [ hr ] 2.19, 95% ci : 1.53 to 3.17 ), but not of hemorrhagic stroke ( hr : 1.05, 95% ci : 0.95 to 1.14 ).<n> the association of stress resilience with subsequent stroke risk was not mediated by smoking, but was mediated by lifestyle factors, such as cigarette smoking.<n>.<n><n>, the low stress resilience was also.<n><n>, the stroke risk was associated.<n><n>, the association of the stroke risk was associated, in the stroke risk.<n><n><n>.<n><n><n>.<n><n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>.<n><n>.<n>.<n>.<n><n>.<n><n><n>.<n><n><n><n><n>.<n>.<n><n><n>.<n><n>.<n><n><n>.<n><n>.<n><n><n>.<n><n><n>.<n>.<n>.<n>.<n><n><n>.<n><n><n>.<n>.<n><n>", "longt5": "<pad> backgroundpsychosocial stress is a feasible risk for stroke through its influence on the hypothalamic pituitary adrenal ( hpa ) axis and sympathetic nervous system, which can result in inflammation and altered metabolic and cardiac autonomic control. stress resilience may be a useful and underused measure for investigating the consequences of chronic stress in relation to stroke risk.methodswe examined the association of stress resilience in adolescence with subsequent stroke risk in middle age within a general population - based cohort of male swedish residents.resultsthe study sample comprised 237 879 men, 84% of the potential target population. the lowest stress resilience group ( 21.8% with scores 13 ) compared with the highest ( 23.7% with score 79 ) was associated with increased risk of all stroke types. the intermediate category of stress resilience lay between the low and high groups, indicating a graded association. when adjusted for demographic and socioeconomic factors in childhood, the association attenuated slightly but remained statistically significant.conclusionlow stress resilience in adolescence was associated with a higher risk of stroke in men of working age between 31 and 58 years, with a relatively young age group to experience stroke. this association was independent of childhood socioeconomic circumstances, as well as health and developmental characteristics in adolescence. the association was attenuated more notably by adjustment for bmi and physical working capacity as indicators of physical fitness in adolescence, likely to signal future lifestyle characteristics.</s>"}
{"article": "mortality rates due to accidental drowning are higher in japan than in western countries , largely resulting from a higher incidence of sudden unexpected death ( sud ) of japanese people in hot baths .\nalthough the precise mortality rates are unknown , approximately 10% of suds confirmed by the tokyo medical examiner s office occur at home , involving individuals who took deep hot baths .\na few studies have examined the autopsies of victims of sud associated with taking hot baths .\nsatoh et al summarized the findings of 268 autopsy cases of sud in hot baths .\npathological and serological examination of the 173 subjects who did not show decomposition revealed a high incidence of structural cardiac disorders , such as coronary artery disease and cardiomegaly . only 7 of the subjects were below 50  years of age , but all 7 had a history of epilepsy . here , we present a rare autopsy case of sud of a young subject found dead in a hot bath .\nwe attempted genetic screening using next - generation dna sequencing ( ngs ) , which allows large numbers of samples to be sequenced simultaneously .\nit can be used for the comprehensive analysis of panels of 20 to 80 genes associated with inherited arrhythmia or cardiomyopathy to detect arrhythmogenic potential in the victims whose hearts have no significant structural disorders .\na 28-year - old female beauty therapist was found dead in a bathtub with her face submerged .\nthere was no clinical history of significant organ or functional disease , such as epilepsy , that could have caused sud or syncope in any of the cases .\nthere was no family history of heart disease , and no electrocardiography had been performed within the past 10  years . during medicolegal autopsy ,\nno traumatic injury was found , but signs of drowning , specifically froth in the upper airway and pulmonary edema , were evident .\nlow levels of ethanol ( 1.1  mg / ml ) were detected in the blood , but the full toxicological examination was negative .\nwe concluded that all possible causes of sudden loss of consciousness , other than those of cardiac origin , were excluded by the full autopsy examination as well as the investigation of the scene of death .\nthe heart weighed 200  g and was examined as described in a previous report , but it did not show any significant pathological changes . under microscopic examination , ischemic necrosis of myocytes , substantial coronary artery atherosclerosis with luminal narrowing greater than 50% , and myocardial disarray were not evident .\ndiffuse but very mild interstitial fibrosis of the left ventricle was found ( figure 1 ) .\ngross and microscopic appearance of the deceased victim s heart ( after fixation with formalin ) : ( a ) horizontal section of both ventricles ( scale bar  =  1  cm ) and ( b ) mild interstitial fibrosis of the left ventricle , visualized using elastica - masson staining ( scale bar  =  100  m ) .\nthe ethical committee of toyama university approved this study , which was performed in accordance with the ethical standards established in the 1964 declaration of helsinki . the genetic analysis using ngs\ngenomic dna samples of the case were extracted directly from whole blood using the qiaamp dna mini kit ( qiagen sciences inc . ,\nwe designed a custom ampliseq panel using ion ampliseq designer software ( http://www.ampliseq.com ) to target all exons of 73 cardiac disorder \nthis custom panel , which consisted of 2 separate polymerase chain reaction ( pcr ) primer pools and produced a total of 1870 amplicons , was used to generate the target amplicon libraries .\ngenomic dna samples were pcr - amplified using the designed custom panel and the ion ampliseq library kit v2.0 ( life technologies , carlsbad , ca , usa ) .\nemulsion pcr and ion sphere particle enrichment were conducted with the ion pgm template ot2 200 kit ( life technologies ) .\nion sphere particles were loaded on an ion 314 chip kit v2 and sequenced using an ion pgm sequencing 200 kit ( life technologies ) .\nthe torrent suite and ion reporter software 5.0 ( life technologies ) were used to perform primary to tertiary analyses , including optimized signal processing , base calling , sequence alignment with the hg19 human genome reference ( http://genome.ucsc.edu/ ) , and variant analysis . for all variants detected , we consulted the east asian ( eas ) population database of 4327 individuals from the exome aggregation consortium ( http://exac.broadinstitute.org ) to filter out those variants for which the minor allele frequency ( maf ) was 1.0% or undetermined in the eas population . for each genetic variation identified , we applied the single nucleotide polymorphism database ( dbsnp ) as a population database and the human gene mutation database ( hgmd ) and clinvar as reported disease - causing mutation databases .\nwe also included 8 types of in silico predictive algorithms to evaluate the pathogenicity of identified variants .\nthe url for each database , in silico algorithms , and conditions used to evaluate pathogenicity are listed in table 2 .\nfrom the ngs analysis , scn5a_p.gly289ser , cacnb2_p.ser502leu , and myh11_p.lys1573glu were detected as rare variants in eas , and the mafs were 0% , 0.95% , and 0.035% , respectively .\nthe sequences of scn5a_p.gly289ser and cacnb2_p.ser502leu found in this case study are depicted in figure 2 .\nsequences for possible channelopathy - related pathogenic variants from the deceased : ( a ) scn5a , ( b ) cacnb2 , and ( c ) myh11 .\nscn5a_p.gly289ser was previously reported as possibly pathogenic in an earlier study and was evaluated as \nthe other 2 variants were evaluated as having  uncertain significance  in clinvar and are not noted in hgmd . after using our in silico predictive algorithm analyses , scn5a_p.gly289ser was evaluated as possibly pathogenic twice , cacnb2_p.ser502leu was evaluated as possibly pathogenic 5 times , and myh11_p.lys1573glu was evaluated as possibly pathogenic 6 times ( table 3 ) . detected variants and results of in silico analysis .\nabbreviations : cadd , combined annotation dependent depletion ; fathmm , functional analysis through hidden markov models ; maf , minor allele frequency ; provean , protein variation effect analyzer ; sift , sift sequence .\nprevious reports indicate a number of heart conditions that may cause sud in young adults , including structural heart disease such as coronary anomaly , hypertrophic cardiomyopathy , and arrhythmogenic right ventricular cardiomyopathy . no evidence of these conditions were found in this particular case .\nour study supports the findings of others with evidence that concealed cardiomyopathy and channelopathy may also result in sud of young adults .\narrhythmogenic events and related sud usually require both an abnormal myocardial substrate and an inciting trigger , such as exercise , being asleep , or emotional stress as seen in many cases .\nnagasawa et al found that in the elderly , blood pressure and heart rate begin to rise immediately on immersion in a hot bath .\nthese changes were associated with a temporary decrease in sympathetic activity without the compensatory parasympathetic suppression , resulting in hypotension and bradycardia .\nchiba et al showed that increased peripheral blood pressure and cardiac output occurred after bathing in both young and elderly subjects .\nin addition , asymptomatic ventricular tachycardia occurred in elderly individuals while sitting in hot water , and this arrhythmia developed within 5  minutes of immersion .\nmany japanese people love to take bath in water that reaches shoulder depth and soak in a sitting position , and a higher water temperature than in western countries is generally used ( approximately 40 - 42c ) .\nthese studies , along with the case described here , show that immersion in deep hot water can trigger an arrhythmogenic event which could lead to drowning in the bath water in individuals with an inherited or acquired heart disease .\nwe recently reported the significance of postmortem genetic analysis using ngs for both sud syndrome and sud with epilepsy cases in young people to explore the cause of such death if pathological change of the heart is not evident .\nthe present case is notable in that detection of rare gene variants suggested that the deceased might have had undiagnosed arrhythmogenic potential which could cause sudden loss of consciousness during bathing .\nhowever , we should note the limitations involved in interpretation of the detected variants found by ngs analysis .\nwe frequently depend on population databases and in silico analyses to evaluate the pathogenicity of detected variants because functional or genetic analysis of family members , the criterion standard method for evaluating the pathogenicity of genetic variants , can be difficult in some cases . however , the evaluations obtained from different in silico analyses do not always correspond , as shown in our case .\nguidelines for interpreting sequence variants recommend that several in silico analyses should be used to evaluate the pathogenicity of arrhythmia - related gene variants because most algorithms used for missense variant prediction are only 65% to 80% accurate when examining known disease variants .\nin addition , le scouarnec et al and kapplinger et al indicated that identification of a variant does not confirm the presence of the disease because many of the variants found in brugada syndrome patients were also identified in the control population . genetic analysis using ngs\nmay provide significantly useful information about the mechanism of sud in some conditions , but careful and comprehensive evaluation of the detected variants is needed when the evaluation for pathogenicity differs across a range of predictive procedures .\nscn5a_p.gln289ser is a very rare variant , not only in eas but across the world .\n however , 1 patient with long qt syndrome has been reported to have this variant .\nin addition , although the relevance of drinking alcohol to sud occurring in hot baths is not fully understood , some researchers consider that ethanol intake may increase the chance of developing atrial fibrillation , a prolonged qt interval , and sud as the combination of pathogenic genetic variants and alcohol intake might increase the risk of sudden arrhythmogenic events occurring in hot baths .\nthe cacnb2_p.ser502leu variant is rare but has a relatively high incidence in eas , yet 5 of 8 in silico tools evaluated this variant as pathogenic .\nthe l - type calcium channel is composed of 4 subunits , and cacnb2 codes one of 3 ancillary subunits .\ncacnb2 is the dominant isoform known to play an essential role in the voltage dependence of the l - type calcium channel .\naccelerated inactivation of the calcium current was found in 1 person who had a mutation in cacnb2 , and the variant is also associated with brugada syndrome , short qt , long qt 8 ( timothy syndrome ) , j wave syndrome , and sudden death .\nour results show that the variants of cacnb2 may also have the potential to cause arrhythmogenic sud in hot baths .\nwe should note that we can not evaluate the pathogenic significance of the combined effect of the variants seen in present case .\ncurrently available in silico tools can only indicate the pathogenicity of single genes ; thus , the pathogenic significance of interactions between different gene variants can not be fully evaluated .\nthis victim s heart might have concealed an arrhythmogenic potential from the combination of 2 channelopathy - related pathogenic variants , even if structural abnormality was not evident .\nthe role of the variant of myh11 ( which encodes a smooth muscle myosin heavy chain ) is not well established .\nthis gene belongs to the myosin heavy chain family and is a major contractile protein in smooth muscle cells . whereas mutations in myh11 have been identified in families with inherited patent ductus arteriosus and thoracic aortic aneurysms and dissections , cases of arrhythmia or sudden death associated with this myh11 variant\nexamination of further cases involving this variant will be useful to determine how significant this variant is . given the high cost of genetic analysis , it is not feasible to conduct this analysis routinely for every case . in many circumstances , careful toxicological screening and histological examination of\nthe heart and other organs should provide enough evidence to specify cause of death or might at least contribute to narrowing the list of target genes to explore .\nin particular , detection of minimal cardiac pathology , including necrosis , inflammation , and fatty infiltration into the ventricle , during an examination might be indicative of cardiomyopathy - related genetic variants .\nsuch findings may prompt further genetic analysis , even if the observed pathological changes do not fulfill the commonly used diagnostic criteria of structural heart diseases .\nwe report here a rare autopsy case of a young female adult who died suddenly and unexpectedly in her bathtub .\ngenetic analysis using ngs showed 2 previously unpredicted channelopathy - related variants with possible arrhythmogenic potential .\na combination of the possible pathogenic channelopathy - related gene variants might have contributed to this unusual death in the bathtub , and the event may also have been triggered by bathing under the influence of alcohol .\nalthough the evaluation of these detected variants is still complicated by our inability to completely assess pathogenicity , future molecular analysis by ngs may help to predict which young people could be at risk of sud in hot baths .", "human": " we report a case of sudden unexpected death of a young woman who was found in a bathtub of hot water . \n the autopsy concluded that all possible causes of sudden loss of consciousness , except cardiac origin , could be excluded . \n however , the heart did not show any obvious pathological changes . \n we used next - generation dna sequencing ( ngs ) to examine 73 genes and detected 3 rare , potentially pathogenic variants with minor allele frequencies 1.0% . \n the pathogenicity of these variants was evaluated using 8 in silico predictive algorithms , and scn5a_p.gly289ser , cacnb2_p.ser502leu , and myh11_p.lys1573glu were detected as possible pathogenic variants . inherited heart disease is a likely cause of sudden unexpected deaths of young people in hot baths , even before the clinical manifestation of the disease . in the future , \n molecular analysis by ngs may help to predict young to early middle - aged people who could be at risk of sudden arrhythmogenic fatality in hot baths . ", "section_names": "Introduction\nCase Report\nMolecular Testing\nResults of Molecular Testing\nDiscussion\nConclusions", "bigbird_pegasus": "<s> background : mortality rates due to accidental drowning are higher in japan than in western countries, largely resulting from a higher incidence of sudden unexpected death ( sud ) of japanese people in hot baths. here, we present a rare autopsy case of sud of a young subject found dead in a hot bath.objectives : we attempted genetic screening using next - generation dna sequencing ( ngs ) to detect arrhythmogenic potential in the victims whose hearts have no significant structural disorders.patients and methods : a 28-year - old female beauty therapist was found dead in a bathtub with her face submerged.<n> there was no clinical history of significant organ or functional disease, such as epilepsy, that could have caused sud or syncope in any of the cases.<n> no traumatic injury was found, but signs of drowning, specifically froth in the upper airway and pulmonary edema, were evident.results : the full toxicological examination was negative.<n> low levels of ethanol ( 1.1 mg / ml ) were detected in the blood, but the full toxicological examination was negative.<n> we concluded that all possible causes of sudden loss of consciousness, other than those of cardiac origin, were excluded by the full autopsy examination.<n> the heart weighed 200 g and was examined, but it did not show any significant pathological changes.<n> arrhythmogenic arrhythmogenic events of the myh11, a myh11, myh11, myh11, myh11, myh11, myh11, myh11, myh11, myh11, the myh11, the myh11, the myh11, the myh, the myh, the myh, the myh, the myh,.<n> the.<n> the.<n> the.<n> the.<n> the.<n> the.<n> the.<n>.<n>.<n>.<n>.<n>.<n>.<n> the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was the.<n> was a patient was a patient was a patient was a patient was a patient was a patient was a", "longt5": "<pad> we report here a rare autopsy case of sudden unexpected death ( sud ) of a young female adult who died suddenly and unexpectedly in her bathtub. genetic analysis using next - generation dna sequencing showed 2 previously unpredicted channelopathy - related variants with possible arrhythmogenic potential. a combination of the possible pathogenic channelopathy - related gene variants might have contributed to this unusual death in the bathtub, and the event may also have been triggered by bathing under the influence of alcohol. although the evaluation of these detected variants is still complicated by our inability to completely assess pathogenicity, future molecular analysis by next - generation dna sequencing may help to predict which young people could be at risk of sud in hot baths.</s>"}
{"article": "  walking ability is impaired in patients with peripheral arterial disease ( pad ) due to decreased blood flow to the skeletal muscle tissue used during walking .\nit has been demonstrated that walking distance is associated with the degree of impairment in the affected leg as measured by the ankle - brachial index ( abi ) and the time to onset of claudication pain [ 16 ] .\nlikewise , it has been shown that walking exercise in patients with pad prolongs the onset of claudication pain thus allowing the patient to walk longer but does not change the abi [ 79 ] .  \nrecently , several investigators have used near - infrared spectroscopy ( nirs ) to dynamically study the effect of walking on oxygen desaturation of the gastrocnemius muscle of the impaired leg during exercise [ 2 , 1014 ] .\ninvestigators noted a marked decline in skeletal muscle tissue oxygenation ( sto2 ) during walking exercise [ 2 , 1014 ] .\ngardner et al . also identified that the rate of decline in calf muscle sto2 was significantly associated with initial claudication time and absolute claudication time in patients with pad .\nthree of the above studies examined the changes in tissue oxygenation , using nirs , in patients with pad before and after an exercise training program [ 1214 ] .\nused a pretest - post - test design and reported greater exercise duration and lower mean exercise sto2 in 15 patients after a 3-month treadmill and calf exercise training program .\nstudied 55 patients with pad who were given the option to participate in a structured or unstructured home exercise program for 34  2 weeks . at the end of the study , those patients in the structured exercise program had an increased oxyhemoglobin area under the curve when compared to baseline ; similar changes were not identified in the unstructured exercise group .\nlastly , tew et al .   studied calf - tissue oxygenation and treadmill walking response time after randomization to 12 weeks of arm - crank ergometry or a control group in 57 patients with intermittent claudication .\ninvestigators identified that walking distance and time to nadir sto2 increased in those assigned to arm - cranking and there were no changes in the control group .\nno studies however compared leg muscle responses after a traditional walking program compared to a walking - with - poles program of rehabilitation in patients with claudication .  \nthe purpose of this study was to determine if there were differences in calf muscle sto2 parameters before and after 12 weeks of a traditional walking program versus a walking - with - poles exercise program .\nwe reasoned that by using the poles to offload the legs , patients would have less claudication pain and be able to walk longer distance thus achieving a greater training effect .\nwe hypothesized that the calf muscle tissue deoxygenation would be less in both groups after 12 weeks of exercise training than at baseline and that the decrease would be greater in those patients assigned to the walking - with - poles group .\nthese data represent a subanalysis of data from a larger clinical trial comparing traditional walking to walking with poles .\npatients with pad were screened and recruited to participate in a randomized clinical trial designed to compare the effects of a traditional walking training program versus walking - with - poles exercise training program .\na total of 2296 patients were screened for eligibility , 146 enrolled in the study .\npatients were recruited using radio and newspaper advertising , posted fliers , and letters of invitation sent to patients at the university and va hospitals . for the purposes of this analysis\n, we included only those participants with an abi of 0.90 ( n = 91 patients ) .\nof those 91 patients , 3 did not have sto2 analyses on their baseline progressive treadmill test due to equipment malfunction and 3 had questionable data resulting in a final sample of 85 patients .\nof those 85 patients , 45 were assigned to the walking - with - poles group and 40 patients were assigned to the traditional walking group .  \nthe major study was a randomized clinical trial to examine the effects of a traditional walking program compared to walking with poles on walking endurance and perceived physical function in patients with pad .\nour primary outcome focused on changes the patients realized walking on the constant work rate treadmill test whereas this analysis used data from the progressive treadmill test . at two minutes on the constant work rate test , the speed and incline increased to 85% of the patient 's workload on the progressive treadmill test resulting in a sudden decline in sto2 . due to the gentle nature of the progressive treadmill protocol used , we were able to detect more subtle changes in sto2 and onset of claudication pain .   \npatients were randomized using computer - generated permuted blocks and group assignment was managed by the study statistician .\nthe training programs for both groups were identical except that one group exercised with poles and the other group did not .\npatients assigned to the walking - with - poles group received training on the use of the poles prior to beginning the exercise program .\nadditionally , patients were coached on proper poling mechanics during the training period if needed .\nthe training program incorporated interval training whereby exercise consisted mostly of low - to - moderate intensity training at the start of the program and progressed to moderate - to - high intensity .\nexercise intensity was determined by heart rate associated with a percentage of oxygen uptake obtained during the metabolic exercise treadmill tests .\nexercise duration and intensity was adjusted every three weeks . during the first weeks , patients walked for 30 minutes ( 20% light intensity , 60% moderate intensity , and 20% hard intensity ) . by weeks 1012 , patients walked for 55 minutes ( 10% light intensity , 45% moderate intensity , and 45% hard intensity ) .\nlight intensity was defined as 2544% peak vo2 , moderate intensity was 4559% peak vo2 , and hard intensity was 6084% vo2 peak .\nthe program was designed so that patients walked on the treadmill two days / week and outdoors or in the hospital corridors one day / week . the exercise interval was adjusted based on the patient 's pain tolerance .\nfor example , some patients could only walk for one to two minutes at the higher intensities . in order for them to achieve 20% total time at the harder intensities ,\ndemographic information , height , weight , comorbid conditions , and medication history were obtained from the patient and reviewed in the patient medical record .\nthe abi was measured in the more severely affected leg at baseline and 12 weeks after training .\nthe location of the signal was recorded and used consistently throughout the study for that individual subject .\nafter the patient rested comfortably in a supine position for 15 minutes , doppler ultrasound was used to measure the systolic pressure in the right and left arms and in the ankle of the most severely affected leg . the arm with the highest systolic pressure\npatients were tested using a gentle treadmill protocol that was developed for patients with pad [ 6 , 16 ] .\nincreases in percent grade occurred every 30 seconds , and , after the first 6 minutes , speed increased every 3 minutes .\ninitial claudication time was defined as the time during the treadmill test when the subject experienced pain in the affected leg . the absolute walking time was defined as the time walked by the patient on the progressive treadmill test .\npeak oxygen uptake was measured using the medgraphics cpx / d system ( medical graphics corp , st .\nthe metabolic cart was calibrated using a 3  l syringe prior to each test and the analyzers were calibrated using references gasses and room air .\npatients breathed through a mouthpiece and their nose was clipped with a standard nose clip .\noxygen uptake was averaged over 30  s and the highest value at peak exercise was recorded .\nskeletal muscle tissue oxygenation was measured prior to , during , and after exercise using the nirs spectrometer ( inspectra 325 , hutchinson technology , inc . ,\na 25  mm probe attached to an optical cable was used to noninvasively measure the percentage of hemoglobin oxygen saturation of the tissue beneath the near - infrared light .\nthe inspectra machine was calibrated prior to each test according to known high and low reference standards .\nthe nirs probe was attached to the medial section of the gastrocnemius muscle of the patient 's most severely affected leg .\nthe probe was placed into a specially designed adhesive housing unit to reduce ambient light .\nthe probe was then secured to the leg to avoid excessive motion and possible tripping .\nthe sto2 values used in this analysis were the sto2 value recorded after 2 minutes of standing prior to exercise ( sto2 rest ) , time walked when the patient reached the nadir sto2 value ( time to nadir sto2 value ) , sto2 value at peak exercise ( sto2 peak ) , and absolute and relative drop in sto2 ( absolute drop in sto2 = rest sto2  minimal sto2 value , relative drop in sto2 = [ rest sto2  nadir sto2 value]/rest sto2 )\n. ratings of perceived leg pain were obtained every minute using the borg ratio scale .\nthe initial claudication time is the time that patients either notified the staff of the onset of pain or the time they first reported pain when asked every minute .  \nthe two groups were compared at baseline using the t - test for independent samples and mann whitney u test .\nregression analyses were used to compute the initial decline in slopes for sto2 values ( sto2 value regressed over time ) .\npearson r correlations were completed to examine relationships between the variables . paired t - tests\nindependent t - tests were used to examine differences between groups . intent - to - treat analyses using the baseline value carried forward were completed for the comparisons between groups .\nthe sample consisted of primarily older ( age = 69.4  9.2 years ) men .\nover one - third of the patients were current smokers , half were diabetic , and the majority of patients received treatment for hypertension and dyslipidemia ( table 1 ) .\npatients were generally unfit with a peak oxygen uptake of 14.3  2.9  ml  kg  min. the walking - with - poles group was older than the traditional walking group .\ncalf muscle oxygenation decreased from 56  17% prior to the treadmill test to 16  18% at peak exercise ( 71% relative decline from rest to peak exercise ) .\npatients walked 4.45  3.67 minutes before experiencing claudication pain and 4.39  3.99 minutes when the sto2 reached its nadir value .\nthere was no difference between the time elapsed when the sto2 reached its nadir value and pain onset ( p = .87 ) .\nalthough all patients reported claudication pain , exercise was not limited by claudication pain for all patients .\ntherefore , we examined the onset of claudication pain and time to nadir sto2 for those whose exercise was limited by claudication pain only ( n = 72 ) .\npatients walked 3.35  2.57 minutes before experiencing claudication pain and 3.67  3.49 minutes when the sto2 reached its nadir value .\nthere was no difference between the time elapsed when the sto2 reached its nadir value and pain onset ( p = .40 ) .\nafter exercise , the time for the sto2 to return to half of its resting value was 1.3  1.3  min and 2.2  2.1 minutes to return to resting values . the initial claudication time and absolute walking time\nwere not associated with the sto2 values at rest ( table 2 ) but were moderately related to the time elapsed prior to reaching the nadir sto2 value ( r = .42 , p < .001 ; r = .58 , p = .001 , resp . ) .\nthere was also a small to moderate relationship between onset of claudication pain and the exercise slope decline in sto2 ( r = .28 , p = .011 ) .\nrelationships were similar between initial claudication time and absolute walking time and the time elapsed prior to reaching the nadir sto2 values when the analysis was restricted to those whose exercise was limited by claudication ( r = 48 , p  .001 and r = .47 , p < .001 ) .\ndata comparing groups after exercise training were analyzed using intent - to - treat analysis for all patients . the change in time elapsed\nprior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks ( r = .65 , p < .001 ) and initial claudication time at 12 weeks ( r = .33 , p = .002 ) .\nanalysis of covariance was completed to compare the groups with age as the covariate since there was a difference in age at baseline ( table 3 ) .\nthe change in the time elapsed prior to reaching nadir sto2 values ( p = .002 ) and absolute walking time ( p = .002 ) were greater in the traditional walking group when compared to the walking - with - poles group .\nthere was , however , no difference in the change in initial claudication time between the two groups ( p = .38 ) .  \nwhen the analyses were restricted to those who completed the exercise training only ( n = 71 ) , the change in time elapsed prior to reaching nadir sto2 values between baseline and 12 weeks was related to the change in absolute walking time between baseline and 12 weeks ( r = .57 , p < .001 ) and initial claudication time at 12 weeks ( r = .32 , p = .004 ) . data from a sample patient are depicted in figure 1 .\nrecovery time was unchanged when baseline and 12-week values were compared ( baseline = 2.45  2.17  min , 12  wk = 2.19  1.94  min , p = .81 ) .\nafter 12 weeks of exercise training , within - group changes in initial claudication time , absolute claudication time and time elapsed prior to reaching nadir sto2 values increased ( table 4 . ) the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking - with - poles group ( walking group = 4.01  5.13 minutes , walking - with - poles group = .89  3.56 minutes , p = .009 ) .\nsimilarly , absolute walking time increased more in the traditional walking group than in the walking - with - poles group ( walking group = 3.97  3.14 minutes , walking - with - poles group = 2.24  2.41 minutes , p = .017 ) .\nthere was no difference between the two groups in initial claudication time ( walking group = 1.16  3.64 minutes , walking - with - poles group = .85  3.46 minutes , p = .69 ) . since there was a significant difference in age between the two groups , age\nno differences in recovery time were noted between the traditional walking and walking - with - poles groups at the 12-week follow - up time period ( traditional walking recovery time = 1.26  1.43  min , walking with poles = 1.41  1.76  min , p = .70 ) .\nno significant differences were identified in peak oxygen consumption or abi within or between the two groups from baseline to 12 weeks using intent - to - treat analysis or restricting the analysis to those who completed the training only .\n  there are three major findings of this study : ( 1 ) the time elapsed before reaching nadir sto2 values is associated with initial claudication time and absolute walking time , ( 2 ) there was no difference in the time associated with the nadir of sto2 and the onset of claudication pain , and ( 3 ) the time to nadir sto2 of the gastrocnemius muscle was greater after 12 weeks of exercise training in the traditional walking group when compared to the walking with poles group .    as bauer notes , during higher work rates and apparent blood flow limitation , muscle oxygen desaturation becomes more rapid in pad subjects .\nthus , one would expect that oxygen desaturation would be associated with onset of claudication and walking duration .\nour findings reflect these assumptions and were similar to those reported by gardner et al .\n, that is , shorter time to reach nadir sto2 values were associated with shorter initial claudication time and total walking duration .\nsecond , in gardner 's study , relationships between initial claudication time ( r = .339 ) , absolute walking time ( r = .68 ) and measured time to minimal exercise sto2 were similar to our relationships between initial claudication time ( r = .42 ) , absolute walking time ( r = .58 ) and measured distance to nadir sto2 .\nthese findings suggest that our sample patients were similar to patients in other studies [ 2 , 19 ] .  \nexercise - associated decline in sto2 of the gastrocnemius muscle was less after 12 weeks of exercise training when compared to baseline .\nwang and colleagues recently demonstrated in 17 subjects with pad who completed a 24-week walking program that an increase in the number of capillaries in contact with type iix and iia calf muscle fibers was related to an improved pain - free walking time ( r = .69 and r = .62 , p < .05 ) .\ninvestigators hypothesized that the ratio of capillaries to muscle fibers affects oxygen supply thus delaying the mismatch between supply and demand .\nboth report greater exercise sto2 area under the curve postexercise training when compared to preexercise training . in our study ,\nan increase in the time to nadir sto2 values was associated with delayed initial claudication time and improved absolute walking time .\nour findings provide further evidence that walking exercise improves tissue muscle oxygenation in patients with pad .\nlikewise , our findings support the possibility that the onset of claudication and walking duration are linked by the decline in tissue oxygenation .\nthe onset of claudication and the time elapsed prior to reaching the nadir sto2 values were nearly identical .\nthus , the patient 's perception of pain is a good indicator of sto2 in the calf muscle .\nexercise - induced decline in gastrocnemius muscle sto2 was less in patients assigned to the traditional walking program than in patients assigned to the walking - with - poles exercise training program .\nwe had originally hypothesized that a walking training program with poles for patients would be advantageous because the poles would  offload  the legs during periods of claudication allowing additional walking exercise .\nindeed , oakley et al .   investigated the immediate effects of walking with nordic poles on 20 patients with pad and found that claudication distance increased from 77  m without the poles to 130  m with the poles ( p < .0001 ) and the level of claudication pain also decreased ( p = .0002 ) .\nour group has also previously reported that patients had decreased calf pain when walking with poles .\noakley et al .   compared muscle histology of 36 patients randomly assigned to 12 weeks of treadmill training , strength training or control .\nafter the 12 weeks , only the treadmill group had histological changes in the muscle .\nthe increase in muscle ischemia with treadmill training was associated with a marked increase in muscle damage .\nhiatt suggests that skeletal muscle dysfunction and associated muscle metabolic state can be ameliorated with treadmill exercise training .\ntew et al .   provides evidence that even when the exercising muscle is not the calf muscle , tissue oxygenation can improve .\nclearly , the patients assigned to the traditional walking group experienced a prolonged exercise time before experiencing claudication pain , prolonged their absolute walking time and increased the amount of time exercising until reaching nadir values . in the walking - with - poles group\n, there were no changes over time when an intent - to - treat approach was used .\nhowever , when the analysis was restricted to those who completed the training program only , there was a difference in absolute walking time and a trend toward increasing time to initial claudication pain onset as well as nadir sto2 .\nthe explanation for these findings may be that leg metabolic changes in the calf muscle occurred to a greater extent in those assigned to the walking - with - poles group or we may not have had enough statistical power to detect changes that were present .\nanother explanation for this finding may be that the intensity of our training program was based on oxygen uptake associated with heart rate response to exercise . with the addition of the upper body to the exercise regime for patients assigned to the walking - with - poles group\nthus , the work accomplished by the leg muscles may have been less even though overall exercise intensity was consistent between the two groups of patients . both groups trained on the treadmill and outdoors .\npatients assigned to the walking with poles group were unable to use the handrails on the treadmill for balance ; added anxiety may have increased the cardiovascular response thus keeping the overall work accomplished lower in some patients .  \nfirst , although age was not a contributing factor to the differences between the groups , the walking - with - poles group was older than the traditional walking group .\nwe can not exclude that the differences in exercise tolerance and willingness to push limits may differ between someone who is 67 years old ( mean age for walking group ) and someone who is 72 years old ( mean age for walking - with - poles group ) .\nthis five - year age difference may have influenced our outcomes in ways that we did not measure .\nnext , the sample was primarily men and thus can not be generalized to women .\nadditionally , in order to include only those with compressible vessels , we excluded 17 patients who were initially randomized to our study .\nlastly , although all of our patients experienced claudication pain , not all patients stopped exercise due to claudication pain . including patients that did not stop exercise due to claudication pain\nadditional studies examining different walking intensities in patients with peripheral arterial disease should be tested .\nfurther , it may be that use of walking poles early in the rehabilitative effort may augment traditional walking training later by assisting patients to train longer early on .\nin summary , we conclude that there is a significant decline in sto2 in the gastrocnemius muscle during walking exercise in patients with peripheral arterial disease reflecting muscle tissue ischemia .\ncontrary to our hypothesis , after 12 weeks of exercise training , absolute walking time and time to reach nadir muscle tissue oxygenation were prolonged in the patients assigned to the traditional walking program more than those assigned to a walking - with - poles exercise training program reflecting greater tissue perfusion and enhancement of arteriovenous oxygen extraction .\nthe precise mechanism for these differences remains unknown but these findings may provide some insight to tissue adaptations to exercise stimulus and may therefore be useful to pad rehabilitation programs .", "human": " this randomized trial proposed to determine if there were differences in calf muscle sto2 parameters in patients before and after 12 weeks of a traditional walking or walking - with - poles exercise program . \n data were collected on 85 patients who were randomized to a traditional walking program ( n = 40 ) or walking - with - poles program ( n = 45 ) of exercise training . \n patients walked for 3 times weekly for 12 weeks . \n seventy - one patients completed both the baseline and the 12-week follow - up progressive treadmill tests ( n = 36 traditional walking and n = 35 walking - with - poles ) . using the near - infrared spectroscopy measures , sto2 was measured prior to , during , and after exercise . at baseline , \n calf muscle oxygenation decreased from 56  17% prior to the treadmill test to 16  18% at peak exercise . \n the time elapsed prior to reaching nadir sto2 values increased more in the traditional walking group when compared to the walking - with - poles group . likewise , \n absolute walking time increased more in the traditional walking group than in the walking - with - poles group . \n tissue oxygenation decline during treadmill testing was less for patients assigned to a 12-week traditional walking program when compared to those assigned to a 12-week walking - with - poles program . in conclusion , \n the 12-week traditional walking program was superior to walking - with - poles in improving tissue deoxygenation in patients with pad . ", "section_names": "1. Introduction\n2. Methods\n3. Results\n4. Discussion\n5. Conclusion", "bigbird_pegasus": "<s> <n> background. near - infrared spectroscopy ( nirs )<n> has been used to dynamically study the calf muscle tissue oxygenation ( sto2 ) during walking.<n> the purpose of this study was to determine if there were differences in calf muscle sto2 parameters before and after 12 weeks of a traditional walking program versus a walking - with - poles program of rehabilitation in patients with peripheral arterial disease ( pad ).<n> methods.<n> calf muscle sto2 was measured before and after 12 weeks of traditional walking and walking - with - poles rehabilitation.<n> results.<n> there were no differences between the two groups in calf muscle oxygenation parameters before exercise.<n> after exercise, the calf muscle oxygenation increased in the walking - with - poles group when compared to the traditional walking group.<n> conclusions.<n> there were no differences in calf muscle oxygenation parameters before and after 12 weeks of traditional walking or walking - with - poles rehabilitation in patients with pad.</s>", "longt5": "<pad> [ purpose ] the purpose of this study was to determine if there were differences in calf muscle tissue oxygenation ( sto2 ) parameters before and after 12 weeks of a traditional walking program versus a walking - - poles exercise program. [ subjects and methods ] patients with peripheral arterial disease ( pad ) were randomly assigned to a traditional walking program ( 45 patients assigned to the walking - - poles group and 40 patients assigned to the traditional walking group ) or a walking - - poles exercise program ( 45 patients assigned to the walking - - poles group and 40 patients assigned to the traditional walking group ). calf muscle oxygenation was measured prior to, during, and after exercise using near - infrared spectroscopy. [ results ] after 12 weeks of exercise training, within - group changes in initial claudication time, absolute walking time and time to reach nadir sto2 values increased. there was no difference in the time associated with the nadir of sto2 and the onset of claudication pain. [ conclusion ] there is a significant decline in sto2 in the gastrocnemius muscle during walking exercise in patients with peripheral arterial disease reflecting muscle tissue ischemia. contrary to our hypothesis, after 12 weeks of exercise training, absolute walking time and time to reach nadir muscle tissue oxygenation were prolonged in the patients assigned to the traditional walking program more than those assigned to a walking - - poles exercise training program reflecting greater tissue perfusion and enhancement of arteriovenous oxygen extraction.</s>"}
{"article": "children constitute approximately 40% of india 's population but information on adverse drug reactions occurring in them is limited .\nphenytoin sodium ( pht ) is one of the commonest antiepileptic drug ( aed ) used in children in india .\nthe drug has wide pharmacokinetic variability and has a narrow therapeutic range that leads to toxicity .\nthere is some evidence of the association of long - term use of pht and toxicity like cerebellar atrophy .\nsuch cerebellar changes have been reported even with the long - term use of nontoxic levels of phenytoin .\n, we report a case of reversible cerebellar atrophy induced by pht in a 10-year - old boy .\nafter initiating therapy with pht 10 years back , he was seizure free for 2 years .\npatient was also occasionally prescribed clobazam , 5 mg , oral , as and when required . the episodes used to last for a brief period of over 6 - 7 days .\nseizures used to occur at every 3 - 4 months interval . the boy had history of birth asphyxia and delay in developmental milestones .\nafter the patient recovered , he was evaluated again due to complaint of difficulty in walking .\ncns examination revealed normal mentation with cerebellar signs including gaze - evoked nystagamus , truncal , and appendicular ataxia .\nmri scan of the brain was advised and it showed cerebellar atrophy as shown in figure 1 .\nserum phenytoin level was high ( 30 mcg / ml ) and pht was withdrawn immediately . patient was started on valproic acid and followed up .\nhowever , a sizeable proportion of patients may develop drug induced adverse effects that include sedation , gum hypertrophy , lymphadenopathy , chorea , ataxia , etc .\nthere are a few reports on cerebellar atrophy after long - term use of pth .\nthese adverse effects are usually reported if the drug serum levels are above the therapeutic range .\nour patient presented with severe cerebellar disorder and he was on the drug for 10 years .\nhence , a regular monitoring for adverse drug reaction should be considered in patients who are on drugs on long term basis .\nthese reactions could be idiosyncratic or dose - dependent which again may be acute or chronic in nature .\nsince most of these effects are reversible , it is important to identify the clinical manifestations related to drug toxicity and to manage them appropriately . also , it warns the need for regular monitoring of plasma concentration , accurate dosing , and identification of adherence issues in patients on phenytoin .", "human": " epilepsy is an important health problem due to its high prevalence and potential for causing long - term morbidity . \n it is commonly treated in children with phenytoin sodium . \n it has wide pharmacokinetic variability and a narrow therapeutic range that leads to toxicity . here \n , we report a case of phenytoin - induced cerebellar atrophy in a 16-year - old epileptic boy who presented to the hospital with a viral infection . ", "section_names": "Introduction\nCase Report\nDiscussion", "bigbird_pegasus": "<s> information on adverse drug reactions occurring in children is limited in india.<n> phenytoin sodium ( pht ) is one of the commonest antiepileptic drugs ( aed ) used in children in india.<n> there are a few reports on cerebellar atrophy after long - term use of pth.<n> we report a case of reversible cerebellar atrophy induced by pht in a 10-year - old boy.</s>", "longt5": "<pad> phenytoin sodium ( pht ) is one of the commonest antiepileptic drugs used in children in india. it has wide pharmacokinetic variability and has a narrow therapeutic range that leads to toxicity. there is some evidence of the association of long - term use of pht and toxicity like cerebellar atrophy. such cerebellar changes have been reported even with long - term use of nontoxic levels of phenytoin. we report a case of reversible cerebellar atrophy induced by pht in a 10-year - old boy.</s>"}
{"article": "since 2000 , over 160,000 children have come to the united states as international adoptees .  \nmore than 25% of these children have come from eastern european countries having received primarily institutional care .  \nchildren in these orphanages frequently endure significant social deprivation that may impact their physical growth due to suppression of hypothalamic function with consequent low levels of growth factors .   we and others have previously documented significant physical growth delays in up to 34% of international adoptees from eastern europe , south america , and asia     [ 35 ] . of the many hereditary , environmental , and hormonal factors that may contribute\n, we have previously shown that age , prenatal factors ( birth weight and risk of fetal alcohol syndrome ) , and growth factors ( insulin - like growth factor binding protein-3 , igfbp-3 ) are independently associated with the degree of growth delay in adoptees upon arrival into the us .\na rapid period of catch - up growth ( cug ) is seen following a variety of growth delays when the causative conditions improve .  \nthe growth hormone-(gh-)insulin - like growth factor ( igf ) system is known to be involved in cug following many causes of growth delay , but limited data are available on the role of gh - igf system in cug following adoption .\nthe goal of this prospective longitudinal study was to examine the determinants of cug in 148 postinstitutionalized international adoptees during the first 6 months after arrival into their adoptive families .\nwe aimed to identify baseline factors that would help predict subsequent cug and therefore help counsel the families , the degree of cug , the usefulness of obtaining igf - i and igfbp-3 levels , and the impact of nutrition on cug and the physiologic roles of nutrition and the growth hormone system on cug .\nparticipants were part of a longitudinal study of growth of institutionalized children adopted into the usa from eastern europe ( russia , kazakhstan , and ukraine ) .\nthe study was approved by the institutional review boards of the university of minnesota and inova fairfax hospital for children , and written informed consent was obtained from the adoptive parents .\nparticipants who were between 6 and 59 months of age at adoption were recruited and enrolled through the international adoption clinics at the university of minnesota and inova fairfax hospital for children between march 2004 and march 2007 .\nparticipants were examined within three weeks of arrival into the usa and then six months later .  \nauxological parameters included length or height ( average of triplicate measurements ) , single determinations of weight , and occipitofrontal circumference ( ofc ) .\nmidarm circumference , triceps , and subscapular skinfolds were also measured to assess the nutritional status of the adoptees in addition to liver function tests , total protein , and albumin , which are part of a routine pre - adoption evaluation .\npreadoption historical data , including birth weight ( bw ) and time spent in institutions , such as hospitals and orphanages , were obtained via parent interview and translated pre - adoption medical records provided by the adoptive parents .  \nchildren were classified as being at high risk for fetal alcohol syndrome ( fas ) if a moderate or severe facial phenotype was identified using facial photographic analysis software as previously described     [ 710 ] .  \nmothers recorded everything the child ate for three separate days in the two weeks prior to the clinic visit .\nthe diet records were reviewed for completeness , and mothers were contacted afterward for additional clarification , if necessary .\nthe diet records were entered into the nutrition data system for research software ( university of minnesota ) that generates intakes for 160 nutrients averaged over the three - day period of intake .\npercentage of the us dietary reference intakes ( dris ) were calculated using recommendations of the institute of medicine .\nserum ( 2.5  ml ) was obtained through venipuncture and stored at 20c until shipping .\n( calabasas , ca ) and reported as actual values and standard deviation scores ( sdss ) .\ntsh was defined as high if it was above the normal range of the assay ( 5.0  iu / ml ) .\nage- and gender - specific z scores for anthropometric variables were calculated based on the cdc 2000 growth charts using epi info 3.3 ( centers for disease control and prevention , atlanta , ga ) . for children older than 36 months\nage - specific percentiles for estimated annual height velocity were estimated from the figures and tables of roche and himes .\nanalyses were conducted on all subjects that had complete data for that analysis , and the numbers of available cases are reported , accordingly .\nchanges in mean growth variables within the same individuals were evaluated using paired t - tests , and tests among multiple means for independent groups were by analysis of variance .\nlinear regression models for growth status and change were developed by considering only the subset of potential independent variables whose spearman correlation coefficients with the dependent variables were statistically significant at p  .10 .  \nadjusted odds ratios describing associations of tertiles of kcal / kg , igf-1 , and igfbp-3 with subsequent cug were estimated from logistic regressions using cug ( 0.5 sd ) as a dichotomous - dependent variable and adjusting for gender , age , and high risk for fas status .\nthe mean age at the time of initial evaluation was 20 months ( range 759 months ) , which was on average 20  10 days after arrival into the usa ( table 1 ) .\nthe follow - up appointment was a mean of 6.05  0.86 months later .   as we have previously reported , international adoptees had significant growth failure upon arrival , which was more severe in children with low birth weight ( lbw , < 2500  g ; n = 34/104 , 32.7% ) and high risk for fas ( n = 10/132 , 7.6% ) .\nall three growth parameters were affected ; 22% of children were < 2 sds for height , 34% were < 2 sds for weight , and 12% were < 2 sds for ofc .\nten percent of children were wasted at baseline using weight - for - height < 2 sds .\nlow igf-1 and/or igfbp-3 levels ( < 2 sds ) were present in 32% ( 44 out of 136 ) at the initial visit .  \nliver function tests , total protein , and albumin were normal .   at baseline ,\nthe mid - arm circumference was slightly below average when normalized for age ( 0.73 sds , 12.4% < 2 sds ) and height ( 0.56 sds , 10.8% < 2 sds ) , and the weight for height was near normal ( 0.45  1.24 sds with 9.5% below 2 sds , table 1 ) . at 6 months , there was significant improvement in means for height sds , weight sds , ofc sds , weight for height sds , and igfbp-3 sds ( p\ncug , defined as a gain of > + 0.5 in height sds , was observed in 62% of children ( 82 out of 132 ) , and 23% ( 30 out of 132 ) gained > + 1 height sds over the six month period .  \n84% of children had height velocity greater than the 50th percentile for age with 55% greater than the 95th percentile ( figure 2 ) .\n90% of children had height velocity > 10  cm / yr and 12% > 20  cm / yr .  \nthe degree of cug was age dependent with mean growth velocities for children < 18 months = 16.9  3.6  cm / yr , 1830 months = 12.8  3.0  cm / yr , and > 30 months = 10.6  2.5  cm / yr ( p < .001 ) ( figure 2 ) .\nalthough the proportion of stunted children significantly decreased by 6 months , 6.8% of children ( n = 132 ) remained below 2 sds for height , 9.8% for weight , 8.5% for head circumference , and 4.5% for weight for height . despite significant cug in the group as a whole ,\nigf-1 and/or igfbp-3 remained low in a significant number of children ( 23% < 2 sds ) ( 29 out of 124 ) . in order to identify potential factors associated with cug\n, we examined the relationships of the change in auxological parameters and growth factors with a number of environmental , historical , physical , medical , and hormonal variables .\nyoung age , severity of short stature , and higher dietary intake at the initial visit were statistically significant independent predictors of improved growth ( delta ht sds ) ( table 2 ) .\nneither igf - i nor igfbp-3 sds was an independent predictor of delta ht sds . also , children in the lowest tertile of igf-1 sds were significantly more likely to show height cug than those in the highest tertile ( p = .042 , or = 4.9 , 95%ci : 1.122.9 ) .  \nalthough associated with baseline growth failure , lbw and being at high risk for fas were not significant predictors of cug in height .   however , low risk for fas children was more likely to show height cug than the high risk for fas children ( p = .007 , or = 34.8 , 95%ci : 2.7457.6 ) . excluding high risk for fas children from the regression analysis did not change the significant predictors\n. mid - arm circumference and baseline weight for height were not independently predictive of baseline height sds or degree of height cug .    because of the important role of nutrition in growth , we analyzed caloric intake at baseline and six months using a three - day diet record .\nmean caloric intake was higher than the dri at arrival ( % dri = 135  42 ; kcal / kg = 108  33 ) and was increased further at six months ( % dri = 157  42 ; kcal / kg = 125  34 ; p < .001 ) ( table 1 ) . at baseline ,\n76% of children were consuming greater than the dri ( 100% ) increasing to 93% at six months .  \nalthough mean height velocity was higher in younger children ( figure 2 ) and in those with higher caloric intake ( table 2 ) , the mean increases in caloric intake per kg did not significantly differ across different ages ( p > .3 by anova ) ( figure 3 ) .  \nthose children who had cug ( gain in height > + 0.5 sds ) had statistically significantly higher caloric intake at both baseline and 6 months ( table 3 ) compared with other children .  \ncaloric intake at 6 months was significantly correlated with subsequent change in height sds ( r = 0.318 , p = .001 ) .  \nchildren in the highest tertile of caloric intake / kg at the initial visit were also significantly more likely to show height cug than those in the lowest tertile of kcal / kg ( p = .033 , or = 4.2 , 95%ci : 1.115.9 ) .  \nrelatively lower baseline weight sds , higher birth weights , higher caloric intake , and lower baseline igfbp-3 sds were significant positive independent predictors of change in weight sds ( table 2 ) .\ncaloric intake at 6 months was also significantly correlated with the change in weight sds ( r = 0.441 , p <\nofc sds and ht sds were independent predictors of growth in ofc , so that children with relatively smaller heads and greater heights at baseline had the most improvement in subsequent head growth ( table 2 ) .  \nif children who were high risk for fas were excluded from the analysis , ht sds was no longer a significant independent predictor of subsequent ofc growth .   \nchildren who remained stunted were significantly older ( mean 32 months , range 14 to 59 ) , shorter ( mean 3.1 ht sds , range 2.1 to 4.1 ) , lighter   ( mean 2.5 wt sds , range 1.4 to 4.0 ) and had smaller heads ( mean 1.66 ofc sds , range 3.3 to 2 ) at the time of adoption than those who caught up ( table 4 ) .  \nthere were no significant differences in mean baseline growth factors in those who remained stunted compared to those who caught up .  \nthree of the children who had high risk for fas remained stunted at 6 months .  \nhowever , the degree of height cug ( delta ht sds ) in high risk for fas children was not statistically different from the larger cohort ( data not shown ) .   due to persistent short stature , children who did not catch - up by 6 months ( n = 6 ) were referred for pediatric endocrinology evaluation .   at the time of endocrine evaluation , five of these children\nthe four children who remained stunted , two were identified by provocative growth hormone stimulation testing as having growth hormone deficiency .   one female child with growth hormone deficiency , who was adopted at 14 months old and had associated optic nerve hypoplasia and fas , has demonstrated an excellent response to growth hormone therapy with height at the 25th percentile at last evaluation five years after adoption .\nthe pretreatment growth velocity was 6.8  cm / year ( gv sd not established ) compared to 12.3  cm / year ( + 2.96 sd ) after 1 year of treatment with growth hormone .\nthe other child a male who was 4 years old at the time of adoption with growth hormone deficiency was at low risk for fas and also demonstrated a good response to growth hormone treatment .\nthe pre - treatment growth velocity was 4.9  cm / year ( 0.82 sd ) compared to 6.9  cm / year ( + 2.12 sd ) after 1 year of treatment with growth hormone .\nhe is now growing along the 5th percentile at last evaluation on growth hormone therapy five years after adoption .  \nelevated tsh ( > 5 iu / ml , range 5.0611.60 ) was seen in international adoptees ( n = 18/110 , 16.4% ) at baseline with a normal free t4 level .   of the 18 children with elevated tsh at baseline , 6 had normal tsh at the 6-month follow - up ,\n7 had no follow - up tsh reported , and 5 had elevated tsh at the end of the study .   children with elevated tsh at the end of the study ( n = 5/110 , 4.5% ) were referred to a pediatric endocrinologist .\nin this prospective study of cug in children following international adoption , we found that significant growth failure was present at baseline as published before by the authors .   during the first 6 months after adoption , these children experienced substantial cug in length , weight , and ofc similar to previous cohorts [ 15 , 16 ] , and the degree of cug positively correlated with the young age and the time of adoption as observed by others\n. however , more than a third of children in this study did not show significant cug ( > + 0.5 sds ) during the 6-month follow - up period .  \n6.8% of children remained stunted ( < 2 ht sds ) at the end of the study , and two of these children were identified as having growth hormone deficiency .   older children with more severe baseline growth failure were more likely to remain stunted at follow - up .\nalthough our previous analyses showed that lbw , high risk for fas , and igfbp-3 were significantly and independently associated with height sds at the time of adoption , these variables were not significant independent predictors of subsequent height cug , which in the case of igfbp-3 was likely due to its correlation and colinearity with baseline ht sds .  \nchanges in igf-1 and igfbp-3 were positively correlated with linear growth , but were not independent predictors of growth restoration of adoptees .\ntherefore , it is likely that the improved nutrition and other changes , such as a more nurturing environment , have an important effect on the growth hormone axis influencing catch - up growth .   among the variables analyzed , only age , caloric intake ( per kg ) , and baseline height were found to be independent predictors of height cug .  \nprevious studies of cug following growth failure caused by other mechanisms have shown improvement in serum levels of components of the gh - igf system [ 17 , 18 ] . however , limited data are available on the role of gh - igf system in cug following adoption .\nwe found that although baseline serum igfbp-3 values correlated with the degree of linear growth failure   and igf-1 and igfbp-3 sds values improved in most children , neither igfbp-3 nor igf-1 was predictive of the degree of height cug in the first six months following adoption .\nthe finding that neither baseline growth factor levels nor the change in their values independently predicted the degree of cug in height was unexpected .    there are several potential explanations .\nit is possible that rapid changes in igf-1 levels could have occurred between the time that these children were united with their adoptive parents and when the igf-1 values were measured in the clinic .\nalternatively , low levels of igfbp-3 may primarily reflect baseline growth hormone status in some patients .  \nimprovement in igfbp-3 over time may improve the delivery of igf-1 to the target tissue .  \nfinally , it is possible that other related factors , such as baseline height or caloric intake , are more important than these growth factors in this early , rapid cug phase .  \nthese relationships suggest that although growth factors improve during this period , recovery from growth failure related to international adoption is a complex phenomenon that is dependent upon a number of factors and not solely related to restoration of normal function of the gh - igf system per se .  \ngrowth failure at the time of international adoption could represent a combination of malnutrition , reduced growth hormone secretion , and/or growth hormone resistance as observed in other conditions .\nfor example , children who suffer from intrauterine growth retardation have been shown to have growth hormone resistance , but normal growth hormone production . in psychosocial short stature ,\nreversible suppression of growth hormone secretion may also occur in hyperphagic short stature , which is a condition associated with disordered eating behaviors ( stealing food , hoarding food , foraging for discarded food ) that are commonly seen in institutional settings [ 21 , 22 ] .  \naccess to sufficient macro- and micronutrients to support growth is critically important and , worldwide , the most common cause of growth failure during childhood .\nnutritional demands vary depending on growth rates at different stages of development and any preexisting deficits due to pre- or postnatal malnutrition . during the most rapid growth phase between birth and 18 months the effects of even modest nutritional deficits\nmay become magnified in children within institutional care settings .   in this study , we found that 10% of the children were wasted ( wt < 2 sds ) on arrival that relative caloric intake was unusually high at baseline and substantially increased in most children .\nthe degree of cug for height and weight was related to calorie intake both at arrival and at six months .\nin addition , we have previously shown a high incidence of iron deficiency at adoption that persists at six months despite iron intake that is above the recommended daily allowance .\nthese findings emphasize the role of adequate nutrition support for cug in international adoptees and highlight the need to monitor feeding issues that could impact nutritional intake .\nwe found that the growth hormone axis , as measured by igf-1 and igfbp-3 , may be suppressed at baseline following international adoption .  \nage and severity of growth failure at the time of adoption are independent predictors of the degree of subsequent cug .\nlbw and high risk for fas , associated with baseline growth failure , are not significant predictors of the degree of subsequent cug , although a third of children who remained stunted after six months had facial features suggestive of fas .\nas nutritional intervention appears to be extremely important during the first 6 months after adoption , we recommend that adoptive parents be made aware of the need for increased calories beyond typical age requirements .\nif growth failure persists after 6 months of appropriate caloric intake , nutrition - independent causes should be considered , for example , growth hormone deficiency .\nthe older , the more severely stunted at the time of adoption , and those who are high risk for fas should be monitored most closely .", "human": " children raised in orphanages frequently experience growth suppression due to multiple risk factors . \n placing such children in more nurturing environments through adoption leads to significant catch - up growth ( cug ) , the determinants of which are not entirely understood . \n the goal of this study was to perform an auxological evaluation and examine the degree and correlates of cug in international adoptees . \n children adopted from eastern europe , ( n = 148 , 71 males ) , 7 to 59 months of age , were recruited within 3 weeks of their arrival to the us . at baseline , mean height sds was 1.2  1.1 and 22% were < 2 sds for height . \n igf-1 and/or igfbp-3 levels < 2 sds were present in 32% . \n cug , defined as a gain of > + 0.5 in height sds , was seen in 62% of adoptees at 6 months after adoption ; 7% of children remained < 2 sds for height ( two had growth hormone deficiency ) . \n growth factors improved in the majority of children . younger age , greater degree of initial growth failure , and higher caloric intake \n were significantly associated with improved linear growth in multiple regression models . in summary \n , most adoptees demonstrate excellent cug within six months after adoption . \n if growth failure persists after 6 months of appropriate caloric intake , nutrition - independent causes should be considered . ", "section_names": "1. Introduction\n2. Patients and Methods\n3. Results\n4. Discussion\n5. Conclusions", "bigbird_pegasus": "<s> a rapid period of catch - up growth ( cug ) is seen following a variety of growth delays in international adoptees from eastern european countries coming to the united states.<n> the growth hormone-(gh-)insulin - like growth factor ( igf ) system is known to be involved in cug following many causes of growth delay, but limited data are available on the role of gh - igf system in cug following adoption.<n> the goal of this prospective longitudinal study was to examine the determinants of cug in 148 postinstitutionalized international adoptees during the first 6 months after arrival into their adoptive families.<n> of the many hereditary, environmental, and hormonal factors that may contribute, we have previously shown that age, prenatal factors ( birth weight and risk of fetal alcohol syndrome ), and growth factors ( insulin - like growth factor binding protein-3, igfbp-3 ) are independently associated with the degree of growth delay in adoptees upon arrival into the us. in this prospective longitudinal study of 148 postinstitutionalized international adoptees, we found that age at arrival was the most important predictor of subsequent cug.<n> however, other factors were also significant independent predictors of subsequent cug.<n> these findings suggest that the gh - igf system is involved in the early, rapid cug phase of growth. the role of the gh - igf system in growth, growth and the effects of growth.<n> growth, growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n> growth.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>..<n>.<n> is the age..<n>.<n>.<n>.<n>.<n>.<n>.<n> is the age..<n> is the age.<n> is the age.<n> is the age.<n> is the age.<n>.<n> is the age.<n> is the age.<n> is the age.<n> is the age..<n> is the age..<n>.<n>.<n>", "longt5": "<pad> objective. to examine the determinants of catch - up growth ( cug ) in 148 postinstitutionalized international adoptees during the first 6 months after arrival into their adoptive families. methods. children were examined within weeks of arrival into the usa and then six months later. auxological parameters included length or height ( average of triplicate measurements ), single determinations of weight, and occipitofrontal circumference ( ofc ). children were classified as being at high risk for fetal alcohol syndrome ( fas ) if a moderate or severe facial phenotype was identified using facial photographic analysis software. results. at 6 months, there was significant improvement in means for height sds, weight sds, ofc sds, weight for height sds, and igfbp-3 sds ( p cug, defined as a gain of > + 0.5 in height sds ). children in the lowest tertile of igf-1 sds were significantly more likely to show height cug than those in the highest tertile ( p =.042, or = 4.9, 95%ci : 1.122.9 ). children in the lowest tertile of igf-1 sds were significantly more likely to show height cug than those in the highest tertile ( p =.042, or = 4.9, 95%ci : 1.122.9 ). children in the lowest tertile of igf-1 sds were significantly more likely to show height cug than those in the highest tertile ( p =.042, or = 4.9, 95%ci : 1.122.9 ). children in the highest tertile of caloric intake / kg at the initial visit were also significantly more likely to show height cug than those in the lowest tertile of kcal / kg ( p =.033, or = 4.2, 95%ci : 1.115.9 ). conclusions. age and severity of growth failure at the time of"}
{"article": "alzheimer s disease ( ad ) is a neurodegenerative disorder characterized by progressive cognitive and functional impairment and behavioural and psychological symptoms of dementia ( bpsd ) .\nthese neuropsychiatric symptoms commonly include delusions , hallucinations , agitation , disinhibition , apathy , irritability , anxiety , depression , sleep disturbances , and elation .\nbpsd are highly common in severe dementia , with 90% of individuals exhibiting at least one behaviour . up to 50% of patients exhibit\nit has previously been shown that even modest improvements in these behaviours can result in significant improvement in the quality of life ( qol ) for the patient .\nalthough there is still a lack of agreement about how qol should be defined and measured , it is generally considered to be a multidimensional construct that includes the individual s subjective experience of life , as well as objective criteria related to activities valued by society .\nengagement in positive activities , presence of positive affect , absence of negative affect , participation in meaningful activity , and a sense of community are assumed to be correlated with qol in late - stage dementia .\nthere is a growing consensus about the need to measure qol in dementia trials , as such assessments allow researchers to evaluate the benefits and harms of a treatment and elements of health not detected by standard clinical outcomes .\nhowever , it is very difficult to determine qol in persons with late - stage dementia as they can not communicate reliably and are not involved in activities widely accepted by others as rewarding . due\nthe severity of cognitive impairment of patients with moderate to severe ad , assessment must rely on proxy reports or direct observation .  \nunfortunately , both of these approaches tend to exclude consideration of the patient s subjective experiences , which many believe to be an inherent feature of qol .\nthe quality of life in late - stage dementia ( qualid ) scale was originally developed by weiner and co - workers in 2000 .\nthe qualid is a late - stage , dementia - specific questionnaire with a one - week window of observation .\nit provides information about the patient s quality of life through assessments made by proxy informants .\nthe scale consists of 11 items , comprising both positive and negative dimensions of concrete and observable mood and performance , thought to be indicative of qol in late - stage dementia .\nthe items are rated by frequency of occurrence on a five - step scale , and scores are summed to range from 11 ( best qol ) to 55 ( worst qol ) . while the qualid scale has been shown to obtain reliable estimates of qol and validated in patients with severe dementia residing in long - term care facilities , little is known about the scale s responsiveness to change due to therapeutic intervention .\nthe objective of this study was to assess the responsiveness of the qualid scale to changes in bpsd due to a therapeutic intervention in a population of long - term care residents with moderate to severe ad . as well , this study evaluated the relationship between the qualid scale and the severity of bpsd as determined by standard validated research scales .\npatients with moderate to severe ad ( mini - mental state examination [ mmse ] score  15 ) and agitation / aggression ( neuropsychiatric inventory  nursing home version [ npi]-total score  10 , npi - agitation / aggression score  1 ) at two long - term care sites were recruited to enter a three - month , open - label trial of 10 mg bid memantine , which has been shown to have a beneficial effect on memory and behaviour in ad patients .\nthis study was approved by the sunnybrook health sciences centre research ethics board , and was conducted in compliance with all relevant federal guidelines .\nassessments were conducted four times throughout the study : at baseline and months 1 , 2 , and 3 .\nnpi clinical global impression  caregiver ( cgi ) , and cohen - mansfield agitation inventory ( cmai ) were assessed at each visit by a trained research assistant with the patient s primary nurse .\nthe designated primary nurse working with the patient also completed the qualid at baseline and endpoint ( either month 3 or at time of discontinuation if the patient terminated early ) .\nthe npi assesses behavioural disturbances in nursing home patients with dementia and consists of 12 subscales examining specific symptom domains , including agitation / aggression and depression .\nthe cgi is a seven - point , observer - rated scale that measures global improvement or change and therapeutic response .\nthe cmai is a measurement of agitated behaviour in patients with dementia consisting of 29 behaviours rated on seven - point frequency and disruptiveness scales .\nthe mmse , used extensively in clinical research on patients with dementia as a measure of cognition , is scored on a scale of 030 based on various domains of cognitive functioning .\nthe analysis was based on the intent - to - treat ( itt ) population using last - observation - carried - forward ( locf ) .\nrepeated measure anova was conducted on assessments that were conducted monthly ( npi , cmai , cgi ) .\npaired sample t - tests were used to compare assessments that were conducted only at baseline and endpoint .\nthe p value was not adjusted for multiple comparisons due to the exploratory nature of the study .\nkendall correlation coefficients were obtained between the npi , cmai , cgi , and mmse scales with the qualid scale .\nstatistical calculations were performed using ibm spss statistics 20 ( spss inc . , chicago , il ) .\npatients with moderate to severe ad ( mini - mental state examination [ mmse ] score  15 ) and agitation / aggression ( neuropsychiatric inventory  nursing home version [ npi]-total score  10 , npi - agitation / aggression score  1 ) at two long - term care sites were recruited to enter a three - month , open - label trial of 10 mg bid memantine , which has been shown to have a beneficial effect on memory and behaviour in ad patients .\nthis study was approved by the sunnybrook health sciences centre research ethics board , and was conducted in compliance with all relevant federal guidelines .\nassessments were conducted four times throughout the study : at baseline and months 1 , 2 , and 3 .\nnpi clinical global impression  caregiver ( cgi ) , and cohen - mansfield agitation inventory ( cmai ) were assessed at each visit by a trained research assistant with the patient s primary nurse .\nthe designated primary nurse working with the patient also completed the qualid at baseline and endpoint ( either month 3 or at time of discontinuation if the patient terminated early ) .\nthe npi assesses behavioural disturbances in nursing home patients with dementia and consists of 12 subscales examining specific symptom domains , including agitation / aggression and depression .\nthe cgi is a seven - point , observer - rated scale that measures global improvement or change and therapeutic response .\nthe cmai is a measurement of agitated behaviour in patients with dementia consisting of 29 behaviours rated on seven - point frequency and disruptiveness scales .\nthe mmse , used extensively in clinical research on patients with dementia as a measure of cognition , is scored on a scale of 030 based on various domains of cognitive functioning .\nthe analysis was based on the intent - to - treat ( itt ) population using last - observation - carried - forward ( locf ) .\nrepeated measure anova was conducted on assessments that were conducted monthly ( npi , cmai , cgi ) .\npaired sample t - tests were used to compare assessments that were conducted only at baseline and endpoint .\nthe p value was not adjusted for multiple comparisons due to the exploratory nature of the study .\nkendall correlation coefficients were obtained between the npi , cmai , cgi , and mmse scales with the qualid scale .\nthirty - one patients were enrolled in the study , with an average age of 85.83.7 years . twenty - nine ( 94% ) were men .\nthe mean (  sd ) mmse score at baseline was 8.76.7 , reflecting moderate to severe cognitive impairment .\ntwenty - four patients ( 77.4% ) completed the study ; two died of causes unrelated to the memantine treatment , three discontinued due to increasing agitation , one for significant physical deterioration , and one for significantly increased somnolence . at baseline\n, patients had a mean qualid score of 21.36.2 , with a range from 13 to 40 .\ntable 1 provides the results of changes in outcome measurements over the course of the trial .\nthere were statistically significant differences in scores for npi total ( f3,90 = 4.035 , p = .010 ) and its subscale items : agitation / aggression ( f3,90 = 3.721 , p = .014 ) , and irritability ( f3,90 = 3.899 , p = .011 ) ; and cmai total ( f3,90 = 6.301 , p = .001 ) and its subscale items : physical aggression ( f3,90 = 5.928 , p = .001 ) and verbal aggression ( f3,90 = 3.961 , p = .011 ) .\nno significant improvements were found for qualid ( t = 0.278 , p = .783 ) , mmse ( t = 0.819 , p = .419 ) , or cgi ( f3,84 = 0.760 , p = .520 ) .\noutcome measures at baseline and endpoint qualid scores were compared with scores on the npi , cmai , and cgi at baseline and endpoint ( table 2 ) . at both baseline and endpoint ,\nthe qualid scale was correlated with npi total score ( baseline :  = 0.270 , p = .037 ; endpoint :  = 0.404 , p = .002 ) , npi depression ( baseline :  = 0.332 , p = .022 ; endpoint :  = 0.381 , p = .008 ) , npi irritability ( baseline :  = 0.288 , p = .034 ; endpoint :  = 0.346 , p = .011 ) , and cmai verbal aggression ( baseline :  = 0.349 , p = .009 ; endpoint :  = 0.294 , p = .028 ) .\nthe qualid was correlated with npi agitation / aggression only at endpoint (  = 0.414 , p = .002 ) , as was npi anxiety (  = 0.290 , p = .049 ) , npi hallucinations (  = 0.456 , p = .002 ) , npi disinhibition (  = 0.322 , p = .026 ) and cmai total (  = 0.277 , p = .032 ) .\nkendall correlations between qualid and other measures correlations between change scores of qualid and other measures between baseline and endpoint\ncorrelations were calculated between change scores for the qualid and npi total , npi subscales , cmai and cgi ( table 3 ) .\nqualid change scores were correlated with change scores in npi apathy (  = 0.345 , p = .012 ) .\nhowever , there were no significant correlations between qualid and cmai , cgi , npi total or any subscales that were correlated with qualid scores at either baseline or endpoint .\nconcurrent validity was tested by comparing changes scores in patients who improved ( n = 19 ) based on the npi and patients who did not . a decrease in 4 points in baseline score\nmean change in qualid was similar between groups ( t = 0.873 , p = .390 ) .\nit has been suggested that treatments designed to alleviate bpsd may have beneficial effects for patients qol , as a strong relationship between bpsd and qol has been previously observed .\nthe significant relationship between the npi and cmai with the qualid scores at baseline and final assessment suggest that qol is associated with behavioural symptoms in moderate to severe ad .\nthis result supports conclusions drawn by previous studies examining the relationship between the qualid scale and bpsd at a single point in time ; however , changes in the qualid score from baseline to endpoint did not correlate with change scores on the npi , cmai or cgi .\nthis lack of relationship suggests that the qualid scale may not be responsive to changes in bpsd .\nconcurrent validity was also tested , by comparing qualid change scores in patients who improved based on the npi and patients who did not . as the mean change in qualid scores was similar between both groups\n, this once again suggests that the qualid may not be responsive to changes in bpsd .\na previous study looking at the responsiveness of the qualid scale to drug treatment found that the qualid was responsive to the changes in bpsd .\nthe discrepancy in this finding may be due to the difference in study length ( i.e. , 14 days in the previous study compared to three months in the current ) .\nit is possible that any short - term benefits from decreased behavioural problems are washed out by deterioration in overall health status over the long term .\nthe population in the previous study included 31 late - stage dementia patients residing in long - term care facilities who were given either olanzapine or risperidone .\nthe patients had a mean baseline qualid of 30.94 and mean npi of 53.48 , both of which are higher than those of the current study and other papers that have studied the qualid scale .\nthis study design reflects a more realistic timeframe for a therapeutic intervention , and is comparable to many other studies using antipsychotics , with a drug that has been shown to improve behavioural symptoms in moderate to severe ad .\nthe population is similar to most other studies in terms of mean qualid and mmse scores , even though the npi scores were slightly higher than those previously shown .\ntherefore , this analysis presents an appropriate design for a study involving patients with moderate to severe alzheimer s disease residing in long - term care facilities and , as a result , should provide more applicable conclusions regarding the responsiveness of the qualid scale to change when a therapeutic intervention is implemented .\nit is also unclear whether family caregiver assessment of qol would differ from nurses assessments .\nit is possible that results attained from the qualid scale are accurate , and that to make an impact in patients qol over the long term , larger changes in behaviour , cognition , and function are necessary .\nanother possibility is that the effects of memantine were not strong enough to elicit a change in qol in the long - term , despite significant improvements in behaviour rating scales .\nanother limitation is the fact that the majority of the patients in this study were male , and therefore the results may not necessarily be applicable to the general population of institutionalized patients with dementia .\nhowever , gender does not appear to have a significant effect on quality of life in those with dementia .\nwhile one study did find that being female was a significant predictor of lower quality of life as measured by the qualid , there was no difference between males and females in actual qualid scores , and the authors did not consider the results robust .\nit is also unclear whether family caregiver assessment of qol would differ from nurses assessments .\nit is possible that results attained from the qualid scale are accurate , and that to make an impact in patients qol over the long term , larger changes in behaviour , cognition , and function are necessary .\nanother possibility is that the effects of memantine were not strong enough to elicit a change in qol in the long - term , despite significant improvements in behaviour rating scales .\nanother limitation is the fact that the majority of the patients in this study were male , and therefore the results may not necessarily be applicable to the general population of institutionalized patients with dementia .\nhowever , gender does not appear to have a significant effect on quality of life in those with dementia . while one study did find that being female was a significant predictor of lower quality of life as measured by the qualid , there was no difference between males and females in actual qualid scores , and the authors did not consider the results robust .\nqol assessments provide another format for individuals and their caregivers to express whether an intervention made an important difference in the patient s life . as important clinical decisions\nmay be drawn from perceived qol effects , it is vital that the qol data be reliable , valid , and responsive to change .\nalthough the qualid scale demonstrated that qol is associated with bpsd in moderate to severe ad , it was unable to reflect change when a therapeutic intervention for bpsd was implemented .\nthese results suggest that methods of assessing qol in moderate to severe ad that are responsive to change are still needed , especially if they are to play an important role in assessing treatment benefits .", "human": " backgroundthis study aimed to determine whether the quality of life in late - stage dementia ( qualid ) scale is responsive to changes in behaviour due to therapeutic intervention.method31 long - term care residents with moderate to severe ad and agitation / aggression entered a three - month , open - label trial of memantine 10 mg bid . \n the relationships between the qualid and bpsd , global improvement , and cognition at baseline and endpoint , as well as the changes in these scales as a result of treatment , were examined.resultsdespite a significant improvement in agitation and aggression ( npi agitation , f3,90 = 3.721 , p = .014 ; cmai total , f3,90 = 6.301 , p = .001 ) and overall behaviour ( npi total , f3,90 = 4.035 , p = .010 ) , there was no significant change in qualid score ( t30 = 0.278 , p = .783 ) . \n the qualid was correlated with npi at baseline (  = 0.270 , p = .037 ) and endpoint (  = 0.404 , p = .002 ) , but change scores were not correlated (  = 0.107 , p = .412).conclusionwhile the qualid correlates with behavioural measures at single time points , it does not appear to correlate with changes longitudinally associated with treatment . ", "section_names": "INTRODUCTION\nMETHODS\nStudy Procedure\nStudy Analysis\nRESULTS\nResponsiveness\nDISCUSSION\nLimitations\nCONCLUSION\nCONFLICT OF INTEREST DISCLOSURES", "bigbird_pegasus": "<s> backgroundthere is a growing consensus about the need to measure the quality of life ( qol ) in dementia trials, as such assessments allow researchers to evaluate the benefits and harms of a treatment and elements of health not detected by standard clinical outcomes. however, it is very difficult to determine qol in persons with late - stage dementia as they can not communicate reliably and are not involved in activities widely accepted by others as rewarding. while the quality of life in late - stage dementia ( qualid ) scale has been shown to obtain reliable estimates of qol and validated in patients with severe dementia, little is known about the scale s responsiveness to change due to a therapeutic intervention in a population of long - term care facilities.<n> the objective of this study was to assess the responsiveness of the qualid scale to changes in behavioural and psychological symptoms of dementia ( bpsd ) due to a therapeutic intervention in a population of long - term care facilities.methodsthe qualid was administered to a population of long - term care facilities that care for persons with moderate to severe alzheimer s disease ( ad ).<n> assessment was conducted monthly for a period of three months.<n> change scores on the 11 items of the qualid scale were correlated with change scores on the neuropsychiatric inventory nursing home version [ npi]-total score 15.<n> the npi clinical global impression caregiver ( npi - total score 15, npi total score 15. the npi total, the npi total. the n, the n. the n, the n, the n.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>..<n> the n.........................<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>.<n>.<n><n>.<n>", "longt5": "<pad> objective : to assess the responsiveness of the quality of life in late - stage dementia ( qualid ) scale to changes in behavioural and psychological symptoms of dementia ( bpsd ) due to a therapeutic intervention in a population of long - term care residents with moderate to severe alzheimer s disease.methods:patients with moderate to severe alzheimer s disease ( mini - mental state examination [ mmse ] score 15 ) and agitation / aggression ( neuropsychiatric inventory nursing home version [ npi]-total score 10, npi - agitation / aggression score 1 ) at two long - term care sites were recruited to enter a - month, open - label trial of 10 mg bid memantine. assessments were conducted four times throughout the study : at baseline and months 1, 2, and 3. kendall correlation coefficients were obtained between the npi, cmai, cgi, and mmse scales with the qualid scale.results:there were statistically significant differences in scores for npi total ( f3,90 = 4.035, p =.010 ) and its subscale items : agitation / aggression ( f3,90 = 3.721, p =.014 ), and irritability ( f3,90 = 3.899, p =.011 ) ; and cmai total ( f3,90 = 6.301, p =.001 ) and its subscale items : physical aggression ( f3,90 = 5.928, p =.001 ) and verbal aggression ( f3,90 = 3.961, p =.011 ). no significant improvements were found for qualid ( t = 0.278, p =.783 ), mmse ( t = 0.819, p =.419 ), or cgi ( f3,84 = 0.760, p =.520 ). at both baseline and"}
{"article": "out - of - hospital cardiac arrest is still a major public health issue , claiming hundreds of thousands of lives worldwide yearly .\nbystander - initiated cardiopulmonary resuscitation ( cpr ) is essential to increase the chance of survival and neurological recovery . despite huge efforts to train laypeople to recognize and treat cardiac arrest , incidence of bystander\nreluctance to perform mouth - to - mouth ventilation is one of the major reason . whereas cpr including ventilation is still considered the gold standard approach before advanced life support can be instituted , a growing number of studies compared a simplified form of cpr , based on chest compression alone versus standard cpr including ventilation .\nanimal studies showed no difference in survival   or even worse outcomes   when ventilation was added to chest compressions ; nevertheless , in animal models of cardiac arrest due to respiratory causes a positive effect of ventilations was demonstrated . in humans ,\nobservational studies of bystander - initiated cpr comparing standard and compressions - only cpr reported similar survival rates ; however , interpretation of the results is made difficult due to the high heterogeneity of the causes of cardiac arrest and of the rescue characteristics .\nchest compression - only cpr is simpler than standard cpr to teach ( during courses but even by dispatchers under real conditions ) , and likely a higher percentage of bystanders would accept to perform it while avoiding mouth - to - mouth contact : the demonstration that it is ( at least ) as effective as standard cpr can be crucial to improve survival rate in out - of - hospital cardiac arrest .   with the underlying hypothesis that out - of - hospital cardiac arrest bystander - initiated compression\n- only cpr is equivalent to cpr including ventilation ( standard cpr ) , we performed a comprehensive systematic review and meta - analysis of randomized controlled trials , focusing on survival at hospital discharge .\npertinent studies were independently searched in biomedcentral , central , and pubmed ( updated september 1 , 2010 ) by several trained investigator .\n( cpr or resuscitation ) and compression and breath * and cardiac and arrest and survival )  . further hand or computerized searches involved the recent ( 2008 - 2010 ) conference proceedings from the international anesthesia research society , american heart association , american college of cardiology , american society of anesthesiology and european society of cardiology congresses .\nin addition , we employed backward snowballing ( ie scanning of reference of retrieved articles and pertinent reviews ) and contacted international experts for further studies .\nno language restriction was enforced , and non - english - language articles were translated when appropriate .\nreferences obtained from database and literature searches were first independently examined at the title / abstract level by several investigators with divergences resolved by consensus , and then , if potentially pertinent , retrieved as complete articles .  \nthe following inclusion criteria were employed for potentially relevant studies : a. random allocation to treatment ; b. comparison of chest - compression - only versus standard cpr .\nthe exclusion criteria were : a. non - parallel design ( ie cross - over ) randomized trials , b. duplicate publications ( in this case only the article reporting the longest follow - up was abstracted ) ; c. non - human experimental studies ; two investigators independently assessed compliance to selection criteria and selected studies for the final analysis , with divergences finally resolved by consensus ( table 1 ) .\ndesign features and appraisal of the internal validity of included studies . * data abstraction and study characteristics \n  baseline and outcome data were independently abstracted by several investigators with divergences resolved by consensus ( table 2 ) .\nthe primary end - point of the present review was survival ( hospital discharge ) .\noverall characteristics of 3737 patients who received either compression - only ( 1852 patients ) or standard - cpr ( 1895 patients ) for out of hospital cardiopulmonary resuscitation .\ninternal validity assessment \n  the internal validity of included trials was appraised according to the cochrane collaboration methods , ie judging the risk for selection bias ( ie the bias due to the unbalanced enrolment of specific patient subsets in one of the groups ) , performance bias ( ie the bias due to differences in the management of patients or ancillary treatment , beyond the intervention object of randomized allocation ) , attrition bias ( ie the bias due to incomplete follow - up or different length of follow - up ) , or difference in number of withdrawals ) , and reporting bias ( difference between reported and unreported findings ) , and expressed as low risk of bias ( a ) , moderate risk of bias ( b ) , high risk of bias ( c ) , or incomplete reporting leading to inability to ascertain the underlying risk of bias ( d ) . in addition , allocation concealment explicitly distinguished as adequate ( a ) , unclear ( b ) , inadequate ( c ) , or not used ( d ) ( table 1 ) .\ntwo independent and experienced reviewers ( gl , gb - z ) appraised study quality , with divergences resolved by consensus .  \n\ndata analysis and synthesis \n  binary outcomes from individual studies were analyzed in order to compute individual risk ratios ( rr ) with pertinent 95% confidence intervals ( ci ) , and a pooled summary effect estimate was calculated by means of a fixed effects model .\nstatistical heterogeneity and inconsistency was measured using , respectively , cochrane q tests and i. the risk of small study bias was not assessed given the inclusion of 3 studies only .\ncomputations were performed with revman 5.0 ( the cochrane collaboration , copenhagen , denmark ) .\ndatabase searches , snowballing and contacts with experts yielded a total of 32 citations ( figure 1 ) . excluding 29 non - pertinent titles or abstracts , we retrieved in complete form and assessed according to the selection criteria 3 studies . which were included in the final analysis .\nstudy characteristics the 3 randomized controlled studies included 3737 patients ( 1895 to chest - compression - only and 1842 to the standard cpr group ) ( table 2 ) .\nall studies were performed in non - traumatic out of hospital patients and stated that the updated international basic life support and advanced life support guidelines were strictly followed .\nall studies were of high quality ( table 1 ) as testified by the details on the method used for randomized sequence generation and allocation , adequate allocation concealment and low risk of selection , performance , attrition and detection bias .\none study employed a multicenter design , a feature which does not strictly impact on internal validity , but usually increases external validity of a trial .\nquantitative data synthesis overall analysis showed that , in comparison to standard cpr , chest - compression - only was associated to increased survival at hospital discharge ( 211/1842 [ 11.5% ] vs 178/1895 [ 9.4% ] , rr=1.24 [ 1.01 - 1.54 ] , p=0.04 ) ( figure 2 ) .\nforest plot for the comparison of standard cpr vs compression - only cpr on hospital survival after cardiopulmonary resuscitation .\nsimilar results were obtained at sensitivity analyses using random - effect methods or risk differences ( all p<0.05 ) .  \nonly one study   considered the favourable neurological outcome suggesting better outcome in clinical subgroups of patients receiving chest - compression - only .\navailable evidence from randomized controlled trials strongly supports the superiority of bystander - initiated compression - only cpr , given that patients who experienced out - of - hospital cardiac arrest could be saved by limiting cpr to chest compression .\nthese results are crucial to significantly improve the first response to out - of - hospital cardiac arrests , a worldwide major public health problem .\nprevious findings from observational studies in humans   documented that spontaneously performed ( i.e. , not dispatcher instructed ) compression - only cpr was as effective as standard cpr . in the sos - kanto study , including witnessed cardiac arrests , compression - only cpr resulted in a higher proportion of patients with a favourable neurological outcome than standard cpr in patients with apnoea , shockable rhythm and resuscitation started within 4 minutes ; ventilations did not add benefits in any subgroup . on the contrary , two recent nationwide observational studies   conducted in japan concluded that standard cpr should be preferred in out - of - hospital cardiac arrests of noncardiac origin , both in adults and in children ; in this group , the two cpr techniques were similarly effective for arrests of cardiac origin . among the tree randomized controlled studies included in this meta - analysis , only one study   included paediatric patients < 8 years old , but results of this subgroup were not separately reported ; the study by rea et coworkers reported a tendency towards a worse efficacy of compression - only cpr than standard cpr in cardiac arrests of noncardiac origin , and a tendency towards a better efficacy in shockable rhythm and in rapid ( < 6 minutes ) response by the emergency medical system\n.   the results of the present meta - analysis are consistent with the most recent observational study on 4415 cardiac arrests not due to trauma or asphyxia , drug overdose or drowning , in which a 5-years data collection was accompanied by a statewide public education campaign aimed to increase bystander compression - only cpr . in this study ,\nthe incidence of bystander - initiated cpr increased every year , as did the proportion of compression - only cpr ; more importantly , overall survival increased significantly over time .\noverall survival to hospital discharge was equal between the no bystander cpr and the standard cpr groups , while survival and neurological outcome were significantly better in the compression - only cpr group ; compression - only cpr resulted particularly effective when the cardiac arrest was witnessed and presented with a shockable rhythm . in 1128\npatients with cardiac arrest of presumed noncardiac origin , not included in the study , survival was lower and not different among the two technique and no bystander cpr .  \nit is well documented that both interruptions of chest compressions during ventilation and positive -pressure ventilations have detrimental effects on survival rate .\noxygenation and ventilation could be allowed - at least initially- by passive ventilation during chest compressions , by spontaneous gasping and by the lungs capacity to act as a reservoir   in addition , compression - only cpr is easier to teach , to remember and to perform , and it does not require mouth - to - mouth contact , so resulting in a better willingness to start cpr by bystanders .\nit is worth noting that in two of the three analyzed studies   bystanders randomly assigned to standard cpr were significantly more likely to withhold cpr than callers assigned to compression - only group .  \nbased on our findings , compression - only cpr should be considered as the preferred bystander cpr technique , even if ventilations still have a crucial role in cardiac arrests of presumed noncardiac origin , in children   and when resuscitation is started more than 4 minutes after the arrest . .\nhowever , it should be considered that most victims of cardiac arrest are adults , and the cause is cardiac in about 2/3 of cases .  \nthe importance of ventilations in cardiac arrests lasting more than 3 - 4 minutes is more controversial , as two recent studies in a porcine models reported contradictory results .  \nlikely laypersons training on cpr should be simplified to privilege compression - only cpr ; in 2008 the american heart association already recommended that untrained bystanders should provide compression - only cpr for adults with sudden cardiac arrest .\nhowever , fatigue can be a relevant problem decreasing the quality of compressions and a change of cpr providers every one minute instead of every two minutes has been suggested .\navailable evidence from randomized controlled trials suggests that compression - only cpr is superior to standard cpr at least when performed by untrained bystander .\nthese results have relevant implications on teaching , and if adequately publicized they should favour a crucial increase in the rate of bystanders performed cpr .", "human": " introductionout - of - hospital cardiac arrest has a low survival rate to hospital discharge . \n recent studies compared a simplified form of cpr , based on chest compression alone versus standard cpr including ventilation . \n we performed systematic review and meta - analysis of randomized controlled trials , focusing on survival at hospital discharge.methodswe extensively searched the published literature on out - of hospital cpr for non traumatic cardiac arrest in different databases.resultswe identified only three randomized trials on this topic , including witnessed and not - witnessed cardiac arrests . \n when pooling them together with a meta - analytic approach , we found that there is already clinical and statistical evidence to support the superiority of the compression - only cpr in terms of survival at hospital discharge , as 211/1842 ( 11.5% ) patients in the chest compression alone group versus 178/1895 ( 9.4% ) in the standard cpr group were alive at hospital discharge : odds ratio from both peto and dersimonian - laird methods = 0.80 ( 95% confidence interval 0.65 - 0.99 ) , p for effect = 0.04 , p for heterogeneity = 0.69 , inconsistency = 0%).conclusionsavailable evidence strongly support the superiority of bystander compression - only cpr . \n reasons for the best efficacy of chest compression - only cpr include a better willingness to start cpr by bystanders , the low quality of mouth - to - mouth ventilation and a detrimental effect of too long interruptions of chest compressions during ventilation . \n based on our findings , compression - only cpr should be recommended as the preferred cpr technique performed by untrained bystander . ", "section_names": "Introduction\nMethods\nResults\nDiscussion\nConclusions", "bigbird_pegasus": "<s> bystander - initiated cardiopulmonary resuscitation ( cpr ) is essential to increase the chance of survival and neurological recovery in out - of - hospital cardiac arrest. despite huge efforts to train laypeople to recognize and treat cardiac arrest, incidence of bystander reluctance to perform mouth - to - mouth ventilation is one of the major reasons. whereas cpr including ventilation is still considered the gold standard approach before advanced life support can be instituted, a growing number of studies compared a simplified form of bystander - initiated cpr, based on chest compression alone versus standard cpr including ventilation. in humans, observational studies of bystander - initiated cpr comparing standard and compressions - only cpr reported similar survival rates ; however, interpretation of the results is made difficult due to the high heterogeneity of the causes of cardiac arrest and rescue characteristics.<n> chest compression - only cpr is simpler than standard cpr to teach ( during courses but even by dispatchers under real conditions ), and likely a higher percentage of bystanders would accept to perform it while avoiding mouth - to - mouth contact : the demonstration that it is ( at least ) as effective as standard cpr can be crucial to improve survival rate in out - of - hospital cardiac arrest.</s>", "longt5": "<pad> background and objectives : bystander - initiated cardiopulmonary resuscitation ( cpr ) is essential to increase the chance of survival and neurological recovery. despite huge efforts to train laypeople to recognize and treat cardiac arrest, incidence of bystander reluctance to perform mouth - to - mouth ventilation is one of the major reasons. whereas cpr including ventilation is still considered the gold standard approach before advanced life support can be instituted, a growing number of studies compared a simplified form of cpr, based on chest compression alone versus standard cpr including ventilation. in humans, observational studies of bystander - initiated cpr comparing standard and compressions - only cpr reported similar survival rates ; however, interpretation of the results is made difficult due to the high heterogeneity of the causes of cardiac arrest and the rescue characteristics. we performed a comprehensive systematic review and meta - analysis of randomized controlled trials, focusing on survival at hospital discharge.methods:relevant studies were independently searched in biomedcentral, central, and pubmed ( updated september 1, 2010 ) by several trained investigators. further hand or computerized searches involved the recent conference proceedings from the international anesthesia research society, american heart association, american college of cardiology, american society of anesthesiology and european society of cardiology congresses. backward snowballing and contacts with experts yielded a total of 32 citations. excluding 29 non - pertinent titles or abstracts, we retrieved in complete form and assessed according to the selection criteria 3 studies. data analysis and synthesis binary outcomes from individual studies were analyzed in order to compute individual risk ratios ( rr ) with pertinent 95% confidence intervals ( ci ), and a pooled summary effect estimate was calculated by means of a fixed effects model.results:there was no difference in survival between the no bystander cpr and the standard cpr groups. overall analysis showed that, in comparison to standard cpr, chest - compression - only was associated to increased survival at hospital discharge ( 211/1842 [ 11.5%"}
{"article": "such proteins perform many basic functions including cell signalling , transcription regulation , energy conservation and transformation , and ion exchange .\nmembrane proteins are difficult to study , since they are inserted into lipid bilayers and expose to the polar outer and inner environments portions of different sizes .\nit is therefore difficult to purify them in the native , functional form and even more difficult to crystallize them . for such technical reasons , only a small fraction of the protein data bank structures\nare membrane proteins ( < 1% of the total number of structures and far less than their estimated abundance in cells ) ( 1 ) .\nthere are a number of computational methods available to predict the topology of membrane proteins , which consists of two basic features : ( i ) the location of transmembrane domains along the protein chain and ( ii ) the location of the n- and c - termini with respect to the lipid membrane .\ntopological models are sufficient in many instances to design simple experiments in order to prove the location of the n- and c - protein termini , that of the inner and outer loops with respect to the membrane plane , and concomitantly the number of transmembrane segments in the chain\n. however , the best - performing methods are offered at different servers and are endowed with different graphical interfaces .\nthis hampers the direct comparison of predictions , especially for experimentalists interested in comparing their results with computational methods .\ncurrently , two other web servers of which we are aware ( 2,3 ) are available and separately comprise two of the predictors that we implement tmhmm2.0 ( 4 ) and memsat ( 5 ) .\nthe novelty of our web server is to include in the same framework ensemble ( 6 ) and prodiv ( 7 ) , two powerful methods that became available only recently .\nfurthermore the available web servers render only the consensus prediction , without allowing a critical discrimination among different predictions that may be useful , considering that different predictors may highlight different properties , depending on the different implementation .\nautomatic topology annotation for membrane proteins has been included among the efforts of the biosapiens european network of excellence ( ) with the specific aim of taking into consideration different predictors for annotating membrane proteins in the human genome .\nthe common platform for these efforts is the biosapiens distributed annotation servers ( das ) ( ) . in this context\n, the pongo - das server ( ) provides topology annotation for the all - alpha membrane proteins of the human genome .\nthis is done using the das protocol ( ) to answer at das queries that can be seen using specific visualizers such as dasty ( 8) or ensembl ( 9 ) . in order to allow users to browse directly the pre - computed transmembrane annotations\nthe annotation is carried out using four selected predictors , namely ensemble1.0 ( 6 ) and prodiv ( 7 ) , in order to allow a direct comparison of the topology prediction for the sequence at hand .\nthe server has also been set up to make it possible to predict the topology of any putative membrane proteins of interest regardless of provenance .\nthe topological models computed by the different predictors can be directly obtained simply by pasting in a box the sequence of interest and looking at the results .\nrecently developed web technologies ( e.g. ajax ) are used to improve the user interface .\nthe website implements the following predictors : memsat is a new version of the memsat predictor of transmembrane helices in proteins ( 4 ) .\ntmhmm2.0 which is a predictor of transmembrane helices in proteins based on hidden markov models ( 5 ) .\nit has been shown that it performs quite well taking into account that it uses only single sequence information .\nensemble1.0 is an ensemble of two hidden markov models and one neural network ( 6 ) .\nensemble takes also advantage of the evolutionary information derived by multiple sequence alignment , both for the neural network and the hidden markov model systems .\nprodiv_tmhmm_0.91 is a recent predictor of transmembrane helices in proteins ( 7 ) which uses a hidden markov model similar to tmhmm , but exploits the evolutionary information derived by multiple sequence alignment .\nspep is a signal peptide predictor based on combination of neural networks ( 10 ) .\nthis predictor has performance similar to the most widely used signalp ( 11 ) , and it has been included since it is quite common that signal peptides are mispredicted as transmembrane helices . in the context of the biosapiens project , we downloaded the uniprot dataset ( september 22 , 2004 ) which consists of 33  135 human protein sequences , and for future use also the ipi dataset ( august 5 , 2004 ) which consists of 46  782 human proteins .\nthe union of the two datasets comprises 50  600 sequences from the human genome .\nit is worth noticing that these 50 600 sequences do not include the known splice variants , since those variants are not presently included as unique uniprot codes .\nthe choice of annotating uniprot sequences is well justified from the fact that ensembl gene products ( in contrast to the uniprot entries ) are not stable ; for instance , only 60% of the sequences are common ( and conserved ) between the ensembl releases 34 and 35 , respectively .\nwe then use four state - of - the - art predictors already described in the literature in order to identify the most probable integral membrane proteins . in this way\nthe union of the predictions obtained with the four methods gives a set of likely membrane proteins , while the intersection contains those chains on whose annotation as membrane proteins all the predictors agree upon .\nthe pre - computed annotations are filtered with spep before being processed by the transmembrane predictors .\nthis is done since it is quite common that signal peptides are mispredicted as transmembrane helices by all the predictors implemented in our web server . in the case of a positive spep answer\n, the system cuts the corresponding predicted segment and processes the remaining part of the sequence with the four transmembrane predictors .\nthe website implements the following predictors : memsat is a new version of the memsat predictor of transmembrane helices in proteins ( 4 ) .\ntmhmm2.0 which is a predictor of transmembrane helices in proteins based on hidden markov models ( 5 ) .\nit has been shown that it performs quite well taking into account that it uses only single sequence information .\nensemble1.0 is an ensemble of two hidden markov models and one neural network ( 6 ) .\nensemble takes also advantage of the evolutionary information derived by multiple sequence alignment , both for the neural network and the hidden markov model systems .\nprodiv_tmhmm_0.91 is a recent predictor of transmembrane helices in proteins ( 7 ) which uses a hidden markov model similar to tmhmm , but exploits the evolutionary information derived by multiple sequence alignment .\nspep is a signal peptide predictor based on combination of neural networks ( 10 ) .\nthis predictor has performance similar to the most widely used signalp ( 11 ) , and it has been included since it is quite common that signal peptides are mispredicted as transmembrane helices .\nin the context of the biosapiens project , we downloaded the uniprot dataset ( september 22 , 2004 ) which consists of 33  135 human protein sequences , and for future use also the ipi dataset ( august 5 , 2004 ) which consists of 46  782 human proteins .\nthe union of the two datasets comprises 50  600 sequences from the human genome .\nit is worth noticing that these 50 600 sequences do not include the known splice variants , since those variants are not presently included as unique uniprot codes .\nthe choice of annotating uniprot sequences is well justified from the fact that ensembl gene products ( in contrast to the uniprot entries ) are not stable ; for instance , only 60% of the sequences are common ( and conserved ) between the ensembl releases 34 and 35 , respectively .\nwe then use four state - of - the - art predictors already described in the literature in order to identify the most probable integral membrane proteins . in this way\nthe union of the predictions obtained with the four methods gives a set of likely membrane proteins , while the intersection contains those chains on whose annotation as membrane proteins all the predictors agree upon .\nthe pre - computed annotations are filtered with spep before being processed by the transmembrane predictors .\nthis is done since it is quite common that signal peptides are mispredicted as transmembrane helices by all the predictors implemented in our web server . in the case of a positive spep answer ,\nthe system cuts the corresponding predicted segment and processes the remaining part of the sequence with the four transmembrane predictors .\npongo has two different usage options : \n pongo - das accessing the pre - computed annotations using keywords or das queries;pongo - pred that is an enhanced and modern version of a standard  through - the - web server application .\npongo - das accessing the pre - computed annotations using keywords or das queries ; pongo - pred that is an enhanced and modern version of a standard  through - the - web server application . in the case of pongo - das we implemented two types of result visualization : \n by means of a das , which is a client  server system in which a single client integrates information from multiple servers .\nit allows a single machine to gather up genome annotation information from multiple distant web sites , collate the information , and display it to the user in a single view .\nlittle coordination is needed among the various information providers , anda user - friendly interface that allows the search for a specific prediction.through the das protocol a web client like ensembl can obtain the list of the annotations for each human protein using its uniprot code as requested for the das queries ( ) ; in order to check this url the client needs a das client such as the one that will be embedded in ensembl pages at ebi and a uniprot code for the sequence .\na user can directly query the database , without using the das infrastructure , using the web interface available at   ( figure 1 ) the user can then use a crc64 ( the sequence hash code ) , or the sequence uniprot or ipi code to get the predictions in a graphical view .\nan example of a sequence filtered with the different predictors is presented together with the detailed sequence annotation ( figure 2 ) .\na colour code is used to quickly identify the transmembrane segments . by means of a das , which is a client  server system in which a single client integrates information from multiple servers .\nit allows a single machine to gather up genome annotation information from multiple distant web sites , collate the information , and display it to the user in a single view .\nlittle coordination is needed among the various information providers , and a user - friendly interface that allows the search for a specific prediction .\nconversely , pongo - pred provides the user with a unique framework for membrane protein topology and signal peptide predictions .\nanother interesting feature of pongo - pred is the javascript - enabled portlet that in real time refreshes the queue status ( without reloading of the submission page and with very lightweight xml http requests ) . in particular , on the left - side of the page the user can realise whether her / his submission is a new call , whether it is running ( in this case the starting date and an absolute link is provided for bookmarking ) , or whether it has been processed .\nthe pongo homepage . on the left - side it is possible to follow the status of the different queries and the starting of a new action .", "human": " the annotation efforts of the biosapiens european network of excellence have generated several distributed annotation systems ( das ) with the aim of integrating bioinformatics resources and annotating metazoan genomes ( ) . in this context \n , the pongo das server ( ) provides the annotation on predictive basis for the all - alpha membrane proteins in the human genome , not only through das queries , but also directly using a simple web interface . in order to produce a more comprehensive analysis of the sequence at hand , \n this annotation is carried out with four selected and high scoring predictors : tmhmm2.0 , memsat , prodiv and ensemble1.0 . \n the stored and pre - computed predictions for the human proteins can be searched and displayed in a graphical view . \n however the web service allows the prediction of the topology of any kind of putative membrane proteins , regardless of the organism and more importantly with the same sequence profile for a given sequence when required . here \n we present a new web server that incorporates the state - of - the - art topology predictors in a single framework , so that putative users can interactively compare and evaluate four predictions simultaneously for a given sequence . \n together with the predicted topology , the server also displays a signal peptide prediction determined with spep . \n the pongo web server is available at . ", "section_names": "INTRODUCTION\nMATERIALS AND METHODS\nThe predictors\nPre-computed transmembrane annotations for the human proteome\nRESULTS\nFigures and Tables", "bigbird_pegasus": "<s> there are a number of computational methods available to predict the topology of membrane proteins, which consists of two basic features : ( i ) the location of transmembrane domains along the protein chain and ( ii ) the location of the n- and c - termini with respect to the lipid membrane.<n> membrane proteins are difficult to study, since they are inserted into lipid bilayers and expose to the polar outer and inner environments portions of different sizes.<n> there are a number of computational methods available to predict the topology of membrane proteins, which consists of two basic features : ( i ) the location of transmembrane domains along the protein chain and ( ii ) the location of the n- and c - termini with respect to the lipid membrane.<n> automatic topology annotation for membrane proteins has been included among the efforts of the biosapiens european network of excellence ( ) with the specific aim of taking into consideration different predictors for annotating membrane proteins in the human genome.<n> the common platform for these efforts is the biosapiens distributed annotation server ( das ) ( ). in this context, the pongo - das server ( ) provides topology annotation for the all - alpha membrane proteins of the human genome.<n> this is done using the das protocol ( ) to answer at das queries that can be seen using specific visualizers such as dasty or ensembl.<n> the pre - computed annotations. the client server. the interface. the client server. the. the human genome annotation. the human genome annotation.<n> the human genome annotation. the human genome annotation.<n> the human genome annotation.<n> the human genome annotation.<n> the human genome.<n> the human genome annotation.<n> the human genome..<n> the human genome.<n> is the human genome.... is the human genome.<n> is the.<n> is the human genome.<n> is the.<n> is the human genome.<n> is the human genome.<n> is the human genome.<n> is the human genome.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence.<n> is a sequence..<n> is a sequence ", "longt5": "<pad> the pongo - das server provides topology annotation for the all - alpha membrane proteins of the human genome. this is done using the das protocol to answer at das queries that can be seen using specific visualizers such as dasty or ensembl. in order to allow users to browse directly the pre - computed transmembrane annotations the annotation is carried out using four selected predictors, namely ensemble1.0 and prodiv, in order to allow a direct comparison of the topology prediction for the sequence at hand. the topological models computed by the different predictors can be directly obtained simply by pasting in a box the sequence of interest and looking at the results. recently developed web technologies ( e.g. ajax ) are used to improve the user interface.</s>"}
{"article": "diaphyseal aclasis , also termed hereditary multiple exostosis ( hme ) or osteochondromatosis is characterised by multiple bony prominences that grow near joint lines throughout the skeleton .\nthese bony prominences , otherwise known as exostoses , can present as painless bony deformities or as a complication of the bony growth .\n( 1 ) there have been approximately 100 cases in the literature of vascular complications due to osteochondromas including pseudoaneurysm formation , occlusion , rupture or thrombosis .\n( 2 ) this article describes the case of a 15 year old boy , with known hme , referred to the sarcoma mdt with a 9.5 cm diameter mass in the popliteal fossa , confirmed by ultrasound as a delayed presentation of a pseudoaneurysm .\na 15-year - old boy , with diaphyseal aclasis , presented with a two month history of a painful swelling in his left popliteal fossa , reportedly increasing in size .\nhe presented to his local orthopaedic department where repeated radiographs ( figure 1 ) illustrated decreased cortical definition of the exostosis arising from the medial femoral metaphysis 15 cm above the knee joint .\nat this point he was referred to the regional sarcoma mdt due to concern that the lesion had undergone malignant transformation .\nplain radiographs of the patient s left knee on examination , there was a 10 cm , non - tender , pulsatile mass in the popliteal fossa .\nthe foot was warm with normal capillary refill , palpable posterior tibialis artery but absent dorsalis pedis .\nthe mri scan showed a lesion measuring 9.5 cm in its greatest diameter , of uniform signal , with a cartilage cap exceeding 2 cm throughout most of its surface .\n( figure 2 ) mri scan of the patient s left leg an ultrasound concluded an 8.8 cm pseudoaneurysm and the patient was admitted for urgent pre - op ct angio ( figure 3 and 4 ) and surgical exploration .\nct angiogram 3d reconstruction- showing the bony exostoses and the popliteal aneurysm posterior to the right distal femur ct angiogram : showing the diameter size of the aneurysm to be 88.6 mm .\nthe cross sectional image clearly shows the sharp bony exostoses that slowly eroded into the popliteal artery resulting in the pseudoaneurysm formation .\nthe image also shows that the defect in the artery is still patent because the pseudoaneurysm is filling with contrast the popliteal artery was explored .\n( figure 5 ) the proximal popliteal artery was found to have a 1 cm x 0.5 cm wall defect adjacent to the bony exostosis .\n( figure 6)the exostosis was excised and the 4 cm of diseased artery repaired with end - to - end interpositional long saphenous vein graft .\n( figure 7 ) intraoperative photograph showing the popliteal aneurysm intraoperative photograph showing the 1 cm x 0.5 cm defect in the popliteal artery wall caused by the sharp bony exostoses intraoperative photograph showing the end to end interpositional long saphenous vein graft post operatively the patient recovered without complication .\nhe was followed up with an ultrasound doppler after 6 weeks demonstrating a patent vein graft and will undergo local vascular follow - up .\nhis 6 month post - operative check - up revealed no complications but he will have regular follow - up for any painful , rapidly growing exostosis associated with his hereditary condition .\ndiaphyseal aclasis is a rare genetic skeletal condition due to developmental abnormalities of the growth plate causing multiple cartilage covered exostoses to form on the surface of the metaphysis or the adjacent diaphysis region of long bones .\ndiaphyseal aclasis is usually diagnosed in childhood however it is believed that radiologically the exostoses are present since birth .\n( 3 ) vascular complications of the popliteal vessel occur due to ossification of the previously protective cartilage cap , around the 2 decade and relative immobility of the artery in the popliteal fossa between exiting hunter s canal and the trifurcation .\n( 4 ) the artery undergoes chronic abrasion on the sharp exostosis forming a defect in the adventitia resulting in pseudoaneurysm formation . ( 5 ) it is controversial whether exostoses that lie near a vascular axis should be removed on identification to prevent vascular compromise from occurring . considering most exostoses are innocent , most authors suggest that surgical excision is only required when complications have occurred or malignant transformation is suspected .\nif preventative surgery is not performed , regular ultrasound doppler scans should be performed in order to screen for complications .\n( 6 ) in addition to vascular complications , bony exostosis can also present acutely with nerve compression , bursitis due to bony irritation , stalk fracture or necrosis of the cartilaginous cap following infarction .\n( 7 ) due to the acute presentation of this vascular complication there was no time for pre - operative tissue diagnosis , which would be routinely performed .\nit was important that the procedure was performed by an experienced orthopaedic tumour surgeon to ensure adequate margins were achieved .\nrecent studies report a lifetime risk of sarcomatous transformation in single lesions of approximately 1% but up to 5% in hme .\n( 8) the majority are chondrosarcomas , however , osteosarcomas and malignant fibrous histiocytomas have been reported .\nconcerning features that warrant further investigation include : \n a rapidly enlarging mass , particularly in those beyond skeletal maturityshoulder girdle and pelvic exostosis ( 9)cartilage capsule exceeding 1.5 cm a rapidly enlarging mass , particularly in those beyond skeletal maturity shoulder girdle and pelvic exostosis ( 9 ) cartilage capsule exceeding 1.5 cm investigation with ultrasound , mri and image guided or open biopsy is advocated if an exostosis has concerning features .\nthere are recent studies advocating pet / ct imaging to monitor known benign exostosis for malignant transformation .\n( 10 ) due to the relative rarity of these lesions it is important to review the images and histology in a specialised bone tumour multi - disciplinary meeting .\nthis case illustrates a late presentation of a known complication associated with diaphseal aclasis . in this age group\nwe present one of the largest , non - ruptured , popliteal pseudo aneurysms reported .\nit is important to maintain a high index of suspicion of an increasing soft tissue lesion due to the risk of sarcomatous transformation in patients with mhe ; however , this focus delayed earlier presentation to vascular surgeons putting the patient at risk of a limb threatening rupture .", "human": " a 15 year old boy , with known diaphyseal aclasis , presented with a swollen left leg . \n the diagnosis of popliteal pseudoaneurysm , a known and well understood vascular complication , was delayed due to presentation suggestive of a chondrosarcoma . in this age group , \n sarcomatous change is more common and a potentially sinister complication of diaphyseal aclasis . following a sarcoma mdt referral , the correct diagnosis \n was confirmed by ultrasound and ct angiogram . \n this case identifies one of the largest , non - ruptured popliteal pseudoaneurysms reported and illustrates an unusual complication of a rare orthopaedic genetic condition , which is potentially limb threatening . ", "section_names": "INTRODUCTION\nCASE PRESENTATION\nDISCUSSION", "bigbird_pegasus": "<s> diaphyseal aclasis or hereditary multiple exostosis ( hme ) is a rare genetic skeletal condition due to developmental abnormalities of the growth plate causing multiple cartilage covered exostoses to form on the surface of the metaphysis or the adjacent diaphysis region of long bones.<n> vascular complications of the popliteal vessel occur due to ossification of the previously protective cartilage cap, around the 2nd decade and relative immobility of the artery in the popliteal fossa between exiting hunter s canal and the trifurcation.<n> we present the case of a 15 year old boy, with known hme, referred to the sarcoma mdt with a 9.5 cm diameter mass in the popliteal fossa, confirmed by ultrasound as a delayed presentation of a pseudoaneurysm.</s>", "longt5": "<pad> diaphyseal aclasis is a rare genetic skeletal condition due to developmental abnormalities of the growth plate causing multiple cartilage covered exostoses to form on the surface of the metaphysis or the adjacent diaphysis region of long bones. these bony prominences can present as painless bony deformities or as a complication of the bony growth. there have been approximately 100 cases in the literature of vascular complications due to osteochondromas including pseudoaneurysm formation, occlusion, rupture or thrombosis. this article describes the case of a 15 year old boy, known hereditary multiple exostosis ( hme ), referred to the sarcoma mdt with a 9.5 cm diameter mass in the popliteal fossa, confirmed by ultrasound as a delayed presentation of a pseudoaneurysm.</s>"}
{"article": "prostate cancer is a common malignancy and a main cause of cancer - related death in men . in 2014 in the united states , an estimated 233 000 new cases will be diagnosed and 29 480 men will die of the disease . in recent years , with the widely adopted prostate - specific antigen ( psa)-based screening and biopsy program , the majority of prostate cancer can be detected in the early stage and can be treated by radical prostatectomy .\nhowever , approximately 30% of prostate cancer patients will experience recurrence after the initial surgery and many of them will develop metastatic disease [ 47 ] .\n, the disease progresses relatively slow , but other cases grow aggressively and rapidly metastasize to other part of the body . currently , the major challenge in prostate cancer management is to predict the outcome of the disease accurately at the time of diagnosis , to identify who will need active treatment .\nclinical stage , psa , and gleason score are currently commonly used as prognostic indicators , but the accuracy is limited .\nit is well known that the initiation and progression of prostate cancer results from the accumulation of genetic and epigenetic changes .\nepigenetic changes are characteristic of nearly all human tumors , including prostate cancer , and include changes in dna methylation , micrornas , and histone modifications .\nidentification of epigenetic changes involved in the initiation and progression of prostate cancer will identify novel diagnostic and prognostic biomarkers and therapeutic targets .\nalthough the exact mechanism of how these epigenetic changes arise in prostate cancer is not well understood , the fact that they occur much more frequently than genetic changes may make them useful as potential biomarkers .\ndna methylation is the best studied epigenetic modification in prostate cancers , which occurs at cpg islands in the promoter region of a number of genes and cause transcriptional silencing of gene expression .\npromoter hypermethylation of critical genes could be useful biomarkers and therapeutic targets for prostate cancer .\nthe protocadherin8 gene is located on human chromosome 13q14.3 ; the gen product contains 6 extracellular cadherin domains , a transmembrane domain , and a cytoplasmic domain .\nprotocadherin8 plays crucial roles in cell adhesion , signal transduction , proliferation , migration , and invasion [ 1924 ]\n. a growing number of studies have demonstrated that protocadherin8 functions as a tumor suppressor in human cancers [ 1924 ] .\nmoreover , it is frequently inactivated by promoter methylation in bladder cancer , renal cell carcinoma , nasopharyngeal carcinoma , gastric cancer and breast cancer , and is associated with poor prognosis [ 1924 ] .\nhowever , the methylation status and its clinical significance in prostate cancer remain unclear . in the current study\n, we analyzed the methylation status of protocadherin8 in localized prostate cancer tissues using methylation - specific pcr ( msp ) .\nmsp is a major technique for detecting gene methylation and can provide specific and sensitive results .\nwe also evaluated its association with biochemical recurrence - free survival of patients with prostate cancer in order to analyze its potential as a biomarker in this disease .\na total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 .\nprostate tissues obtained from 47 patients with benign prostatic hyperplasia ( bph ) during transurethral resection of prostate at the same time in the same hospital were used as normal controls .\nnone of the patients with prostate cancer received any form of anti - tumor therapy before surgery , and none received adjuvant therapy before recurrence .\nthe samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used .\nbiochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . the common clinicopathologic parameters were recorded , including preoperative serum psa , pathological stage , seminal vesicle invasion , gleason score , lymph node status , margin status , and follow - up data .\nthe patients were followed up at intervals , ranging from 15 months to 60 months .\nthis study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university ( no .\ngenomic dna was isolated from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) .\nthe isolated dna was modified with bisulfite using epitect bisulfite kit ( qiagen , valencia , ca ) and standard protocol as described previously .\nbisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna .\nmethylated : forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. unmethylated : forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. amplifications were carried out using the following profile : 1 cycle of 95c for 5 min , 40 cycles of 95c for 30 s , 60c for 30 s , and 72c for 30 s , and 1 cycle of 72c for 5 min . in vitro methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) was used as methylation and unmethylation positive control , and water blanks were included with each assay as previously reported .\nmsp products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis .\nsamples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane .\nstatistical analysis was done using sas version 8.0 ( sas institute , cary , n.c .\nthe difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test .\nthe associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . for biochemical recurrence - free survival analysis ,\nkaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test .\nunivariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer .\na total of 162 prostate cancer tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008 .\nprostate tissues obtained from 47 patients with benign prostatic hyperplasia ( bph ) during transurethral resection of prostate at the same time in the same hospital were used as normal controls .\nnone of the patients with prostate cancer received any form of anti - tumor therapy before surgery , and none received adjuvant therapy before recurrence .\nthe samples were flash - frozen in liquid nitrogen at the time of collection and stored at 80c until used .\nbiochemical recurrence was defined as the period between radical prostatectomy and the measurement of 2 successive values of serum psa level 0.2 ng / ml . the common clinicopathologic parameters were recorded , including preoperative serum psa , pathological stage , seminal vesicle invasion , gleason score , lymph node status , margin status , and follow - up data .\nthe patients were followed up at intervals , ranging from 15 months to 60 months .\nthis study was performed according to the declaration of helsinki and was approved by the ethics committee of the third hospital of hebei medical university ( no .\ngenomic dna was isolated from frozen tissues using the dneasy tissue kit ( qiagen , valencia , ca ) .\nthe isolated dna was modified with bisulfite using epitect bisulfite kit ( qiagen , valencia , ca ) and standard protocol as described previously .\nbisulfite modified dna was used for msp with primers specific for either methylated or unmethylated dna .\nmethylated : forward 5-cggttattggttattcggttcc-3 and reverse 5-acgaactctaaaaacgcgcg-3. unmethylated : forward 5-ggtggttattggttatttggttt-3 and reverse 5-ccaacaaactctaaaaacacaca-3. amplifications were carried out using the following profile : 1 cycle of 95c for 5 min , 40 cycles of 95c for 30 s , 60c for 30 s , and 72c for 30 s , and 1 cycle of 72c for 5 min . in vitro methylated dna and unmethylated dna ( new england biolabs , beverly , ma , usa ) was used as methylation and unmethylation positive control , and water blanks were included with each assay as previously reported .\nmsp products were separated in 2% agarose gel , stained with ethidium bromide , and visualized under ultraviolet illumination for analysis .\nsamples were scored as methylation negative when bands were present only in the unmethylated dna lane and as methylation positive when methylated alleles were present in the methylated dna lane .\nstatistical analysis was done using sas version 8.0 ( sas institute , cary , n.c . , usa )\nthe difference of protocadherin8 methylation status between prostate cancer tissues and controls were evaluated using fisher s exact test .\nthe associations between protocadherin8 methylation and clinicopathologic parameters were evaluated by chi - square test . for biochemical recurrence - free survival analysis ,\nkaplan - meier survival analysis was used and the differences in survival were analyzed using the log - rank test .\nunivariate and multivariate cox proportional hazard models were used to evaluate the prognostic effect of protocadherin8 methylation in prostate cancer .\nin the current study , the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 controls was detected by msp .\nprotocadherin8 methylation was detected in 76 ( 46.9% ) prostate cancer cases ( figure 1 ) .\nhowever , no protocadherin8 methylation was found in the controls , and the difference between prostate cancer cases and controls was statistically significant ( p<0.0001 ) .\nsubsequently , we linked the methylation status of protocadherin8 to clinicopathologic parameters in prostate cancer cases to elucidate its clinical significance .\nprotocadherin8 methylation was significantly associated with advanced pathologic stage ( p=0.0122 ) , higher level of preoperative psa ( p=0.0004 ) , higher gleason score , ( p=0.0187 ) , positive lymph node metastasis ( p=0.0314 ) , and biochemical recurrence ( p<0.0001 ) .\nhowever , it was not significantly associated with age , surgical margin status , or seminal vesicle invasion .\nnext , we examined the biochemical recurrence - free survival of patients with prostate cancer according to protocadherin8 methylation status to elucidate its prognostic value .\ninterestingly , patients with protocadherin8 methylated had worse prognosis than patients without ( p<0.0001 , figure 2 ) . to further determine the associations between biochemical recurrence - free survival and potential risk factors , univariate and multivariate cox regression model analysis was performed .\nunivariate cox regression analysis first showed that gleason score , preoperative psa level , pathologic stage , and protocadherin8 promoter methylation were risk factors for poor biochemical recurrence - free survival .\nthese risk factors were entered into multivariate cox regression analysis , revealing that protocadherin8 methylation and gleason score were independent prognostic risk factors for biochemical recurrence - free survival of patients with prostate cancer .\nit is of great important to identify novel prognostic and predictive markers to understand this multifaceted disease process and to identify which patients need more aggressive treatment after initial curative surgery [ 6,7,1416 ] .\ndna methylation of cpg islands within the promoter region of genes is an alternative mechanism of gene silence to genetic changes and is frequently involved in the development and progression of many types of human cancers , including prostate cancer .\naberrant promoter methylation of some genes that are normally unmethylated may be used as potential molecular markers for the diagnosis , surveillance , and prognosis in prostate cancer .\nprotocadherin8 is a tumor suppressor gene and is frequently silenced by aberrant promoter methylation in several human cancers . to date ,\nthe association between promoter methylation of protocadherin8 and the prognosis of prostate cancer has not been reported .\nthis is the first study to investigate the prognostic value of protocadherin8 methylation in prostate cancer based on a relatively large number of clinical samples . in the current study\n, we analyzed the methylation status of protocadherin8 in 162 prostate cancer tissues and 47 normal prostate tissues using msp .\nwe demonstrated that protocadherin8 methylation appeared more frequently in prostate cancer tissues than in normal prostate tissues .\nmoreover , when we analyzed the association between protocadherin8 methylation and traditional clinicopathologic features in prostate cancer , we found that protocadherin8 methylation was significantly correlated with advanced pathologic stage , higher level of preoperative psa , higher gleason score , positive lymph node metastasis , and the occurrence of biochemical recurrence .\nthese results suggest that protocadherin8 methylation plays an import role in the progression of prostate cancer and may be associated with the poor prognosis . to verify this hypothesis ,\nkaplan - meier survival analysis was performed , showing that the biochemical recurrence - free survival time of patients with protocadherin8 methylated was significantly shorter than patients without . moreover ,\nunivariate and multivariate cox regression analysis demonstrated that protocadherin8 methylation is an independent predictor of the prognosis of prostate cancer .\nthese results suggest that the detection of protocadherin8 methylation in tumor samples after surgery may help identify the patients prone to recurrence and could be a novel predictor for disease course in prostate cancer patients .\nour present data demonstrated that aberrant promoter methylation of protocadherin8 occurred frequently in prostate cancer , but not in normal prostate tissues .\nthis result indicates that protocadherin8 methylation is tumor - specific and may be an early event in prostate cancer .\nin addition , the clinical significance of protocadherin8 methylation in prostate cancer is similar to findings of studies on other cancers [ 1921 ] .\nour findings further verified the possibility of using protocadherin8 methylation as a potential biomarker in prostate cancer .\nstudies are needed to investigate the cause of protocadherin8 methylation and to discover how to reverse the methylation status of protocadherin8 in prostate cancer .\npromoter methylation of protocadherin8 is a frequent event in prostate cancer , and is associated with traditional risk factors of poor prognosis and shorter biochemical recurrence - free survival time .\nthe present results indicate that protocadherin8 methylation is an independent prognostic factor for biochemical recurrence - free survival in prostate cancer patients .\nour findings suggest that protocadherin8 methylation might be a useful prognostic biomarker and a potential therapeutic target for prostate cancer .", "human": " backgroundprotocadherin8 has been demonstrated to play critical roles in initiation and progression of several human cancers . \n it is frequently inactivated by promoter methylation in cancers and may be used as a potential biomarker . \n however , the methylation status of protocadherin8 and its clinical significance in prostate cancer remains largely unknown . \n the purpose of this study was to evaluate the clinical significance of protocadherin8 methylation in early - stage prostate cancer.material/methodsthe promoter methylation status of protocadherin8 in 162 prostate cancer tissues and 47 normal prostate tissues was examined using methylation - specific pcr ( msp ) . \n subsequently , the relationships between protocadherin8 methylation and clinicopathological features of prostate cancer patients and biochemical recurrence - free survival of patients were analyzed.resultswe found that protocadherin8 methylation occurred frequently in prostate cancer tissues but not in normal prostate tissues . \n moreover , protocadherin8 methylation was significantly associated with advanced pathologic stage , higher level of preoperative prostate specific antigen ( psa ) , higher gleason score , positive lymph node metastasis , and biochemical recurrence . \n in addition , patients with protocadherin8 methylated have shorter biochemical recurrence - free survival time than patients without . \n multivariate cox regression analysis revealed that protocadherin8 methylation was an independent predictor of biochemical recurrence - free survival in prostate cancer patients.conclusionspromoter methylation of protocadherin8 is a frequent event in prostate cancer , and might be used as an independent prognostic factor for biochemical recurrence - free survival in patients with prostate cancer . ", "section_names": "Background\nMaterial and Methods\nPatients and tissue samples\nGenomic DNA extraction, bisulfite treatment and MSP\nStatistical analysis\nResults\nDiscussion\nConclusions", "bigbird_pegasus": "<s> backgroundprostate cancer is a common malignancy and a main cause of cancer - related death in men. currently, the major challenge in prostate cancer management is to predict the outcome of the disease accurately at the time of diagnosis.<n> identification of epigenetic changes involved in the initiation and progression of prostate cancer will identify novel diagnostic and prognostic biomarkers and therapeutic targets.<n> the protocadherin8 gene is frequently inactivated by promoter methylation in human cancers, but its clinical significance in prostate cancer remains unclear. in the current study, we analyzed the methylation status of protocadherin8 in localized prostate cancer tissues using methylation - specific pcr ( msp).material / methodsprostate cancer tissues were obtained using msp.<n> the common clinicopathologic parameters were recorded, including preoperative serum prostate - specific antigen ( psa ), pathological stage, seminal vesicle invasion, gleason score, lymph node status, margin status, and follow - up data.<n> patients were followed up at intervals, ranging from 15 months to 60 months.resultsprotocadherin8 methylation was detected in 162 prostate cancer tissues and 47 normal prostate tissues using msp.<n> it was significantly associated with advanced pathologic stage ( p=0.0122 ), higher gleason score, lymph node status, margin status, and follow - up data ( p<unk>0.0001 ).<n> the association between protocadherin8 methylation status and gmethylation, gleason score, g score, and g, and gleason score, lymph node status, and the gleas.<n> glea level.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.", "longt5": "<pad> purposeto investigate the prognostic value of protocadherin8 methylation in prostate cancer patients.materials and methodsa total of 162 prostate cancer tissues and 47 normal prostate tissues were obtained from patients with early - stage prostate cancer during radical retropubic prostatectomy at the third hospital of hebei medical university between 1999 and 2008. protocadherin8 methylation was detected in 76 ( 46.9% ) prostate cancer cases and no protocadherin8 methylation was found in the controls ( p<unk>0.0001 ). protocadherin8 methylation was significantly associated with advanced pathologic stage ( p=0.0122 ), higher level of preoperative prostate - specific antigen ( p=0.0004 ), higher gleason score ( p=0.0187 ), positive lymph node metastasis ( p=0.0314 ), and biochemical recurrence ( p<unk>0.0001 ). univariate and multivariate cox regression analysis demonstrated that protocadherin8 methylation and gleason score were independent prognostic risk factors for biochemical recurrence - free survival of patients with prostate cancer.resultsthe methylation status of protocadherin8 was significantly associated with advanced pathologic stage ( p=0.0122 ), higher level of preoperative prostate - specific antigen ( p=0.0004 ), higher gleason score ( p=0.0187 ), positive lymph node metastasis ( p=0.0314 ), and biochemical recurrence ( p<unk>0.0001 ). furthermore, patients with protocadherin8 methylated had worse prognosis than patients without ( p<unk>0.0001 ). furthermore, univariate and multivariate cox regression analysis demonstrated that protocadherin8 methylation and gleason score were independent prognostic risk factors for biochemical recurrence - free survival of patients with prostate cancer.conclusionsthe present results indicate that protocadherin8 methylation might be a useful prognostic biomark"}
{"article": "procalcitonin ( pct ) is a 14-kd protein encoded by the calc-1 gene and synthesized physiologically by thyroid c - cells . under normal conditions , serum pct levels are negligible .\nafter shock or tissue injury ( i.e. burn , trauma , surgery ) or infections and sepsis , pct mrna expression has been documented in human extra - thyroidal tissues .\nthus , systemic pct concentrations are considered as a component of the inflammatory response and as an acute - phase marker . in cardiac acute patients , data on pct\nsome studies [ 3 , 4 ] reported that pct levels were increased in acs patients on admission , whereas other investigations [ 5 , 6 ] documented that plasma pct concentrations were in the normal range in patients with uncomplicated acute myocardial infarction .\nelevated concentrations of pct have been reported in patients with cardiogenic shock . in a more recent retrospective study , it was observed that cs patients showed high pct concentrations , especially in the presence of multiorgan failure ( mof ) and in absence of signs of infections ( cultures and clinical findings ) .\nwe recently   observed that the degree of myocardial ischemia ( clinically indicated by the whole spectrum of acs , from unstable angina to cardiogenic shock st - elevation following myocardial infarction ) and the related inflammatory - induced response are better reflected by crp ( which was positive in most acute cardiac care patients of all our subgroups ) than by pct which seems more sensible to a higher extent of inflammatory activation , being positive only in all cs patients . in these patients , the clinical interpretation of absolute pct values ( both in diagnostic and prognostic terms ) , represent a major challenge since they may be influenced by several factors , such as the degree of systemic inflammatory response , the coexistence of multiorgan dysfunction , the presence / absence of infections and finally by the time of measurements during hospital course ( i.e. the dynamics of pct levels ) .\nno data are so far available on the dynamics of pct levels in patients with cardiogenic shock .\nthe aim of this preliminary investigation was therefore to evaluate the serum evolution of pct during intensive cardiac care unit ( iccu ) staying in a group of patients with cardiogenic shock ( cs ) following st - elevation myocardial infarction ( stemi ) submitted to primary percutaneous intervention ( pci ) with no laboratory or clinical sign of infection .\nten consecutive patients with cardiogenic shock following stemi were submitted to pci and then admitted to our 12-bed iccu in florence , a tertiary center , from 1 september 2008 to 31th march 2009 . to be eligible for the present study , all patients had to be free of infection at the time of blood sampling , as evidenced by both clinical and microbiological examinations , including urinary cultures and microbiological examinations of tracheal aspirate in mechanical ventilated patients and blood cultures . a clinical diagnosis of cardiogenic shock was made if all the following criteria were present : 1 .\nsystolic blood pressure persistently less than 90 mmhg or vasopressors required to maintain a systolic blood pressure of more than 90 mmhg ; 2 .\nsigns of hypoperfusion ( e.g. urine output less than 30 ml / hour or cold / diaphoretic extremities or altered mental status ) ; 3 .\nclinical evidence of elevated left ventricular filling pressure ( e.g. pulmonary congestion on physical examination or chest x - ray ) .\npulmonary artery catheterization was not required when all clinical criteria and echocardiographic evidence of left ventricular dysfunction without mechanical complications were present .\nthe day after iccu admission blood samples were obtained for cardiac biomarkers ( tni < 0.15 ng / ml ) , leucocytes count ( 4000 - 10000/l ) , crp ( < 9 mg / dl ) , uric acid ( < 6.5 mg / dl ) , nt - pro brain natriuretic peptide ( nt - probnp , in males 0 - 50 yrs : < 88 pg / ml , > 50 yrs : < 227 pg / ml ; in females : 0 -50 yrs : < 153 pg / ml ; > 50 yrs : < 334 pg / ml )   and procalcitonin measurements ( normal values < 0.5 ng / ml ) .\ntransthoracic 2-dimensional echocardiography was performed on admission in order to evaluate left ventricular ejection fraction ( lvef ) .\napache ii ( acute physiology and chronic health evaluation ii ) score was also assessed .\nthe study design was approved by the local ethic committee and inform written consent was obtained for each patient .\nstatistical analysis was performed by means of spss 13.0 package ( spss inc , chicago , il ) .\ndata are reported as frequencies and percentages or means  s.d . and analyzed with fisher s exact test and student s t test , respectively .\nsince pct was determined once a day , its mean value for each day of hospital stay in either group of patients has been calculated and graphically plotted in order to obtain two linear regression lines , whose slopes have been subsequently compared by means of an f test .   in all analyses ,\ntable 1 shows the clinical characteristics of cs patients following stemi included in the study after pci .\nclinical characteristics of patients included in the study . compared with survivors , dead patients exhibited higher values of apache ii score , as well as trend towards higher serum concentrations of troponin i , though it did not reach statistical significance .\nno significant differences were detectable in regard to age , sex , infarct location , left ventricular ejection fraction , and mean arterial pressure between the two subgroups .  \nas depicted in table 2 , higher values of glycemia , nt - probnp and crp were detectable in dead patients in respect to survivors .\nbasal serum concentrations of procalcitonin were higher in ( dead ) survivors patients , though this difference did not reach statistical significance due to high values of standard deviation .\nas depicted in figure 1 , the pattern of pct variations during iccu course was significantly different in cs patients who survived in respect to those who died ( survivors : slope = -3.760.71 standard error ; dead : slope = -0.810.35 standard error , p=0.004 ) .\nthe main finding of the present investigation , though preliminary and performed in a small subset of patients , is that the patterns of temporal pct variations throughout iccu course were heterogeneous in patients with cs and no clinical or laboratory signs of infection .\na progressive reduction in pct values was observed in cs patients who survived , whereas the lack of changes in pct concentrations was documented in cs patients who died .\nconversely , basal absolute pct values were not significantly different between the two subgroups , since they exhibit a wide range of values in the overall population .\nsponholz et al .   described the evolution of serum procalcitonin levels after uncomplicated cardiac surgery and observed a progressive return to normal levels within the first week .\npeak pct levels were reached within 24 hours postoperatively and this increase seemed to be dependent on the surgical procedure , being more invasive procedures associated with higher pct levels , and on intraoperative events , including aortic cross - clamping time , duration of cardiopulmonary bypass and duration of surgery . in infected patients , pct levels were elevated throughout the first week postoperatively [ 19 , 20 , 21 ] , with a more pronounced trend in bacterial and fungal infections than in viral infections of sirs . [ 22 , 23 ] .\nthe authors concluded that the dynamics of pct levels , rather than absolute values , may be more important for identifying patients with infectious complications after cardiac surgery .\nmore recently prat et al .   confirmed a slight increase in pct values in the first postoperative day after cardiac surgery , in agreement with previous results [ 25 , 26 , 27 ] and with adamik et al .\n, who showed that the development of postoperative complications after cardiac surgery with cardiopulmonary bypass was associated with increased postoperative neopterin and pct levels .\nsimilarly , after heart transplantation , serum pct levels display a rise in response to surgery , with a peak on day two , whereas high peak levels with delayed return to normal values should lead to a search for inflammatory processes , as they are often associated with increased morbidity and mortality .  \nlikewise , in patients with cardiogenic shock and no sign of infections we documented a reduction of pct levels only in survivors cs patients .\nthis time course of procalcitonin can probably be explained , both in postsurgical and in cs patients , by normal pct kinetic . in healthy subjects\nthe injection of endotoxin is followed by a rise in pct , reaching a maximum 24 hours thereafter .  \nthe return of pct levels to normality within a few days in surgical patients ( after an uncomplicated postoperative course ) and in cs survivors patients can be explained by half - life of pct ( 18 to 24 hours ) , in absence of a further insult that might induce pct production .\nour findings , along with those in cardiac surgery   strongly support the contention that the  dynamic \napproach   may be more reliable that the static one ( that is the absolute single pct value ) especially in the challenging conditions characterized by a systemic inflammatory response , such as cardiac surgery and cardiogenic shock . indeed , in a cohort of unselected critically ill patients , jensen et al .  \nobserved that a pct increase was an independent predictor of 90-day survival and that the pct day - by - day changes was able to identify critically ill patients at a higher risk of icu mortality . on the other hand ,\nthe initial  ct level did not predict mortality , even though many patients were admitted with a pct 1.0 ng / ml .\nthis suggests that several pct measurements should be made consecutively to assess the critically ill patient s infection - related mortality risk ( to monitor treatment of infection day - by - day ) . in our investigation\nwe further confirmed that higher values of nt - probnp are associated with increased mortality in cs patients   and that a more marked systemic inflammation ( as inferred by higher values of crp ) and higher severity score ( as indicated by apache ii ) were associated with an ominous prognosis .\nthe main limitation of the present investigation is represented by the small number of patients . however , the population is homogeneous , comprising patients with cardiogenic shock following stemi all submitted to pci , with no clinical and laboratory sign of infections .\nit is interesting to note that , despite the small number of subjects , the behavior of pct was clearly detectable .\naccording to our preliminary findings , patterns of temporal pct variations throughout iccu course were heterogeneous in patients with cs following stemi submitted to pci and no clinical or laboratory signs of infection .\na progressive reduction in pct values was observed in cs patients who survived , whereas a lack of changes in pct concentrations was documented in cs patients who died .\nour findings strongly support the contention that the  dynamic  approach may be more reliable that the static one ( that is the absolute single pct value ) especially in the challenging conditions characterized by a systemic inflammatory response , such as cardiogenic shock .\nwe further confirmed that higher values of nt - probnp are associated with increased mortality in cs patients and that a more marked systemic inflammation ( as inferred by higher values of crp ) and higher severity score ( as indicated by apache ii ) were associated with an ominous prognosis .", "human": " introductionprocalcitonin concentrations are considered as a component of the inflammatory response and as an acute - phase marker , after shock or tissue injury ( i.e. burn , trauma , surgery ) or infections and sepsis . \n no data are so far available on the dynamics of procalcitonin levels in patients with cardiogenic shock following st - elevation myocardial infarction , with no clinical or laboratory sign of infection.methodswe evaluated procalcitonin values every day during intensive cardiac care staying in ten cardiogenic shock patients admitted to our intensive cardiac care unit . nt - pro brain natriuretic peptide , c reactive protein and apache ii score were also assessed.resultssix patients survived , whereas 4 patients died . \n a progressive reduction in procalcitonin values was observed in cardiogenic shock patients who survived , whereas the lack of changes in procalcitonin concentrations was documented in cardiogenic shock patients who died ( survivors : slope = -3.76 ; dead : slope = -0.81 , p=0.004 ) . \n furthermore , higher values of glycemia , nt - pro brain natriuretic peptide and c reactive protein ( as well as higher apache ii scores ) were detectable in dead patients in respect to survivors.conclusionsin our preliminary study we observed that in patients with cardiogenic shock and no sign of infections a reduction of procalcitonin levels was detectable only in survivors . moreover , higher values of nt- brain natriuretic peptide , a marked systemic inflammation ( higher values of c reactive protein ) and higher severity score ( as depicted by apache ii ) are associated with an ominous prognosis in cardiogenic shock patients . ", "section_names": "Introduction\nMethods\nResults\nDiscussion\nConclusions", "bigbird_pegasus": "<s> backgroundprocalcitonin ( pct ) is an acute - phase marker, usually in the range of normal values in acute coronary syndrome ( acs ) patients.<n> elevated pct concentrations have been reported in patients with cardiogenic shock.<n> no data are so far available on the dynamics of pct levels in patients with cardiogenic shock.aimthe aim of this preliminary investigation was to evaluate the serum evolution of pct during intensive cardiac care unit ( iccu ) stay in a group of patients with cardiogenic shock ( cs ) following st - elevation myocardial infarction ( stemi ) submitted to primary percutaneous intervention ( pci ) with no laboratory or clinical sign of infection.methodsten consecutive patients with cardiogenic shock following stemi were submitted to pci and then admitted to our 12-bed iccu in florence, a tertiary center. to be eligible for the present study, all patients had to be free of infection at the time of blood sampling, as evidenced by both clinical and microbiological examinations, including urinary cultures and microbiological examinations of tracheal aspirate in mechanical ventilated patients and blood cultures.resultsten consecutive patients with cardiogenic shock following stemi were included in the study. to be eligible for the present study, all patients had to be free of infection at the time of blood sampling, as evidenced by both clinical and microbiological examinations.<n> procalcitonin ( pct, a single value.<n> pct pct pct levels were significantly.<n> the pct.<n> pct levels were significantly.<n> the pct.<n> the pct levels were significantly.<n><n><n> the pc.<n> the pct.<n> the pc.<n> the pc.<n> the pc.<n><n> the pc.<n>.<n>.<n>.<n>.<n>.<n>.<n><n><n> the patients were the patients.<n>.<n> patients were a clinical and the patients.<n><n><n><n>.<n> patients were the patients.<n> patients.<n> patients..<n> patients.<n> patients.<n> patients.<n>.<n> patients.<n> patients.<n> patients.<n> patients.<n> patients.<n> patients.<n> patients.<n> patients.<n>.<n> patients.<n><n><n><n><n><n> patients.<n><n><n><n><n>", "longt5": "<pad> backgroundprocalcitonin ( pct ) is a 14-kd protein encoded by the calc-1 gene and synthesized physiologically by thyroid c - cells. in cardiac acute patients, pct levels are negligible. in these patients, the clinical interpretation of absolute pct values ( both in diagnostic and prognostic terms ) represents a major challenge since they may be influenced by several factors, such as the degree of systemic inflammatory response, the coexistence of multiorgan dysfunction, the presence / absence of infections and finally by the time of measurements during hospital course ( i.e. the dynamics of pct levels).objectivesthe aim of this preliminary investigation was therefore to evaluate the serum evolution of pct during intensive cardiac care unit ( iccu ) staying in a group of patients with cardiogenic shock following st - elevation myocardial infarction submitted to primary percutaneous intervention ( pci ) with no laboratory or clinical sign of infection.patients and methodsten consecutive patients with cardiogenic shock following stemi were submitted to pci and then admitted to our 12-bed iccu in florence, a tertiary center, from 1 september 2008 to 31th march 2009. the day after iccu admission blood samples were obtained for cardiac biomarkers ( tni <unk> 0.15 ng / ml ), leucocytes count ( 4000 - 10000/l ), crp ( <unk> 9 mg / dl ), uric acid ( <unk> 6.5 mg / dl ), nt - pro brain natriuretic peptide ( nt - probnp ) and procalcitonin measurements ( normal values <unk> 0.5 ng / ml).resultsthe pattern of pct variations during iccu course was significantly different in cs patients who survived in respect to those who died ( survivors : slope = -3.760.71 standard error ; dead : slope = -0.810.35 standard error, p=0.004).conclusionsour findings strongly support the"}
{"article": "american cutaneus leishmaniasis ( acl ) is a vector - borne zoonotic disease caused by several species of leishmania trypanosome protozoan parasites and transmitted by phlebotomine sandflies ( lutzomyia spp . ) . in brazil\n, acl constitutes a significant health problem , with an incidence of about 20,153 new cases per year ( 2008 ) . in humans ,\ninfections may not be readily apparent but can present a variety of clinical manifestations ranging from localised , sometimes self - healing cutaneous lesions to severe mutilating mucocutaneous lesions or diffuse cutaneous leishmaniasis .\na high prevalence of infection has been reported in pernambuco state , northeastern brazil , concentrated predominantly in the atlantic forest region ; transmission has increased dramatically in recent decades [ 3 , 4 ] .\nmany different patterns of acl etiology have been described in brazil , particularly in highly endemic regions .\nacl was originally considered to be focused among people who work or live within tropical forests ; however , comparison of this idea with current patterns of occurrence suggests strongly that behavior of vectors may be changing , perhaps in response to environmental shifts [ 1 , 6 , 7 ] .\nnumerous studies point to the capacity of some lutzomyia species to adapt to human - altered environments in parts of brazil [ 1 , 810 ] , which opens possibilities for broader and much increased transmission .\nthe sandflies lutzomyia whitmani and l. migonei are considered important acl vectors in brazil that have generally been found in peridomestic environments in southeastern ( states of so paulo , minas gerais , esprito santo , rio de janeiro ) [ 1113 ] , northeastern ( maranho , bahia , cear , pernambuco ) [ 1416 ] , and west - central ( mato grosso , mato grosso do sul , tocantins ) regions [ 10 , 1719 ] .\nlutzomyia intermedia , on the other hand , dominates and is considered the principal acl vector in areas of so paulo , rio de janeiro , and minas gerais [ 1 , 11 , 12 ] .\nvarious factors have been identified as key in this domiciliation process , including climatic factors ( annual and seasonal temperature and precipitation ) , vegetation type , and elevation , as well as socioeconomic conditions that may influence risk of transmission to humans [ 20 , 21 ] .\nfinally , lutzomyia whitmani ranks among the most important acl vectors in brazil   and has been found to be abundant in atlantic forest areas in pernambuco since at least the 1990s [ 4 , 16 ] .\nthis species has been found to be infected naturally with leishmania ( viannia ) braziliensis in this region , forming a key element in the zoonotic transmission cycle of this pathogen [ 23 , 24 ] .\nthe purpose of this study is to analyze the  behavior  in terms of distribution and population trends through time and across space of lutzomyia species in a long - term focus of acl transmission in the state of pernambuco , brazil . given that l. whitmani dominates the sandfly fauna in this region almost absolutely , we focus on this species , as it clearly drives much of the dynamics of the system .\nwe explore this species in relation to various environmental factors in amaraj , pernambuco , an area of intermingled atlantic forest and farmland that is of particular interest as regards high acl transmission [ 3 , 24 ] .\nduring the course of 2009 , sandflies were collected in the municipality of amaraj , an atlantic forest - dominated locality just inland from the coast of pernambuco .\nspecifically , we collected at the small , rural settlements of refrigerio and tranquilidade ( 82259s 352709w , 289  m ; figure 1 ) . the sampling covered 9 months of 2009 ( january , february , march , april , june , august , october , november ) .\nwe used 10 cdc light traps   per night on 3 - 4 nights , for a total of 255 trap - nights over the course of the study .\none cdc light trap inside domiciles , and four in peridomicile ( including animal shelters ) , and five in nearby forested areas .\nthe traps were positioned 1.5  m above the ground on the edges of banana plantations or atlantic forest fragments , in the interior of forest fragments , and around human domiciles and associated structures ( stables , granaries , etc . ) .\neach site was visited every second month , and the two sets of sites were sampled in alternating sets of months to maximize numbers of sites included in the study .\nan initial analysis of temporal dimensions sandfly abundance in this study has already been published .\nthe location of each trap was georeferenced using a hand - held garmin ( etrex hc series ) global positioning unit , accurate to ~10  m on the ground using the datum wgs 1984 .\nthe species lutzomyia whitmani was analyzed separately from the other species occurring in the area because of its near - absolute dominance among the sandfly fauna of the region .\nwe used chi - squared tests to compare relative frequencies of different species in different environments , both in terms of numbers of individuals captured and numbers of sites at which the species were collected .\nwe compared l. whitmani with the remaining lutzomyia species except as constrained by sample sizes for the latter species ( expected frequencies had to be 5 for tests to be possible ) .\nall statistical tests were based on an  = 0.05 . to summarize dimensions of land cover and vegetation characteristics and phenology , we calculated the normalized difference vegetation index ( ndvi ) from landsat images available from the u.s .\ngeological survey ( http://glovis.usgs.gov/ ) with spatial resolution of 30  m ( 98  ft ) . specifically , we used images from the enhanced thematic mapper-7 sensor for the following dates : 3 october and 21 october 2006 , 15 april 2007 , and 8 august 2009 , which were the most cloud - free images available over the period 20062009 . to calculate ndvi\n, we used the formula 10,000[(b40  b30)/(b40 + b30 ) ] , where b40 and b30 represent the red and near - infrared bands from the landsat images , respectively . to identify environmental conditions under which lutzomyia species occur in the amaraj region , we used ecological niche modeling ( enm ) routines implemented in maxent . in general\n, we used default parameters to train models , so that we set the random testing percentage to 50% to provide an independent perspective on model quality ; we focused on the logistic output format . to identify environmental parameters most relevant to the species ' occurrence\n, we used a jackknife procedure that measures effects of each environment variable alone and when omitted from the model on predictions [ 27 , 28 ] . to separate areas predicted as suitable from those predicted as unsuitable , we set the expected meaningful error parameter of peterson et al .\nwe used as a threshold for separating prediction of suitability from prediction of unsuitability the highest logistic maxent suitability value that included ( 100e)% , in this case 98% of the training data , to take into account the possible presence of noise in the input data . to provide a quantitative test of model predictions ,\nwe were forced to focus on a subset of the study area , for which no cloud cover was present in at least two of the images ( figure 1 ) . to provide a clear test of predictive ability among spatial subsets , thereby avoiding some problems with spatial autocorrelation among training and testing data\n, we separated this subset of the study region into eastern , central , and western areas and challenged models to use each pair of areas to anticipate the distribution of the species in the third area .\nwe then used a receiving operating characteristic ( roc ) approach to provide a threshold - independent evaluation of each prediction .\nhowever , in light of known problems with standard roc approaches [ 31 , 32 ] , we used a partial roc approach , in which analyses are limited to portions of the roc curve in which omission error is less than or equal to e ; these tests were developed using a program developed by n. barve that is available upon request from the authors .\nthe test statistic output from these routines is the auc ratio , which compares the observed area under the curve to null expectations ; auc ratios are tested for difference from unity ( i.e. , random prediction ) via 1000 repetitions of a 50% bootstrap of available input data . finally , to provide a visualization of ecological niche patterns of lutzomyia species ' distributions in the study area\n, we developed a final niche model based on all occurrence data available across the three areas ( i.e. , no subsetting ) .\nwe combined ( grid combine in arcgis 9.3 ) this map with the environmental data layers from which it was derived to yield a raster dataset with an associated attributes table that includes the value of each combination of environmental variables ( ndvi of each time period ) and the prediction from maxent .\nthis table was exported in ascii format and used to develop various visualizations of niche patterns .\nwe identified 12 lutzomyia species in the amaraj study during 2009 , for a total of 1361 individuals across the 255 trap sites .\nlutzomyia whitmani was by far the most abundant species , totaling 1195 individuals ( 87.8% ; table 1 ) .\nother species recorded included l. evandroi ( 4.9% ) , l. quinquefer ( 1.9% ) , and l. complexa ( 1.3% ) , among others .   in peridomiciliary environments ,\nl. whitmani was even more dominant ( 98.2% of individuals ) ; l. evandroi , l. quinquefer , and l. migonei appeared to show a similar association with human - modified environments , albeit in much lower numbers .\nin contrast , l. complexa , l. tupynambai , l. sordelli , l. longispina , and l. walkeri appeared restricted to forest and forest edge in this study ( table 1 ) .\nthe concentration of l. whitmani in peridomiciliary environments was much greater than would be expected by chance ( p < 0.05 ) ; tests for the remaining species were equivocal , probably owing to small sample sizes . \n\ntable 1 shows the distribution of positive sites and individuals species in forested and peridomiciliary areas . among\nthe 120 sandfly positive sites , 82 ( 68.3% ) were in peridomiciliary areas , while 38 ( 31.7% ) were detected in forested areas ( p = 0.005 ) .\nl. whitmani and l. quinquefer were dominant in peridomestic sites ( p < 0.05 ) , as well as l. migonei ( p = 0.07 ) , while l. complexa , l. sordelli , and l. tupynambai were found almost exclusively in forested areas ( p < 0.05 ) . for all other species , distribution of positive sites among peridomiciliary versus forested areas could not be determined ( p  0.05 ) .\nl. whitmani was the most abundant species as well as the most broadly distributed across the study area .\nrelating patterns of occurrence to patterns of surface reflectance in the landsat imagery , the jackknife process indicated ndvi from october and april as the environmental variables most associated with presence of l. whitmani .\nndvi of march and august were omitted from models in light of their little contribution to fitness of models .\nniche models estimated from and projected among the three regions of the study area for which cloud - free imagery was available showed good ( i.e. , better than random expectances ) coincidence with independent testing data sets ( table 2 ) . in particular , for example , for l. whitmani , the model based on western and central regions predicted the distribution of the species in the eastern region with an auc ratio mean of 1.12 , which has an associated probability value of p < 0.001 .\nthe other two predictions were similarly statistically significantly better than random expectations ( table 2 ) thus amply confirming both the environmental influences on sandfly distribution and the predictive power of our models . \n\nfigure 2 shows the relationship between modeled distributions in environmental space of l. whitmani as opposed to the other sandfly species at amaraj , revealing differences in the distribution of species according to the vegetation index .  \nfigure 3 shows adding detail regarding presences detected for l. whitmani versus other species in forested and peridomiciliary environments .\nl. whitmani appears to be associated negatively with ndvi values ( both in april , which is the rainy season , and in october , which is the dry season ) , as areas predicted as unsuitable for this species show generally higher ndvi values ( figures 2 and 3 ) .\nmost other lutzomyia species , on the other hand , appear associated positively with denser vegetation ( i.e. , higher ndvi values ) in both seasons ( figures 3 ) .\noverall , then , lutzomyia species ' occurrences are associated with specific environmental combinations ( with contrast among species ) in amaraj .\nin the amaraj region as well as in other areas of brazil , lutzomyia whitmani has been implicated as the principal acl vector , predominantly associated with leishmania braziliensis , the main parasite species involved in transmission , although in southern region of the country it is considered only a secondary vector [ 3 , 13 ] . in amaraj , although 12 species were detected , l. whitmani was dominant constituting 87.8% overall of detections , and 95% in peridomiciliary locations .\nin forested areas , l. whitmani was less dominant ( only 41.7% of detections ) , and other species played more meaningful roles in the sandfly community .\nthis tie of l. whitmani to human - altered environments has been noted also in amazon basin , and in the center - west and southern parts of the country [ 10 , 11 , 14 ] .\nhowever , in a nearby region of pernambuco with greater forest cover , l. whitmani was found to be a relatively unimportant member of the sandfly community , and l. complexa and l. choti were much more numerous . among the other species detected at amaraj\n, l. evandroi and l. migonei both also appeared to be concentrated in peridomiciliary environments .\nalthough far less common than l. whitmani , the human association of these species makes them of some interest in acl transmission , as in other regions [ 11 , 34 , 35 ] . given its domiciliation and massive dominance , l. whitmani is almost certainly the major acl vector in the region [ 24 , 36 ] .\nwhile other species were rare around human habitations , this sand fly was more abundant in peridomiciliary and to a lesser degree forested areas , offering a possible vectorial role for other leishmania species in the wooded environments .\ndetection of l. whitmani in peridomestic and forested areas reinforces the assumption that deforestation does not result in decline of the species habitat but adaptation and/or tolerance of different vegetation type and climatic condition .\nclearly , the next step in this process would be detailed analysis of ( 1 ) blood meal sources for each sandfly species in the region , ( 2 ) detection of leishmania infections in the flies , and ( 3 ) identification and association of leishmania strains in both sandflies and locally infected humans .\nthis group of information , together with our spatial data , would offer significant insight into the details of acl transmission cycle in the region .\npredictive models relating species occurrences to abiotic variables have been used in several previous studies of distribution and ecology of vectors , reservoirs , and infectious diseases [ 10 , 21 , 37 ] .\nmost previous analyzes have been carried out at scales that are set by resolution of the available environmental variables of occurrence data [ 21 , 38 , 39 ] .\nhowever , climate of the relatively small area designated in this study does not vary much over scales like this . whereas the analysis of existing vegetation indirectly reflects the effects of rain and vegetation in the region , identifying ecologically disturbed and forested areas is of particular interest in the study of lutzomyia spp .\nthe amount of vegetation in the dry and wet seasons were adequate in predictions of species occurrence , particularly for l. whitmani , which could be analyzed in detail .\nfor this purpose , ndvi provides a good index of ecosystem function with strong correlation with absorbed photosynthetically active radiation . in spite the fact that l. whitmani has been associated with geoecological factors , this highly anthropophilic species is also influenced by socioenvironmental changes and transformation on landscape [ 10 , 34 ] , which were not evaluated in this study .\nthere was a negative association between this species and higher ndvi values ( denser vegetation ) , and predictions of the distribution of l. whitmani among regsions were statistically significantly better than random expectations .\nthis result strongly suggests that it is feasible to predict the distribution of this important vector in regions where it is difficult to perform sampling due to factors such as difficult access and financial restrictions .", "human": " the purpose of this study is to analyze the spatial distribution and population trends through time of lutzomyia species in a long - term focus of cutaneous leishmaniasis transmission in an atlantic forest area , northeastern brazil . \n sand fly populations of different ecological niches were monitored spatiotemporally in 2009 . to summarize vegetation characteristics and phenology , we calculated the normalized difference vegetation index from landsat images . using niche modeling approaches , we assessed suites of environmental factors to identify areas of transmission risk . \n although 12 species were detected , l. whitmani was the most abundant and broadly distributed across the area , particularly in peridomiciliary locations , and associated negatively with denser vegetation areas . on the other hand , l. complexa , \n l. sordelli , and l. tupynambai were found almost exclusively in forested areas ( p < 0.05 ) , and associated positively with denser vegetation . \n lutzomyia species ' occurrences are related to specific environmental combinations ( with contrast among species ) in the region . ", "section_names": "1. Introduction\n2. Methods\n3. Results\n4. Discussion ", "bigbird_pegasus": "<s> american cutaneus leishmaniasis ( acl ) constitutes a significant public health problem in brazil, occurring in many highly endemic regions.<n> phlebotomine sandflies, lutzomyia spp.<n>, are important acl vectors in this country.<n> numerous studies point to the capacity of some lutzomyia species to adapt to human - altered environments in parts of brazil, which opens possibilities for broader and much increased transmission. in this paper<n>, we analyze various niche models to predict the presence of l. whitmani and l. migonei, two important acl vectors in brazil, in the atlantic forest region of pernambuco state, northeastern brazil.<n> the results suggest that acl transmission may be more widespread in pernambuco, particularly in areas with greater socioenvironmental heterogeneity.<n> it is also suggested that the different patterns of acl etiology in pernambuco, particularly in the atlantic forest region, may be due in part to differences in the behavior of different vectors.</s>", "longt5": "<pad> in brazil, american cutaneus leishmaniasis ( acl ) is a vector - borne zoonotic disease caused by several species of leishmania trypanosome protozoan parasites and transmitted by phlebotomine sandflies ( lutzomyia spp. ). the sandflies lutzomyia whitmani and l. migonei are considered important acl vectors in brazil and have generally been found in peridomiciliary environments in southeastern ( states of so paulo, minas gerais, esprito santo, rio de janeiro ), northeastern ( maranho, bahia, cear, pernambuco ), and west - central ( mato grosso, mato grosso do sul, tocantins ) regions. the purpose of this study is to analyze the behavior in terms of distribution and population trends through time and across space of lutzomyia species in a long - term focus of acl transmission in the state of pernambuco, brazil. we used 10 light traps per night on 3 - 4 nights, for 255 trap - nights over the course of the study. we calculated the normalized difference vegetation index ( ndvi ) from landsat images available from the u.s. geological survey ( http://glovis.usgs.gov/ ) with spatial resolution of 30 m ( 98 ft ). we used ecological niche modeling ( enm ) routines implemented in maxent. lutzomyia whitmani was the most abundant species as well as the most broadly distributed across the study area. l. whitmani appears to be associated negatively with ndvi values ( both in april and in october ), as areas predicted as unsuitable for this species show generally higher ndvi values. most other lutzomyia species, on the"}
{"article": "cell growth is tightly linked with the cell 's perception of its nutritional environment . in particular , microorganisms , such as the yeast saccharomyces cerevisiae , that spend most of their time in the stationary phase in the wild ,\ntherefore , yeast is a good model organism for the study of nutrient detection and response .\nautophagy is one of several responses to nutrient starvation ( klionsky and ohsumi 1999 ) .\na large number of cytoplasmic components are nonselectively enclosed within a double - membrane structure called an autophagosome , in which they are transported into the vacuole / lysosome to be degraded by resident hydrolases\n. such turnover of a large amount of cytoplasm mediated by autophagy is essential for survival under nutrient - depleted conditions .\nwe have isolated several genes essential for autophagy ( termed apg ) and have been investigating the function of the gene products ( tsukada and ohsumi 1993 ; funakoshi et al . 1997 ; matsuura et al .\n1998 ) . genetic and morphological analyses revealed that the degradative process of autophagy shares mechanistic components with the cytoplasm - to - vacuole targeting ( cvt ) pathway ( harding et al .\n; baba et al . 1997 ) , which is biosynthetic , delivering a resident hydrolase , aminopeptidase i ( api ) , to the vacuole ( klionsky and ohsumi 1999 ) .\non the other hand , autophagy and the cvt pathway are distinct in many aspects .\nthe two pathways appear to be regulated separately ; the cvt pathway is mainly observed under growing conditions , whereas autophagy is induced by starvation ( baba et al .\nfurthermore , cvt vesicles and autophagosomes , the vesicles formed in the cvt pathway and autophagy , respectively , are clearly different in size ( baba et al . 1997 ) .\nrecently , the t - snare tlg2 and sec1-homologue vps45 were found to be required for the cvt pathway , but dispensable for autophagy , suggesting that these two pathways are mechanistically distinct ( abeliovich et al . 1999 ) .\ntor is a phosphatidylinositol kinase - related kinase that promotes cell cycle progression in response to nutrient availability ( thomas and hall 1997 ) .\ntreatment with the immunosuppressant rapamycin , a specific inhibitor of tor , induced cell cycle arrest at g0 .\nfor example , accumulation of glycogen , repression of genes that are stimulated in growing cells , and stimulation of genes that are induced during starvation , all result from inhibition of tor ( hardwick et al .\nour laboratory has found that rapamycin induces autophagy in yeast ( noda and ohsumi 1998 ) .\nhowever , the molecular mechanism by which tor negatively regulates autophagy remains to be determined .\nhere , we present evidence that apg1 , a protein kinase essential for autophagy , plays a pivotal role in induction of tor - regulated autophagy .\nan nh2-terminally truncated ( 8 amino acid ) form of apg1 open reading frame , subcloned into pgbd - c2 vector , was used as bait to screen a yeast genomic library , and interacting proteins were identified by dna sequencing . a dna fragment including the entire apg17 gene was cloned from yeast genomic dna using pcr .\nthe kinase - negative apg1 mutation was obtained using the quikchange site - directed mutagenesis kit ( stratagene ) .\nantibody against apg13 protein was raised against a glutathione s  transferase ( gst)-apg13 fusion protein .\nspecifically , a 1.9-kb bglii - xbai fragment of the apg13 gene coding for 396 amino acids of apg13p was subcloned into the vector pgex-2 t .\nthe expressed fusion protein was purified with glutathione - sepharose 4b ( amersham pharmacia biotech ) .\nexpression and purification of the fusion protein was carried out according to the manufacturer 's instructions .\nimmunoprecipitation , kinase assay , and immunodetection of nh2-terminally hemagglutinin ( ha)-tagged apg1 ( apg1 ) were performed as described previously ( kamada et al .\napg1 was immunoprecipitated with anti - ha mab ( 16b12 ; babco ) , and an in vitro protein kinase assay was performed in the presence of [p]atp and myelin basic protein ( mbp , substrate ) .\nyeast cells exponentially grown in yepd medium were treated with zymolyase 100 t ( seikagaku kogyo ) to generate spheroplasts .\nthe resultant spheroplasts were treated with or without 0.2 g / ml of rapamycin and broken by resuspending in lysis buffer ( pbs , ph 7.4 , 1 mm edta , 1 mm egta , 2 mm na3vo4 , 50 mm kf , 15 mm na2h2p2o7 , 15 mm p - nitrophenylphosphate , 20 g / ml leupeptin , 20 g / ml benzamidine , 10 g / ml pepstatin a , 40 g / ml aprotinin , 1 mm pmsf , and 0.5% tween-20 ) .\ncell lysate was cleared by 10-min centrifugation at 6,500 g and 30-min incubation with protein g \napg1 in the cleared cell lysate was bound to anti - ha mab , and apg13 was detected with anti - apg13 antibody .\nthe resultant immunoprecipitates were also analyzed by protein kinase assay and immunoblot with anti - ha . for in vivo labeling of apg13 , cells ( tfd13-w3 ) expressing apg13 were in vivo - labeled with 50 ci of s ( trans , icn ) for 10 min , or 50 ci of pi overnight in sd medium , and transferred to yepd or nitrogen - depleted medium sd(n ) for 1 h. apg13 protein was immunoprecipitated following tca precipitation .\nimmunoprecipitated apg13 was treated with 5 u of alkaline phosphatase for 1 h at 30c .\nprogression of autophagy was estimated by the increase of alkaline phosphatase activity in the cells expressing a cytosolic proform of the phosphatase protein ( pho860p ; noda et al .\nin an effort to study the mechanism of autophagy induction , we focused on the apg1 gene , which encodes a protein kinase whose activity is essential for autophagy ( matsuura et al .\nnh2-terminally ha - tagged apg1 ( apg1 ) was immunoprecipitated with anti - ha ascite and the resultant immunocomplex was analyzed using an in vitro kinase assay .\napg1 kinase activity was found to be highly elevated in cells grown under starvation conditions ( fig .\n1 a ) . after a 6-h incubation in nitrogen - depleted medium , sd(n )\n, the amount of activated apg1 had apparently increased , and was accompanied by slower gel migration , presumably because of autophosphorylation ( fig .\nthe increase in apg1 kinase activity is not due to this apparent increase in the protein amount , because shorter treatments with rapamycin ( for example , see fig .\napg1 activity was also increased by rapamycin treatment , but the effect of rapamycin was abolished in a rapamycin resistant tor1 mutant ( tor1 - 1 ; kunz et al .\nthese results suggest that apg1 activation is required for the induction of autophagy and that it is mediated by tor proteins . a kinase - negative apg1 mutant ( k54a ;\nthis indicates not only that the enhanced apg1 kinase activity is required for autophagy , but that basal apg1 activity in growing cells ( fig .\nnext , we performed a two - hybrid screening with apg1 as bait to identify apg1-associating proteins , which may regulate apg1 activity .\nthe following three genes were obtained from the screen : apg13 ( funakoshi et al .\n1997 ) and two novel genes , which were subsequently found to be essential for either autophagy or the cvt pathway , or both .\none gene , designated as apg17 ( ylr423c ) , was essential for only autophagy and was not required for the cvt pathway ( fig .\n2 a ) . the other , cvt9 ( harding et al . 1996 ; d.j . klionsky , personal communication ) , was required for the cvt pathway , but not for autophagy . among the 16 apg genes discovered so far ,\nit is interesting to note that apg1 binds to proteins whose function is specific to either autophagy ( apg17 ) or the cvt pathway ( cvt9 ) .\noverexpression of apg1 in an apg13 mutant partially rescues the autophagy defect ( funakoshi et al .\nsimilarly , the apg17 mutant was also rescued by overexpression of apg1 ( data not shown ) , indicating that these three genes interact functionally .\nin the apg13 mutant , attenuated apg1 activity was observed . in rapamycin - treated apg17 cells\n, apg1 activity also was found to be largely impaired ( 20% of the wild - type ) . on the other hand ,\ndeletion of cvt9 , which is not needed for autophagy , resulted in rapamycin - induced activation of apg1 to 50% of wild - type .\nthe effects of deleting apg13 and apg17 on apg1 activity are not the result of a general autophagy defect , because deletion of other apg genes , such as apg5 ( mizushima et al .\n1998 ) , does not affect the activation of apg1 ( data not shown ) .\nthese results indicate that the activated state of apg1 is required for autophagy induction , and that apg13 and apg17 play a key role in the activation of apg1 in response to tor inhibition .\nthe next question we addressed was how these apg1-associating proteins transmit the starvation signal from tor to apg1 .\noverexpression of apg13 resulted in a smeared apg13 band on the immunoblot caused by retarded migration , indicating that it was modified in some way ( fig .\nthis modified form was observed only in growing cells , and after starvation or rapamycin treatment , the slower - migrating form disappeared . in particular , it was noted that the disappearance of the slower - migrating form occurred within five minutes after rapamycin treatment . in vivo labeling and in vitro phosphatase treatment revealed that the apg13 bandshift was due to phosphorylation ( fig .\nthese results suggest that apg13 is phosphorylated in a tor - dependent manner , which was confirmed by the observation that dephosphorylation of apg13 in response to rapamycin was not seen in tor1 - 1 cells ( fig .\nthe dephosphorylated , faster - migrating form of apg13 in starved cells was rapidly phosphorylated after readdition of yepd medium ( fig .\n3 d ) , suggesting that the phosphorylation state of apg13 is extremely sensitive to nutrient conditions .\nthis excludes the possibility that the phosphorylated form of apg13 is degraded upon starvation and apg13 is de novo synthesized after medium addition .\nthe faster - migrating form of apg13 ( as well as the slower - migrating form ) was found to be labeled with pi ( fig\n. 3 b , lane 8) , suggesting that apg13 remains partially phosphorylated under starvation conditions . to confirm that there is a physical association between apg1 and apg13\na vacuolar protease - deficient strain was used for these experiments because apg13 is quite labile in cell lysate . when apg1 and apg13 were expressed from a high - copy plasmid , only the faster - migrating form of apg13\n3 e ) , indicating that the hyperphosphorylated form of apg13 has little affinity for apg1 .\nnext , we performed the experiment using a low - copy plasmid to more closely approximate physiological cellular conditions .\nthe amount of apg13 bound to apg1 increased rapidly ( as quickly as 10 min ) after rapamycin treatment ( fig . 3 f ) , which corresponds well to the time course of apg13 dephosphorylation .\nthese results strongly indicate that tor negatively regulates apg1 kinase activity by means of ( hyper)phosphorylation of apg13 , which reduces the affinity of apg13 for apg1 . from these results\n, we hypothesized that apg13 binding to apg1 is required for the induction of autophagy , but not for the cvt pathway .\nthe two - hybrid assay was used to determine the apg1-binding site on apg13 , using various apg13 open reading frame fragments as prey . a central 89-amino acid region ( 432520 )\nwe also isolated a cooh - terminal truncated form of apg13 , apg13(1448 ) , whose ser449 was mutated to a stop codon using in vitro mutagenesis ( kaiser et al .\nthis mutant has a mutation within the putative apg1-binding site , and is unable to associate with apg1 , as confirmed by the two - hybrid assay and coimmunoprecipitation ( fig .\n4 a , and data not shown ) . this result indicates a role for a domain of apg13 around amino acid 448 in binding apg1 .\nwe tested several cooh - terminal truncated apg13 mutants including apg13(1448 ) for autophagy activity .\n4 b , bottom ) , presumably due to the absence of the apg1-binding domain .\nanother cooh - terminal truncated form , apg13 ( 1568 ) , which contains the entire putative apg1-binding domain , displayed partial , but significant , autophagic activity , when compared with apg13(1448 ) .\napg13(1568 ) was less competent for autophagic import than full - length apg13 , suggesting that additional sequences downstream of the apg1 binding site are important for maximal activity .\non the other hand , apg13(1448 ) partially , but significantly , rescued vacuolar - targeting of precursor api ( fig .\n4 b , top ) , suggesting that this truncated protein is still functional for the cvt pathway .\napg1 activity in the apg13 mutant was partially restored in the presence of either apg13(1448 ) or apg13(1568 ) , and was fully recovered in the presence of the whole apg13 construct ( fig . 4 c ) .\nthe kinase activity of the apg13(1568 ) transformant was clearly higher than that of the apg13(1448 ) transformant .\nthese results confirmed the hypothesis that the apg1apg13 association and subsequent activation of apg1 are required for autophagy induction in response to starvation .\nit is currently thought that tor signaling in yeast is bifurcated ( thomas and hall 1997 ) .\none pathway involves the small gtpase rho1 , which is responsible for actin organization and is not affected by rapamycin .\nthe other involves tap42 , a rapamycin - sensitive phosphatase - associating protein that is necessary for the initiation of protein translation and amino acid permease turnover ( di como and arndt 1996 ) . tap42\nis known to be located directly downstream of tor , and is required for tor - mediated signaling , especially the rapamycin - sensitive branch ( jiang and broach 1999 ) . to investigate this issue further , we tested the ability of a tap42 mutant ( tap42 - 11 ; di como and arndt 1996 ) to induce autophagy at a nonpermissive temperature .\naccumulation of vacuolar autophagic bodies in tap42 cells was found to be comparable to that in wild - type cells , confirming that induction of autophagy is not controlled by tap42 ( fig . 5 ) .\nfurthermore , deletion of npr1 , whose product is a protein kinase negatively regulated by tap42 ( schmidt et al .\n1998 ) , did not affect the induction of autophagy ( data not shown ) .\ntherefore , we concluded that tap42 does not transmit a signal from tor in the autophagy induction pathway .\nthe association between apg1 and apg13 is negatively regulated by tor signaling . in nutrient - rich conditions ,\ndephosphorylated apg13 possesses a high affinity for apg1 , which is activated upon apg13 binding , leading to induction of autophagy .\nthis tight apg1apg13 association is required for autophagy , but not for the cvt pathway , an observation that supports a model in which the apg1apg13 complex plays an important role in switching from the cvt pathway to autophagy in response to nutrient conditions ( fig .\nthe function of apg17 is still unclear , but our preliminary results suggest that it may be involved in the apg1apg13 interaction . when both apg1 and apg13 were overexpressed , apg1apg13 binding was observed , even in cells grown in yepd ( fig .\n3 d ) , resulting in a small amount of apg1 activation , insufficient to induce autophagy ( e.g. , see fig\nprotein sorting to the plasma membrane and vacuolar degradation of amino acid permeases , gap1 and tat2 , are also regulated in response to nutrient conditions , and are dependent upon tor , npr1 , and tap42 ( but not on apg1 ; roberg et al .\ntap42 plays a key role in the rapamycin - sensitive tor pathway , suppressing npr1 activity ( schmidt et al .\nour observation that tor regulation of apg1 activity and autophagy induction is rapamycin - sensitive , but tap42-independent , implies that the apg1apg13 interplay comprises a novel tor signaling pathway regulating autophagy induction .\nit is possible that tor directly phosphorylates apg13 , but this remains to be investigated .\nrecently , nuclear transport of transcription factor gln3 has been shown to be under the control of tor signaling , but the involvement of tap42 in this system is still controversial ( beck and hall 1999 ; cardenas et al . 1999 ) .\ndeletion of gln3 did not affected autophagy ( data not shown ) . in mammalian cells , two targets of mammalian tor ( mtor )\nhave been identified : 4e - bp1 and p70s6k ( thomas and hall 1997 ) .\nanother recent study reported a relationship between mammalian tor and autophagy ( shigemitsu et al .\napg1 homologues of caenorhabditis elegans ( ogura et al . 1994 ) and mammals ( yan et al .", "human": " autophagy is a membrane trafficking to vacuole / lysosome induced by nutrient starvation . in saccharomyces \n cerevisiae , tor protein , a phosphatidylinositol kinase - related kinase , is involved in the repression of autophagy induction by a largely unknown mechanism . here , \n we show that the protein kinase activity of apg1 is enhanced by starvation or rapamycin treatment . \n in addition , we have also found that apg13 , which binds to and activates apg1 , is hyperphosphorylated in a tor - dependent manner , reducing its affinity to apg1 . \n this apg1apg13 association is required for autophagy , but not for the cytoplasm - to - vacuole targeting ( cvt ) pathway , another vesicular transport mechanism in which factors essential for autophagy ( apg proteins ) are also employed under vegetative growth conditions . \n finally , other apg1-associating proteins , such as apg17 and cvt9 , are shown to function specifically in autophagy or the cvt pathway , respectively , suggesting that the apg1 complex plays an important role in switching between two distinct vesicular transport systems in a nutrient - dependent manner . ", "section_names": "Introduction\nMaterials and Methods\nResults\nDiscussion", "bigbird_pegasus": "<s> the degradative process of autophagy, which is essential for survival under nutrient - depleted conditions, shares mechanistic components with the cytoplasm - to - vacuole targeting ( cvt ) pathway.<n> furthermore, autophagy and the cvt pathway appear to be distinct in many aspects.<n> furthermore, cvt vesicles and autophagosomes, the vesicles formed in the cvt pathway and autophagy, respectively, are clearly different in size.<n> furthermore, cvt vesicles and autophagosomes, the vesicles formed in the cvt pathway and autophagy, respectively, are clearly different in size. we have isolated several genes essential for autophagy ( termed apg ) and have been investigating the function of the gene products.<n> these analyses revealed that autophagy shares mechanistic components with the cytoplasm - to - vacuole targeting ( cvt ) pathway.</s>", "longt5": "<pad> autophagy is one of several responses to nutrient starvation. we have isolated several genes essential for autophagy ( termed apg ) and have been investigating the function of the gene products. here, we present evidence that apg1, a protein kinase essential for autophagy, plays a pivotal role in induction of tor - regulated autophagy. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy, but not for the cytoplasm - to - vacuole targeting pathway. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy, but not for the cytoplasm - to - vacuole targeting pathway. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy, but not for the cytoplasm - to - vacuole targeting pathway. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy, but not for the cytoplasm - to - vacuole targeting pathway. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1, which is activated upon apg13 binding, leading to induction of autophagy, but not for the cytoplasm - to - vacuole targeting pathway. in nutrient - rich conditions, dephosphorylated apg13 possesses a high affinity for apg1,"}
{"article": "adenosine is released into the extracellular space when the oxygen supply is decreased or energy consumption is increased [ 1 , 2 ] . in particular , significant levels of adenosine\nare found in the extracellular fluid of solid tumors , suggesting a role for adenosine in tumor growth .\nadenosine is an endogenous nucleoside that modulates many physiological processes through its interaction with at least four membrane receptors : a1 , a2a , a2b , and a3 [ 4 , 5 ] .\nthe a2 receptors are divided into two subtypes : high - affinity a2 receptors in rat striatum and low - affinity a2 receptors throughout the brain .\nthese high- and low - affinity receptor subtypes were later designated as a2a and a2b , respectively .\nit was thought that the a2b receptor plays a small role in vivo because of its relatively low affinity for adenosine .\nrecently , spychala discovered that activation of adenosine receptors may be involved in tumor progression .   in a previous study , we collected 64 samples of hepatocellular carcinoma from clinical patients and found that a2b receptors were highly expressed in tumor tissue and expressed in peritumoral tissues to a lesser extent by real - time pcr , western blot , and immunohistochemical staining .\nthese results indicate that the a2b receptor may contribute to hepatic tumor progression and may represent a good therapeutic target . in recent years\n, rna interference ( rnai ) has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer . in this study\nour vector is based on the psilencer 3.1-h1 neo ( hind iii / bamh i ) vector ( ambion ) which contains the human h1 promoter and neomycin resistance gene to enable antibiotic selection in mammalian cells .\nthree pairs of complementary oligonucleotides ( shrna1 , shrna2 , and shrna3 ) were synthesized , targeting adenosine a2b receptor cdna ( genbank : nm_000676cds 3331331 ) at nucleotides 591610 , 856875 , and 909928 , respectively .\nthe oligonucleotides encoding the human adenosine a2b receptor shrna targeting the adenosine a2b receptor were as follows ( http://www.ambion.com/techlib/resources/rnai/index.html ) .  \n\nshrna 1 \n 5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-35-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 \n\n \n 5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-35-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 \n  5-gatcccgtgctggtgatctacattaattcaagagattaatgtagatcaccagcattttttggaaa-3 5-agcttttccaaaaaatgctggtgatctacattaatctcttgaattaatgtagatcaccagcacgg-3 \n shrna 2 \n 5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-35-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 \n\n \n 5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-35-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 \n  5-gatcccgtcccattgtctatgcttacttcaagagagtaagcatagacaatggga ttttttggaaa-3 5-agcttttccaaaaaatcccattgtctatgcttactctcttgaagtaagcatagacaatgggacgg-3 \n shrna 3 \n 5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-35-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 \n\n \n 5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-35-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 \n  5-gatcccgttatctccaggtatcttctttcaagagaagaagatacctggagataattttttggaaa-3 5-agcttttccaaaaaattatctccaggtatcttcttctcttgaaagaagatacctggagataacgg-3 all oligonucleotides were synthesized by sbs genetech , ltd .\nthe synthesized shrna cassette was annealed and cloned into the psilencer3.1-h1 neo vector according to the manufacturer 's instructions .\na blast search with the target sequences was performed to ensure that only the adenosine a2b receptor gene was targeted .\na scrambled control plasmid ( psilencer-3.1-y ) encoding a shrna contained a sequence not present in the mouse , human , or rat genome databases .\nshrna \n 5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and   5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. \n\n \n 5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and   5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. \n  5-gatccagttcaacgaccagtagtcttcaagagagactactggtcgttgaactttttttggaaa-3 and    5-agcttttccaaaaaaagttcaacgaccagtagtctctcttgaagactactggtcgttgaactg-3. hepg2 cells were cultured in dulbecco 's modified eagle 's medium ( dmem , gibco ) , supplemented with 10% heat - inactivated fbs in a humidified incubator with 5% co2 at 37c .\ncells were transfected with lipofectamine 2000 ( invitrogen ) according to the manufacturer 's instructions with 8  g psilencer 3.1-h1 neo - mix ( shrna1 , shrna2 , and shrna3 ) and psilencer-3.1-y .\none day after transfection , cells were screened in medium containing g418 ( 0.4  mg / ml ) and resistant clones were maintained in medium containing 0.4  mg / ml g418 .\nstably transfected cells were plated in 60-mm dishes ( 1.5  10 per dish ) .\nthe treated cells were trypsinized and then centrifuged for 2 minutes at 12,000  rpm at 4c .\ncell pellets were washed with pbs , collected , and lysed with trizol reagent ( gibco ) .\ntotal rna was isolated by phenol / chloroform extraction , isopropanol precipitation , and 75% ethyl alcohol wash and dissolved in depc water .\nthe reverse transcription reaction was set up according to promega 's reverse transcription system protocol using primers for the a2b receptor ( forward primer : 5-tccatcttcagccttctggc-3 ; reverse primer : 5-aaaggcaaggacccagagga-3 ) and -actin ( forward primer : 5-gccctgaggcactcttcca-3 ; reverse primer : 5-gaaggtagtttcgtggatgcca-3 ) .\neach pcr reaction was performed using an optimized number of cycles ( 25 cycles ) of 94c for 1 minute , 56c for 30 seconds , and 72c for 40 seconds , with a final extension of 72c for 7 minutes .\nthe pcr reactions were visualized on a 1.2% agarose gel containing 5  g / ml of ethidium bromide .\nintensity of the dna bands was analyzed by glyko bandscan analysis software , using -actin as an internal standard .\ncell monolayers in six - well culture plates were washed twice with ice - cold pbs and lysed with 150  l of ripa lysis buffer ( 0.05  m tris - hcl ( ph 7.4 ) , 0.15  m nacl , 0.25% deoxycholic acid , 1% np-40 , and 1  mm edta ) containing protease inhibitors ( 1  mm pmsf , 1  g / ml aprotinin , and 1  g / ml leupeptin ) .\nprotein concentration was measured ( bca protein assay , pierce ) , and samples were resolved by reducing sds - page , transferred to nitrocellulose , and incubated in blocking buffer ( 25  mm tris - hcl , ph 8.0 , 125  mm nacl , 0.05% tween 20 , and 5% bsa ) .\nmembranes were incubated with an antibody to the adenosine a2b receptor ( chemicon international , diluted 1  :  200 ) at 4c overnight .\nthe membranes were washed in blocking solution and incubated with an hrp - conjugated secondary antibody for 1 hour at room temperature .\nblots were exposed to x - ray film for the appropriate time period . a total of 2  10 cells / well were suspended in complete medium containing 0.3% agarose ( gibco ) and seeded in triplicate in six - well plates onto a bottom layer of complete medium containing 0.6% agarose .\na total of 50,000 cells were used for fluorescence - activated cell sorter analysis ( facs ) .\nbriefly , the cells were harvested , washed twice with pbs buffer , and then incubated at room temperature for 45 minutes .\nafter two pbs washes , the cells were resuspended in pbs and filtered through spectra mesh filters ( spectrum ) .\ndata were analyzed by cellquest software ( becton - dickinson ) and the modfit / lt software . at total of 20,000 events\nhepg2 cells were passed into 96-well plates ( 1,000 cells / well ) 24 hours after transfection .\nviability and proliferation of cells were measured using mtt assays from the second until the seventh day after passage . for each group ,\nexperiments were carried out a total of three times , and the difference in average od ( 490  nm ) between treated groups was compared using the unpaired , two - tailed t - test .\nresults were expressed as mean  standard error ( se ) . values with p < 0.05 were considered significant .\nfour pairs of primers were cloned into psilencer3.1-h1 neo ( hind iii / bamh i ) vector to construct four interfering vectors : psilencer3.1-h1 neo-1 , psilencer3.1-h1 neo-2 , psilencer3.1-h1 neo-3 , and psilencer3.1-h1 neo - y .\nplasmids were verified by sequencing ( figure 1 ) . to verify the silencing effect of the three sirna vectors , we transfected the three vector psilencer3.1-h1 neo-1 , 2 , 3 ( mixed ) and psilencer3.1-h1 neo - y ( as control ) into the hepg2 cell line .\nrt- pcr showed that transfection of mixed vector could decrease the a2b receptor mrna about 66%  5% , while psilencer3.1-h1 neo - y had no effect ( figure 2 ) .  \nwestern blot analysis of a2b receptor was comparable to the rt - pcr results ( figure 3 ) .\ncells transiently transfected with psilencer3.1-h1 neo-1 , 2 , 3 decreased levels of adenosine a2b receptor ( about 70%  8% ) .\ncells transfected with psilencer3.1-h1 neo - y had no effect on a2b receptor protein levels .\nafter seven days in culture , we compared the proliferation rate of the three groups of cells .\nthe cells transfected with psilencer3.1-neo - mix showed a significant decrease in the proliferation rate after five days in culture .\nhowever , cells transfected with psilencer3.1-neo - y and untransfected cells had similar proliferation rates ( figure 4(a ) ) .   to determine anchorage - independent growth rates ,\ncontrol - transfected cells showed an average colony forming efficacy of 108  10.7% , compared to untransfected hepg2 cells (= 100% ) .\nin contrast , stably transfected cells showed a decreased colony forming ability of 60.33  9.6% compared with hepg2 cells ( p < 0.05 ) ( figure 4 ( b ) ) . to explore the mechanism of growth suppression in a2br - silencing cells ,\nthe number of cells in go / g1 phase was 89.56 , 62.01 , and 56.19% for the psilencer3.1-neo - mix , psilencer3.1-neo - y , and untransfected cells , respectively ( figure 5 and table 1 ) .\nliver cancer is the fifth most important cancer worldwide in terms of morbidity but the third in terms of mortality .\nin addition , its mortality has increased in recent years , with 548,600 cases in the year 2000 .\nlittle is known about the mechanisms of hepatocarcinogenesis which seem to differ according to the risk factors involved .\nmany genes are associated with liver cancer.the p53 protein is involved in cell cycle control , senescence , dna repair , genomic stability , and apoptosis , and different mutations of p53 are involved in hepatocellular carcinoma formation . the prb protein is phosphorylated during the g1 phase of the cell cycle by members of the cyclin - dependent kinase ( cdk )\nthe mutation of other genes , including -catenin , smad2 , smad4 , p16 ink4a , and cyclin d1 , may also be implicated in liver cancer .  \nsignificant advances have been made in the understanding of the molecular pharmacology and physiological relevance of adenosine receptors , but little is known about a2b receptors .\na2b receptors have been implicated in mast cell activation   and asthma , vasodilation , regulation of cell growth , intestinal function , and modulation of neurosecretion . in a previous study , we found that a2b receptors were highly expressed in hepatocellular carcinoma tissue , indicating that expression of the a2b receptor may contribute to tumor progression and may be a good therapeutic target for liver cancer .\nrna interference ( rnai ) is a natural silencing process first described in caenorhabditis elegans and drosophila melanogaster   by which double - stranded rna initiates and directs the degradation of homologous mrna .\nspecific inhibition of cellular mrna by rnai can be triggered in mammalian cells by the introduction of synthetic 21- to 23-nucleotide double - stranded small interfering rna ( sirna ) [ 26 , 27 ] or alternatively by the transcription of sirna from a dna construct driven by the rna polymerase cassette .\nrnai technology has been widely used as an extremely powerful strategy for reverse functional genomics [ 29 , 30 ] and as an effective method for gene silencing - based therapeutics [ 31 , 32 ] .\nrnai - mediated inhibition of virus infection or replication has been reported for numerous viruses , including several important human pathogens such as hiv-1 , hepatitis c virus , and dengue virus [ 3335 ] .\n, we constructed three rnai vectors which target the a2b receptor gene to investigate if silencing can convert the tumor phenotype .\nas shown by rt - pcr and western blot , transfected cells showed specific silencing of the a2b receptor gene without interrupting other molecular interactions . a stably transfected hepg2 cell line which silences the expression of a2b receptors\nmtt and soft agar assays show that the proliferation rate of the stably transfected cells was significantly decreased compared with control - transfected or untransfected hepg2 cells .\nfcm experiments revealed that 89.56  3.15% of stably transfected cells were in the g1 phase .\ntaken together , these results show that rnai silencing of the a2b receptor gene alters the phenotype of hepg2 cells , and this method might lead to development of novel therapies for the human hepatocellular carcinoma .", "human": " to investigate the biological effect of adenosine a2b receptor ( a2br ) on the human hepatocellular carcinoma cell line hepg2 , three a2br sirna constructs were transiently transfected into hepg2 cells . \n the results showed that a2br sirna reduced the levels of a2br mrna and protein . in order to further detect the function of a2br , we established a stable hepatocellular carcinoma cell line ( hepg2 ) expressing sirna targeting the adenosine a2b receptor . \n targeted rnai significantly inhibited tumor cell growth in vitro , and flow cytometry ( fcm ) showed that significantly more cells expressing a2br sirna were in the g0/g1 phase compared to the untransfected group ( ( 89.56%  3.15% ) versus ( 56.19%  1.58% ) , p < 0.01 ) . \n these results indicated that silencing the expression of adenosine a2b receptor in hepg2 cells can suppress cell growth effectively by blocking the cell cycle . \n downregulation of adenosine a2b receptor gene expression with rna interference could be a new approach to hepatocellular carcinoma therapy . ", "section_names": "1. Introduction\n2. Materials and Methods\n3. Results\n4. Discussion", "bigbird_pegasus": "<s> rna interference ( rnai ) has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer.<n> recently, spychala discovered that activation of adenosine receptors may be involved in tumor progression.<n> adenosine a2b receptors are divided into two subtypes : high - affinity a2 receptors in rat striatum and low - affinity a2 receptors throughout the brain.<n> these high- and low - affinity receptor subtypes were later designated as a2a and a2b, respectively.<n> it was thought that the a2b receptor plays a small role in vivo because of its relatively low affinity for adenosine. in a previous study, we collected 64 samples of hepatocellular carcinoma from clinical patients and found that a2b receptors were highly expressed in tumor tissue and expressed in peritumoral tissues to a lesser extent by real - time pcr, western blot, and immunohistochemical staining.<n> these results indicate that the a2b receptor may contribute to hepatic tumor progression and may represent a good therapeutic target. in recent years, rnai has been widely used to study gene expression regulation in mammalian cells and therapeutic intervention for various diseases including cancer. in this study,<n> three pairs of complementary oligonucleotides were synthesized, targeting adenosine a2b receptor cdna cdna ( genbank : nm_000676cds 3331 ).<n> the a2b protein is highly expressed in the g1 phase. the growth of the p53, the p53 protein levels of the p53 protein of the p53 protein.<n> the p53 protein.<n> the p53 protein.<n> the p53. the p53 protein.<n> the ps..<n> the p was the p p was the p was the p.<n> the p was the.<n> the p.<n> the p.<n>.<n> the p.<n>.<n>.<n>.<n>..<n>.<n>.<n>.<n>.<n><n><n><n><n><n><n><n><n> the p was the p.<n><n><n><n><n><n><n><n><n><n><n><n><n><n> is the p.<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> the a.", "longt5": "<pad> adenosine is an endogenous nucleoside that modulates many physiological processes through its interaction with at least four membrane receptors : a1, a2a, a2b, and a3. it was thought that the a2b receptor plays a small role in vivo because of its relatively low affinity for adenosine. recently, spychala discovered that activation of adenosine receptors may be involved in tumor progression and may represent a good therapeutic target. in this study we constructed rna interference vectors which target the a2b receptor gene to investigate if silencing can convert the tumor phenotype. rt - pcr and western blot showed that transfection of mixed vector could decrease the a2b receptor mrna about 66% 5%, while psilencer3.1-h1 neo - y had no effect. in contrast, stably transfected cells showed a decreased colony forming ability of 60.33 9.6% compared with hepg2 cells ( p <unk> 0.05 ). fcm experiments revealed that 89.56 3.15% of stably transfected cells were in the g1 phase. taken together, these results show that rnai silencing of the a2b receptor gene alters the phenotype of hepg2 cells, and this method might lead to development of novel therapies for the human hepatocellular carcinoma.</s>"}
{"article": "the online version of this article ( doi:10.1007/s40121 - 014 - 0043 - 9 ) contains supplementary material , which is available to authorized users .\na member of the togaviridae family , infection with the chikungunya virus ( chikv ) has emerged as a major public health concern , resulting in outbreaks of fever and debilitating arthralgia in the caribbean and globally .\nthe first autochthonous ( native ) transmission of chikv in the caribbean was confirmed in december 2013 on the french island of saint martin .\nrapid spread and local transmission of chikv occurred in the caribbean and the americas within 9  months ( fig .  1 ) .\nthis has resulted in 651,344 suspected and 9,182 laboratory - confirmed chikungunya cases in the caribbean and the americas as reported by the centers for disease control and prevention .\nthe effective management of the rapid spread of chikungunya is integrally related to the geographic distribution and re - emergence of competent mosquito vectors , evolving chikv genotypes , susceptible human populations , environmental influences , and social mobilization .\nunderstanding the contribution of these factors is important to improving the control of the global transmission of this disease.fig . \n1introduction of chikungunya to the caribbean by epidemiological week first reported  december 2013 to august 2014 .\ndata from paho / who statistics   introduction of chikungunya to the caribbean by epidemiological week first reported  december 2013 to august 2014 .\nthere are three distinct chikv genotypes : west african , east central south african [ ecsa ; or indian ocean lineage ( iol ) ] , and asian [ 1 , 5 , 6 ] . these genotypes represent the evolution of the virus in keeping with the geographic distribution over the years . in africa , this virus is transmitted through enzootic ( sylvatic ) and urban ( human  mosquito cycle ) cycles among non - human and human primates by aedes mosquitoes species .\nprevious authors report the probable existence of the chikv in africa for hundreds of years , with the first suspected epidemic documented in 1779 .\nsubsequent reports included outbreaks in nigeria ( 1964 ) , the ivory coast ( 1981 ) , and senegal ( 1983 ) associated with the west african strain .\nthe resurgence of chikungunya in the twentieth century was first documented in 1953 , in the newala district of tangaiynika ( tanzania ) .\nthe chikv continued to spread through the suspected vectors aedesfurcifer / aedescordellieri , to other south african countries , inclusive of rhodesia ( zimbabwe ; 1961 , 1962 , and 1971 ) .\nepidemics associated with the ecsa lineage subsequently occurred in cameroon ( 2006 ) and gabon ( 2007 ) with aedesafricanus and aedesalbopictus reported as the principal vectors , respectively . in gabon in 2007 , concurrent chikv and dengue fever epidemics were also experienced , with chikv transmission linked to the a.albopictus mosquito .\nthe iol strain originated in coastal kenya in 2004 and 2005 ( affecting 75% of the lamu island s population , via the vector aedesaegypti ) and then spread to the reunion island ( affecting one - third of the population ) and was subsequently introduced to other islands of the indian ocean and continental india , via the vector a.albopictus [ 1 , 57 , 12 ] .\nit is believed that the 2007 outbreak in italy was initiated through the importation of the chikv by a traveler from reunion island .\nother countries in which international travel facilitated the spread of chikv included france ( from travelers from reunion island ; 77% ) , comoros ( 14% ) , and mauritius ( 9% ) .\nautochthonous transmission in france , however , was not detected until the year 2010 , in association with a. albopictus .\nstudies have reported a high efficiency of transmission of chikv in the temperate climates by the a. albopictus species .\nthere are several aedes species which are competent in the transmission of the chikv , with a.aegypti and emerging populations of a.albopictus identified as responsible vectors in asia .\nthe asian strain identified in thailand in 1958 was transmitted by the suspected vector , a. aegypti .\nthis asian strain was also reported in outbreaks in india ( 19621965 ) and southeast asia ( 19581960 and 19621964 ) , also in association with the a. aegypti mosquito .\nepidemics of the 1980s and 1990s in southeast asian countries ( philippines , thailand , myanmar , and indonesia ) were associated with the asian endemic / epidemic chikv lineage . since then\n, the asian endemic / epidemic chikv lineage has continued to circulate sporadically , transmitted primarily among humans by a.aegypti and was again documented in the 2006 outbreak in malaysia [ 1 , 7 ] .\nemergence of an iol strain with resulting replacement of the endemic asian strain occurred during the southeast asia epidemics of 20062009 [ 1 , 7 ] .\nit is thought that the e1 envelope glycoprotein mutation of the endemic asian genotype resulted in the decreased adaptability of the chikv to a.albopictus , with decreased transmission , and the facilitation of chikv evolution and strain replacement .\nthe caribbean region continues to encounter challenges with the control of mosquito populations including a.aegypti and other aedes species .\nthe aedes mosquito was introduced to the caribbean through the african slave trade . following its introduction ,\na significant increase in the a. aegypti population density was associated with the intercontinental exchange activities of the second world war .\npublic health interventions of national health ministries and the pan american health organization in the 1950s and 1960s successfully reduced a.aegypti vector indexes by 1972 .\nthis success , however , was short lived and the re - infestations of the latin american and caribbean regions by a.aegypti in the late 1970s was accompanied by the introduction of a.albopictus in the early 1980s to some caribbean countries . although both a.aegypti and a.albopictus may be found in the caribbean , a.aegypti remains the principal vector responsible for the transmission of chikv and dengue in this region . to date\n, the chikv lineage identified in the 2014 caribbean outbreak belongs to the old asian lineage .\nthe presence of the asian lineage chikv , compounded by a nave caribbean population and high prevalence of a.aegypti , makes the probability of establishment of endemicity of chikungunya in the caribbean high .\nthis risk of establishment of endemicity extends to most tropical and subtropical regions of latin america areas and the southern usa , which is presently experiencing challenges with a.aegypti re - infestation . in the months preceding the caribbean s first case , china and the philippines accounted for 27.5% of travelers into the caribbean .\nthere were ten cases reported in spain from travelers from haiti and dominica republic during april to june 2014 .\nthe expansion of the chikv to north and south america from the caribbean is of great concern .\nin their review of air travel from the caribbean , noted that the final destination of 52.1% of international travelers from the chikungunya - infected caribbean territories was the usa .\nthe most likely cities to be travelled to from the caribbean were new york ( 13.8% ) , paris ( 11.7% ) , miami ( 7.8% ) and san juan , puerto rico ( 3.9% ) .\nit is expected that the change of climatic conditions , compounded by the increase of the warmer weather in temperate zones , will facilitate the further spread of this disease .\nthe months june through to november are designated as the  hurricane season  in the caribbean , or  the wet season  . the wet season has been shown to be associated with the increased breeding of the a.aegypti mosquitos .\nflorida reported its first two cases of autochthonous chikv transmission in july 2014 and , as of september 9 , 2014 , remains the only us state with autochthonous transmission .\nflorida now has eight cases of local transmission and 184 travel - associated laboratory - confirmed chikungunya cases as reported to arbornet .\nthe impact of the introduction of chikv into the caribbean region , a known tourist destination exchange of an estimated 20 million persons annually of which 9 million are us residents , remains to be seen .\nthe acquisition of chikv by travelers to the caribbean enhances the spread to neighboring caribbean countries and globally . as of epidemiological week 35 , among the caribbean countries affected , those with the highest incidence rates ( incidence/100,000 population ) include : guadeloupe ( 16,465 ) , martinique ( 15,087 ) , saint martin ( french part 13,401 ) , saint barthelemy ( 11,707 ) , dominica ( 5,068 ) , dominican republic ( 4,128 ) , and haiti ( 627 ) ( fig .  1 ) .\nthe emergence of chikungunya in the caribbean unfolds a story of the dynamic evolution and interaction of microbes and risk factors underlying the determinants of health .\nthe interaction of economic trade and its role in the transmission of vectors and infectious agents needs to be reviewed and policies reinforced and implemented .\n. continued education to increase the awareness of this disease is needed to curtail the population growth of mosquitoes and to mitigate the spread of chikungunya by travelers to the usa and other regions . improved awareness of the epidemiology and clinical manifestations\npreventative measures and epidemiological monitoring of the evolving chikv epidemic in the caribbean must be improved and sustained .\nthis article does not contain any new studies with human or animal subjects performed by any of the authors . \n\nlizette mowatt and sandra t. jackson have no conflict of interest to declare with respect to this article .\nthis article does not contain any new studies with human or animal subjects performed by any of the authors .\nthis article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use , distribution , and reproduction in any medium , provided the original author(s ) and the source are credited .", "human": " chikungunya is a mosquito - borne virus that has shown increased prevalence in the caribbean since october 2013 . \n there have been several outbreaks throughout asian and african countries over the past few decades with global travel and tourism having a major impact on the further spread of this disease . improved policies and practices for preventative measures and epidemiological surveillance must be implemented to prevent the continued transmission of chikungunya.electronic supplementary materialthe online version of this article ( doi:10.1007/s40121 - 014 - 0043 - 9 ) contains supplementary material , which is available to authorized users . ", "section_names": "Electronic supplementary material\nIntroduction\nThe Geographic Spread of Chikungunya Genotypes\nThe Caribbean\nElectronic supplementary material\nConflict of interest\nCompliance with ethics guidelines\nOpen Access", "bigbird_pegasus": "<s> chikungunya, a member of the togaviridae family, has emerged as a major public health concern, resulting in outbreaks of fever and debilitating arthralgia in the caribbean and globally.<n> the effective management of the rapid spread of chikungunya is integrally related to the geographic distribution and re - emergence of competent mosquito vectors, evolving chikungunya virus genotypes, susceptible human populations, environmental influences, and social mobilization. understanding the contribution of these factors is important to improving the control of the global transmission of this disease.<n> three genotypes, west african, east central south african, and indian ocean lineage, represent the evolution of the virus in keeping with the geographic distribution over the years. understanding the contribution of these factors is important to improving the control of the global transmission of this disease.electronic supplementary materialthe online version of this article ( doi:10.1007/s40121 - 014 - 0043 - 9 ) contains supplementary material, which is available to authorized users.</s>", "longt5": "<pad> chikungunya virus ( chikv ) infection has emerged as a major public health concern, resulting in outbreaks of fever and debilitating arthralgia in the caribbean and globally. the first autochthonous transmission of chikv in the caribbean was confirmed in december 2013 on the french island of saint martin. rapid spread and local transmission of chikv occurred in the caribbean and the americas within 9 months. this has resulted in 651,344 suspected and 9,182 laboratory - confirmed chikungunya cases in the caribbean and the americas within 9 months. the effective management of the rapid spread of chikv is integrally related to the geographic distribution and re - emergence of competent mosquito vectors, evolving chikv genotypes, susceptible human populations, environmental influences, and social mobilization. understanding the contribution of these factors is important to improving the control of the global transmission of this disease.</s>"}
{"article": "nonalcoholic fatty liver disease ( nafld ) is one of the most common chronic liver diseases in the worldwide and it is associated with chronic diseases such as diabetes and heart disease .\nnafld is associated with insulin resistance and is defined as fat accumulation in liver , exceeding 5% of liver weight , in the absence of ethanol intake > 10 g / day .\nthe first one is about the development of insulin resistance that explains the effect of insulin resistance in nafld .\nthe second theory is increased inflammation which can lead to nafld . in a study conducted in japan\n, a significant relationship was observed between the level of serum c - reactive protein ( crp ) and risk of nafld .\nhowever , in another study , no significant correlation was seen between serum crp and nafld .\nvitamin d is a fat - soluble vitamin that exists in a number of food products such as oils and dairy products .\nvitamin d is traditionally known as a regulator of calcium and phosphorus metabolism , but in recent years a significant relationship has been observed between serum levels of vitamin d and risk of chronic diseases such as diabetes and cardiovascular diseases .\nvitamin d receptors are present in more than 38 tissues and its receptors affect genes controlling oxidative stress and inflammation .\nthere are several lines of evidence demonstrate an association between vitamin d and liver disease .\nhowever , in several studies , there were no association between vitamin d concentration and severity of fatty liver .\nthe effect of vitamin d on its receptor in these cells regulates and balances the inflammation and oxidative stress .\nmoreover , several studies have confirmed the relationship between serum vitamin d levels and inflammation . due to the role of inflammation in nafld ,\nhence , the purpose of this study was to investigate the effect of vitamin d supplementation on inflammation in patients with nafld .\na randomized double - blind placebo - controlled clinical trial was conducted on 60 patients ( 30 - 70 years ) with nafld .\nsamples were calculated with a confidence interval of 95% and 80% power of the test by below formula ( s = 1.7 , d = 0.7 ) .\nthis study was conducted in metabolic liver disease research center in isfahan university of medical sciences , isfahan , iran .\nthe study was performed with the approval of isfahan university of medical sciences local ethics committee .\nexclusion criteria in our study were defined as acute illnesses , chronic kidney disease , hyperparathyroidism , hypoparathyroidism , chronic heart failure , hepatitis c or hepatitis b , wilson syndrome , history of chronic liver diseases , or disorders that affect gallbladder and bile ducts , pregnancy or history of taking any drugs affecting levels of alt including ( valproic acid , tamoxifen , 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors , metformin , angiotensin - converting enzyme 1 and angiotensin - converting enzyme - related 1 ) .\nsubjects should not intake oral vitamin d / calcium / multivitamin supplementation in the previous study .\nparticipants were divided into two groups using permuted block randomization : ( a ) 30 patients in vitamin d group ( capsules containing 50,000 iu vitamin d ) , ( b ) 30 patient in the placebo group .\nintervention period followed for 10 weeks and patients received vitamin supplements or placebo capsules every week . to evaluate the acceptability of vitamin d supplementation , serum 25-hydroxy vitamin d level was measured at the beginning and end of the study .\ndietary records were collected every 2 weeks , and intakes were determined based on estimated values in household measurements . to obtain nutrient intakes of participants on the basis of these 5-d food diaries , nutritionist iv software ( version 7.0 ; n - squared computing , salam , or , usa ) , which was modified for iranian food items were used .\nphysical activity levels estimated as metabolic equivalent of task hours per week ( met - hr / wk ) .\nmet - hr / wk for each exercise program calculated ( days per week  hours of exercise each time  met equivalent of exercise ) and summed of all met - min / wk values for each patient evaluated .\nheight and body weight were measured while the subjects were in a standing position at baseline and 10 week .\n25-hydroxy vitamin d was assessed by using a commercial elisa kit ( immuno diagnostic systems ) . at the beginning and the end of the study .\nast and alt serum levels were measured through enzymatic photometric method ( ifcc ) with a sensitivity of 2 u / l and a coefficient of variation of 14% ( alt , ast , and alkaline phosphatase ( alp ) were measured by commercially available enzymatic reagents ( pars azmoon ) on a bt-3000 ( biotechinica ) autoanalyzer .\ncrp serum was measured by high - sensitivity enzyme ( test pars tehran , tehran , iran ) .\nlevel of liver esteatosis was assessed by using ultrasonography with esaote medical ultrasound machine ( convex 3.5 mhz ) at the beginning and the end of the study .\nus performed by the same expert radiologist with the same instrument in the begging and the end study .\nhepatic ultrasonography was conducted by someone who is unaware of the objectives of the study .\npatients for ultrasound should be fasting for 8 h. ultrasonography is performed in the supine position .\nechogenicity the liver , the presence or absence of bulky tumors cystic or solid and calcification was assessed .\nindependent - samples student 's t - test was used to detect differences in general characteristics and dietary intakes between two groups . in this analysis\nchi - square test for comparison the grades of fatty liver between two groups of placebo and intervention used and paired t - test used to assess the within group comparison of quantitative variables .\nall statistical analyses conducted using statistical package for the social sciences ( spss ) , version 16 ( spss inc . , chicago , usa ) .\na randomized double - blind placebo - controlled clinical trial was conducted on 60 patients ( 30 - 70 years ) with nafld .\nsamples were calculated with a confidence interval of 95% and 80% power of the test by below formula ( s = 1.7 , d = 0.7 ) .\nthis study was conducted in metabolic liver disease research center in isfahan university of medical sciences , isfahan , iran .\nthe study was performed with the approval of isfahan university of medical sciences local ethics committee .\nexclusion criteria in our study were defined as acute illnesses , chronic kidney disease , hyperparathyroidism , hypoparathyroidism , chronic heart failure , hepatitis c or hepatitis b , wilson syndrome , history of chronic liver diseases , or disorders that affect gallbladder and bile ducts , pregnancy or history of taking any drugs affecting levels of alt including ( valproic acid , tamoxifen , 3-hydroxy-3-methylglutaryl - coenzyme a reductase inhibitors , metformin , angiotensin - converting enzyme 1 and angiotensin - converting enzyme - related 1 ) .\nsubjects should not intake oral vitamin d / calcium / multivitamin supplementation in the previous study .\nparticipants were divided into two groups using permuted block randomization : ( a ) 30 patients in vitamin d group ( capsules containing 50,000 iu vitamin d ) , ( b ) 30 patient in the placebo group .\nintervention period followed for 10 weeks and patients received vitamin supplements or placebo capsules every week . to evaluate the acceptability of vitamin d supplementation , serum 25-hydroxy vitamin d level was measured at the beginning and end of the study .\ndietary records were collected every 2 weeks , and intakes were determined based on estimated values in household measurements . to obtain nutrient intakes of participants on the basis of these 5-d food diaries , nutritionist iv software ( version 7.0 ; n - squared computing , salam , or , usa ) , which was modified for iranian food items were used .\nphysical activity levels estimated as metabolic equivalent of task hours per week ( met - hr / wk ) .\nmet - hr / wk for each exercise program calculated ( days per week  hours of exercise each time  met equivalent of exercise ) and summed of all met - min / wk values for each patient evaluated .\nheight and body weight were measured while the subjects were in a standing position at baseline and 10 week .\n25-hydroxy vitamin d was assessed by using a commercial elisa kit ( immuno diagnostic systems ) . at the beginning and the end of the study .\nast and alt serum levels were measured through enzymatic photometric method ( ifcc ) with a sensitivity of 2 u / l and a coefficient of variation of 14% ( alt , ast , and alkaline phosphatase ( alp ) were measured by commercially available enzymatic reagents ( pars azmoon ) on a bt-3000 ( biotechinica ) autoanalyzer .\ncrp serum was measured by high - sensitivity enzyme ( test pars tehran , tehran , iran ) .\nlevel of liver esteatosis was assessed by using ultrasonography with esaote medical ultrasound machine ( convex 3.5 mhz ) at the beginning and the end of the study .\nus performed by the same expert radiologist with the same instrument in the begging and the end study .\nhepatic ultrasonography was conducted by someone who is unaware of the objectives of the study .\npatients for ultrasound should be fasting for 8 h. ultrasonography is performed in the supine position .\nechogenicity the liver , the presence or absence of bulky tumors cystic or solid and calcification was assessed .\nnormality of studied variables was evaluated using kolmogorov  smirnovtest or probability - probability plot . for nonnormal variables ,\nindependent - samples student 's t - test was used to detect differences in general characteristics and dietary intakes between two groups . in this analysis\nchi - square test for comparison the grades of fatty liver between two groups of placebo and intervention used and paired t - test used to assess the within group comparison of quantitative variables .\nall statistical analyses conducted using statistical package for the social sciences ( spss ) , version 16 ( spss inc . , chicago , usa ) .\nthe study flow chart shows the screening , randomization and follow - up of the participants [ figure 1 ] . in this study , 29 men and 31 women participated .\ndata shows that 23.6% and 10.9% of our subjects have abnormal alt and ast levels at baseline , respectively .\ncompliance with the treatments was good in both groups and no side - effects were presented . on the basis of 5-d dietary intake and physical activity records , no significant differences were seen between the two groups [ table 3 ] . the comparison of subclinical characteristics at baseline and after intervention of study adjusted changes in metabolic variables in nafld who received either vitamin d supplements or placebo fatty liver grades in nafld who received either vitamin d supplements or placebo dietary intakes and physical activity of nafld who received either vitamin d supplements or placebo throughout the study vitamin d supplementation resulted in an increase of serum 25(oh ) d concentrations in inter group ( p < 0.05 ) and intra - group ( p < 0.05 ) . at the end of study , in the intervention group , tg and crp reduced significantly compare with baseline ( p < 0.05 ) .\na significant increase was seen in calcium serum in the intervention group in comparison with baseline ( p < 0.05 ) and compared with the placebo group ( p < 0.05 ) . after adjusting for baseline values , levels of alt ,\nast , tg and crp were reduced in the intervention group in comparison with the placebo group , but these changes were not significant between two groups after intervention .\nthis study was the first one that investigated the effect of vitamin d supplementation on inflammation in patients with nafld . in this study ,\nvitamin d supplementation did not reduce inflammation in patients with nafld in the intervention group compared with the control group .\nin addition , vitamin d supplementation did not significant effect on serum tg levels and liver enzymes .\nseveral studies have shown significant relationship between low serum vitamin d and increase inflammatory markers . in a study conducted by grossmann et al .\n, 12 weeks of vitamin d supplementation caused a significant decrease in the levels of inflammatory factors in patients with cystic fibrosis . in another study\non 328 african - american patients , vitamin d supplementation significantly decreased systemic inflammation in these patients . in another study ,\nthe effect of vitamin d supplementation was investigated on inflammatory markers in patients with type 2 diabetes . in this study ,\nvitamin d supplementation significantly decreases systemic inflammation and crp concentration in patients with type 2 diabetes .\nhowever , in several studies , vitamin d supplementation had no effect on systemic inflammation and crp .\nvitamin d affects through receptors on these organs and regulates pro - inflammatory and systemic inflammation in the body .\nin addition , vitamin d with binding to its receptors in monocytes can reduce pro - inflammatory cytokines .\nthe first one was use of ultrasound method for diagnosis of fatty liver disease , while for accurate diagnosis of fatty liver , liver biopsy should be used .\nthe second limitation was a small sample size of participants , especially in grades one and three .\nvitamin d supplementation had no effect on crp and other variables in the intervention group compared with the placebo group .\nfurther studies with strong design and more sample must conduct to demonstrate the effect of vitamin d supplementation on inflammation in patients with nafld .", "human": " background : nonalcoholic fatty liver disease ( nafld ) is the most common chronic liver disease in the worldwide . \n it is associated with chronic disorders such as diabetes and heart diseases . \n inflammation is one of the basic causes of metabolic diseases . \n several studies have shown that vitamin d can reduce inflammation . \n the purpose of this study was to investigate the effect of vitamin d supplementation on inflammation in patients with nafld.methods:this study involved 60 nafld patients , divided equally into two intervention and placebo groups . during 10 weeks \n , patients in the intervention group receive vitamin d ( capsules containing 50,000 iu vitamin d ) , weekly . \n vitamin d levels , c - reactive protein ( crp ) , triglyceride ( tg ) , aspartate aminotransferase ( ast ) and alanine aminotransferase ( alt ) levels were measured at the beginning and end of the study . \n data were analyzed using analysis of covariance tests . \n analyses were done using spss software ( version 16 ) ( spss inc . , \n chicago , usa ) . \n p < 0.05 set as significant level.results:vitamin d supplementation resulted in an increase of serum 25(oh ) d concentrations in inter group ( p < 0.05 ) and intra - group ( p < 0.05 ) in intervention group . at the end of the study , in the intervention group , \n tg and crp reduced significantly compare with baseline ( p < 0.05 ) . \n a significant increase was seen in calcium serum in the intervention group in comparison with baseline ( p < 0.05 ) and compared with the placebo group ( p < 0.05).conclusions : vitamin d supplementation had no effect on crp and other variables in the intervention group compared with the placebo group . \n further studies with strong design and more sample must conduct to demonstrate the effect of vitamin d supplementation on inflammation in patients with nafld . ", "section_names": "INTRODUCTION\nMETHODS\nParticipants characteristics\nAnthropometric measurements\nBiochemical measurements\nDegree of fat accumulation in liver\nStatistical analysis\nRESULTS\nDISCUSSION", "bigbird_pegasus": "<s> background : nonalcoholic fatty liver disease ( nafld ) is one of the most common chronic liver diseases in the worldwide and it is associated with chronic diseases such as diabetes and heart disease. there are several lines of evidence demonstrate an association between vitamin d concentration and severity of fatty liver.<n> the effect of vitamin d on its receptor in these cells regulates and balances the inflammation and oxidative stress. hence, the purpose of this study was to investigate the effect of vitamin d supplementation on inflammation in patients with nafld.materials and methods : a randomized double - blind placebo - controlled clinical trial was conducted on 60 patients ( 30 - 70 years ) with nafld.<n> a physical activity score was evaluated before and after 10 weeks of intervention.<n> serum 25-hydroxy vitamin d, c - reactive protein, tumor necrosis factor-, interleukins ( il ) 6, 8, and 10, and serum alkaline phosphatase were measured at baseline and after 10 weeks of intervention.<n> statistical analysis was performed using the statistical package for the social sciences ( spss ) version 16 ( spss inc., chicago, il, usa ).<n> p <unk> 0.05 was considered as significant.results:the mean physical activity score significantly increased after 10 weeks of intervention ( p <unk> 0.05 ).<n> there was a significant increase in serum 25-hydroxy vitamin d and c - reactive protein and c - reactive protein, il, il, il, il, il, il, il, il, il, il, and il, and il..<n>..<n>.<n>.....<n>..<n>.<n>.<n>.<n>.<n>.<n> serum 25-hydroxy vitamin levels of serum 25-hydroxy vitamin levels of serum 25-hydroxy vitamin levels.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n> serum levels of serum levels of serum levels of serum levels of serum levels..<n>.<n>.<n>.<n>..<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>", "longt5": "<pad> background : nonalcoholic fatty liver disease ( nafld ) is one of the most common chronic liver diseases in the worldwide and it is associated with chronic diseases such as diabetes and heart disease. vitamin d is traditionally known as a regulator of calcium and phosphorus metabolism, but in recent years a significant relationship has been observed between serum levels of vitamin d and risk of chronic diseases such as diabetes and cardiovascular diseases. therefore, the purpose of this study was to investigate the effect of vitamin d supplementation on inflammation in patients with nafld.materials and methods : a randomized double - blind placebo - controlled clinical trial was conducted on 60 patients ( 30 - 70 years ) with nafld. participants were divided into two groups using permuted block randomization : ( a ) 30 patients in vitamin d group ( capsules containing 50,000 iu vitamin d ), ( b ) 30 patient in the placebo group. intervention period followed for 10 weeks and patients received vitamin supplements or placebo capsules every week. serum 25-hydroxy vitamin d level was measured at the beginning and the end of the study. serum c - reactive protein ( crp ) was measured by high - sensitivity enzyme ( test pars tehran, tehran, iran).results : vitamin d supplementation resulted in an increase of serum 25(oh ) d concentrations in inter group ( p <unk> 0.05 ) and intra - group ( p <unk> 0.05 ). at the end of study, in the intervention group, tg and crp reduced significantly compare with baseline ( p <unk> 0.05 ). a significant increase was seen in calcium serum in the intervention group in comparison with baseline ( p <unk> 0.05 ) and compared with the placebo group ( p <unk> 0.05).conclusions : vitamin d supplementation had no effect on crp and other variables in the intervention group compared with the placebo group. further studies with strong design and more sample must conduct to demonstrate the effect of vitamin d supplementation on inflammation in patients with nafld.</s>"}
{"article": "peroneal nerve entrapment is the most frequent nerve entrapment in the lower extremities and the third most common entrapment in the body , following the median and ulnar nerves .\nperoneal neuropathies often develop after trauma , direct injury or upon entrapment during the course of the nerve proximal or distal to the fibular head .\nmechanical entrapment by an osteochondroma in this anatomic region is a rare occurrence . in this study ,\nfive patients with a drop foot resulting from osteochondroma of the proximal fibula who did not receive a proper diagnosis in neurosurgery and physical therapy clinics are presented .\na 2.5-year - old boy presented to the neurosurgery clinic with the complaint of limping that started shortly after beginning to walk .\nhis neurologic background history and examination included cranial and comprehensive spinal mri for embolisms and congenital anomalies .\nall test results were negative for etiologic factors and the patient was referred to a physical therapy and rehabilitation clinic for six months . during the physical examination , simple gait analysis revealed missing dorsiflexion of the right foot . according to the medical research council ( mrc ) scale ,\nfurther radiologic evaluation by plain x - rays , computerized tomography ( ct ) and magnetic resonance imaging ( mri ) displayed a posterolateral exostosis on the fibular neck ( fig .\n1 ) . surgery was performed , and an osteochondroma , including its cartilage cap , was removed .\npathologic examination revealed an osteochondroma with a thin , 2-mm cartilage cap . in the early post - operative period ,\nelectrostimulation and active and passive range of motion ( rom ) exercises were initiated . within three months following surgery , full recovery of motor functions was observed .\none year after surgery , electromyogram results indicated normal excitations , and recurrence of the tumor was not noted ( table 1 ) . a 15-year - old boy presented to the physical therapy and rehabilitation center ( ptrc ) complaining of inability to dorsiflex his left toe for five months .\nno improvement was detected with vigorous ptrc ; therefore , the patient was referred to a neurosurgery clinic , where spinal mri studies were conducted .\nno improvement of the condition was observed , and the patient was referred to our department .\nthe patient was examined , and dorsiflexion of the ankle and toe was determined as mrc grade 1 without any sensory deficit .\nradiologic assessment detected compression of the peroneal nerve due to an osteochondroma of the proximal fibula and fatty degeneration of the proximal musculotendiosis area of extensor hallucis longus .\nhourglass constriction of the peroneal truncus at the level of the fibular neck by an osteochondroma was observed .\npathologic specimens depicted an osteochondroma . within the first 24  h following the surgery ,\nelectrical stimulation , accompanying active and passive range of motion exercises , was started . at the end of the post - operative first month , 5/5 muscle strength was achieved .\nan 11-year - old girl presented to the neurosurgery clinic complaining of gradual weakness of foot dorsiflexion , which was first noted 4 months prior to admission .\nshe was evaluated for possible intervertebral disk pathology , but the radiologic studies were normal .\nshe was referred to a physical therapy and rehabilitation clinic . by the time she consulted with our department ,\nher ankle and toe extensors were assessed as mrc grade 2 without any sensory deficit .\nradiologic examination showed osteochondroma that was accompanied by a bursitis at the level of the proximal fibula , causing peroneal nerve entrapment .\npathologic evaluation showed osteochondroma . by the third week following surgery , gradual increase of the muscle strength was noted .\na 14-year - old boy presented to the neurosurgery clinic with weakness of foot dorsiflexion that was first noticed five months prior . upon spinal examination for rehabilitation purposes ,\nthe ankle and toe extensor was evaluated as mrc grade 2 without sensory deficit . during the electromyogram\nradiologic examination showed osteochondroma accompanied by a bursitis at the level of proximal fibula , causing peroneal nerve entrapment .\na 10-year - old girl presented to the physical therapy and rehabilitation center and neurosurgery clinic with spinal pathologies that started three months prior due to her complaint of right drop foot .\nthe patient was examined and dorsiflexion of the ankle and toe was determined as mrc grade 1 without any sensory deficit .\nradiologic examination showed osteochondroma accompanied by a bursitis at the level of the proximal fibula , causing peroneal nerve entrapment .\npathologic examination results indicated osteochondroma . a week after the surgery , the muscle began to gain strength .\na 2.5-year - old boy presented to the neurosurgery clinic with the complaint of limping that started shortly after beginning to walk .\nhis neurologic background history and examination included cranial and comprehensive spinal mri for embolisms and congenital anomalies .\nall test results were negative for etiologic factors and the patient was referred to a physical therapy and rehabilitation clinic for six months . during the physical examination , simple gait analysis revealed missing dorsiflexion of the right foot . according to the medical research council ( mrc ) scale ,\nfurther radiologic evaluation by plain x - rays , computerized tomography ( ct ) and magnetic resonance imaging ( mri ) displayed a posterolateral exostosis on the fibular neck ( fig .\n1 ) . surgery was performed , and an osteochondroma , including its cartilage cap , was removed .\npathologic examination revealed an osteochondroma with a thin , 2-mm cartilage cap . in the early post - operative period ,\nelectrostimulation and active and passive range of motion ( rom ) exercises were initiated . within three months following surgery , full recovery of motor functions was observed .\none year after surgery , electromyogram results indicated normal excitations , and recurrence of the tumor was not noted ( table 1 ) .\na 15-year - old boy presented to the physical therapy and rehabilitation center ( ptrc ) complaining of inability to dorsiflex his left toe for five months .\nno improvement was detected with vigorous ptrc ; therefore , the patient was referred to a neurosurgery clinic , where spinal mri studies were conducted .\nno improvement of the condition was observed , and the patient was referred to our department .\nthe patient was examined , and dorsiflexion of the ankle and toe was determined as mrc grade 1 without any sensory deficit .\nradiologic assessment detected compression of the peroneal nerve due to an osteochondroma of the proximal fibula and fatty degeneration of the proximal musculotendiosis area of extensor hallucis longus .\nhourglass constriction of the peroneal truncus at the level of the fibular neck by an osteochondroma was observed .\npathologic specimens depicted an osteochondroma . within the first 24  h following the surgery ,\nelectrical stimulation , accompanying active and passive range of motion exercises , was started . at the end of the post - operative first month , 5/5 muscle strength was achieved .\nan 11-year - old girl presented to the neurosurgery clinic complaining of gradual weakness of foot dorsiflexion , which was first noted 4 months prior to admission .\nshe was evaluated for possible intervertebral disk pathology , but the radiologic studies were normal .\nshe was referred to a physical therapy and rehabilitation clinic . by the time she consulted with our department ,\nher ankle and toe extensors were assessed as mrc grade 2 without any sensory deficit .\nradiologic examination showed osteochondroma that was accompanied by a bursitis at the level of the proximal fibula , causing peroneal nerve entrapment .\npathologic evaluation showed osteochondroma . by the third week following surgery , gradual increase of the muscle strength was noted .\na 14-year - old boy presented to the neurosurgery clinic with weakness of foot dorsiflexion that was first noticed five months prior . upon spinal examination for rehabilitation purposes , the patient was referred to the physical therapy and rehabilitation clinic . upon admission ,\nthe ankle and toe extensor was evaluated as mrc grade 2 without sensory deficit . during the electromyogram\nradiologic examination showed osteochondroma accompanied by a bursitis at the level of proximal fibula , causing peroneal nerve entrapment .\na 10-year - old girl presented to the physical therapy and rehabilitation center and neurosurgery clinic with spinal pathologies that started three months prior due to her complaint of right drop foot .\nthe patient was examined and dorsiflexion of the ankle and toe was determined as mrc grade 1 without any sensory deficit .\nradiologic examination showed osteochondroma accompanied by a bursitis at the level of the proximal fibula , causing peroneal nerve entrapment .\npathologic examination results indicated osteochondroma . a week after the surgery , the muscle began to gain strength .\nthe increasing number of fascicles in this area , expansion of epineural tissue , and nerve 's unprotected surface transition play an important role in this pathology .\nthe peroneal nerve is connected to the fibular head and is subjected to the movements of the fibula . spur or tumoral structure formation of the tubular bones can potentially apply pressure to the surrounding structures .\nflores and koerbel reported a case of peroneal nerve compression resulting from fibular head exostosis .\nonly a few cases of compressions of the peroneal nerve by cartilaginous exostosis have been reported thus far . however , due to their rare occurrence , lesions such as osteochondromas may be overlooked by non - orthopedic clinics .\nosteochondroma is the most common benign bone tumor and can cause a variety of symptoms .\ndepending on the location of the lesion pain , a palpable mass , puffiness  ( inflammation ) , and tinel 's sign might be significant clinical symptoms and findings . furthermore , when an exositosis accompanying stiffness is diagnosed , hereditary multiple exositosis syndrome must be considered .\nmotor deficits are more common than sensory nerve lesions , which might be explained by the arrangement of the fascicles inside the common peroneal nerve .\nthe exostosis grows from the bone surface to the periphery , compressing the motor fibers earlier .\nthis is most likely due to medial placement of the motor branches within the nerve so that they are more prone to injury by a newly forming osteochondroma .\nadvanced knowledge of the peroneal nerve anatomy as well as the mri and ct scan assessments of the lesion are key factors for preventing complications .\na surgery for an osteochondroma causing peroneal nerve entrapment should be performed within three months ; otherwise , the surgical success rate decreases .\nalthough the mean time that passed until the patients consulted with us was 5.7 months ( range : 312 months ) , the loss of muscle strength in our cases fully recovered following surgery .\nthe mean age of our patients was low , which could have played a role in the fast and complete neurological recovery ( mean age 10.5 ( 2.515 years ) ) .\nin spite of its frequent occurrence , drop foot associated with peroneal nerve entrapment by an osteochondroma is not easily remembered and diagnosed . especially in pediatric patients , drop foot can be overlooked during physical examination and may even be more difficult to detect in non - orthopedic clinics . with careful physical examination along with radiologic and electrophysiologic studies ,\nnerve entrapment can be easily diagnosed , enabling surgeons to perform surgery in a timely manner , thus preventing further sequelae .\nwritten informed consent was obtained from each patient for the publication of this case report and accompanying images .\na copy of the written consent is available for review by the editor - in - chief of this journal .\nall authors have been equally involved in the collection of data and drafting of the manuscript .", "human": " introductionthe fibular nerve is the most frequent site of neural entrapment in the lower extremity and the third most common site in the body , following the median and ulnar nerves . the peroneal nerve is commonly injured upon trauma . \n additionally , a dropped foot might be a symptom related to the central nervous system or spinal pathologies in pediatric patients . \n entrapment of the peripheral nerve as an etiologic cause should be kept in mind and further analyzed in orthopedic surgery clinics.presentation of casein this study , the evaluation and treatment results of five patients with no history of trauma , who underwent diagnostic procedures and treatment in various clinics ( physical therapy and rehabilitation and neurosurgery ) , are reported . \n the patients underwent several treatments without diagnosis of the primary etiology . upon initial consultation at our department , osteochondroma at the proximal fibula was detected after physical examination and radiologic assessment . during surgery , \n the peroneal nerve was dissected , starting from a level above the knee joint . following nerve release , \n the osteochondroma was removed , including its cartilage cap . \n consequently , recovery was observed in all five cases after surgery.discussionmany factors may cause non - traumatic neuropathies . \n however , due to their rare occurrence , lesions such as osteochondromas may be overlooked at non - orthopedic clinics . \n nerve entrapment due to proximal fibular osteochondroma is rare . \n surgical treatment planning plays a critical role in nerve entrapment cases.conclusiondespite its frequent occurrence , a drop foot associated with peroneal nerve entrapment by an osteochondroma is not easily remembered and diagnosed . especially in pediatric cases , inadequate clinical consultation and a lack of appropriate radiologic studies may result in a delay in diagnosing peroneal nerve lesions . ", "section_names": "Introduction\nPresentation of cases\nCase 1\nCase 2\nCase 3\nCase 4\nCase 5\nDiscussion\nConclusion\nConflict of interest\nFunding\nEthical approval\nAuthor contribution", "bigbird_pegasus": "<s> introduction : entrapment of the peroneal nerve by an osteochondroma of the proximal fibula is a very rare condition. in this study, five patients with a drop foot resulting from osteochondroma of the proximal fibula who did not receive a proper diagnosis in neurosurgery and physical therapy clinics are presented.case report : five patients with a drop foot resulting from osteochondroma of the proximal fibula who did not receive a proper diagnosis in neurosurgery and physical therapy clinics are presented.conclusion:mechanical entrapment by an osteochondroma in this anatomic region is a rare occurrence.<n> early diagnosis and surgical treatment are essential for a complete and full recovery.</s>", "longt5": "<pad> highlightsperoneal nerve entrapment is the most frequent nerve entrapment in the lower extremities and the second most common entrapment in the body, following the median and ulnar nerves. mechanical entrapment by an osteochondroma in this anatomic region is a rare occurrence. careful physical examination along with radiologic and electrophysiologic studies, nerve entrapment can be easily diagnosed, enabling surgeons to perform surgery in a timely manner, thus preventing further sequelae. careful physical examination along with radiologic and electrophysiologic studies, nerve entrapment can be easily diagnosed, enabling surgeons to perform surgery in a timely manner, thus preventing further sequelae. careful physical examination along with radiologic and electrophysiologic studies, nerve entrapment can be easily diagnosed, enabling surgeons to perform surgery in a timely manner, thus preventing further sequelae. careful physical examination along with radiologic and electrophysiologic studies, nerve entrapment can be easily diagnosed, enabling surgeons to perform surgery in a timely manner, thus preventing further sequelae.</s>"}
{"article": "in patients receiving radiotherapy and chemotherapy for esophageal and lung cancers , it is not uncommon to witness development of life - threatening tracheo - esophageal fistula ( tof ) .\nvarious procedures have been tried including surgical repair , endoprostheses , endo - bronchial gluing and tracheal stents .\nother workers have shown good long - term results of palliative treatment with covered expandable metallic stents .\nwe report a case of ca esophagus who after chemotherapy and radiotherapy developed to fistula ; esophageal stenting was done but patient was still having cough and dyspnoea .\nfibreoptic bronchoscopy ( fob ) showed a large rent in the posterior wall of the trachea with marked narrowing of the tracheal lumen because of protrusion of the esophageal stent .\nhe was successfully managed with the insertion of an ultraflex - covered tracheal stent and achieved relief from cough and dyspnoea .\na male patient , ks , aged 60 years , suffering from esophageal cancer was electively operated upon in october 2007 after discussion in the multispecialty tumor board .\nthe gross specimen was an ulcero - proliferative growth measuring 4.5  1.7 cm in size located 2.3 cm from the gastro - esophageal ( ge ) junction and was reported to be moderately differentiated squamous - cell carcinoma .\ncomputed tomography ( ct ) chest and abdomen showed esophageal gastric anastomosis in the lower neck with irregular mass abutting the posterior and left wall of the trachea and encasing the left carotid artery .\nultra sound ( usg ) and ct - guided fine needle aspiration cytology ( fnac ) from liver nodules showed metastatic deposits of poorly differentiated squamous - cell carcinoma .\nhe received three cycles of tip- ( paclitaxel / ifosfamide / cisplatin ) based chemotherapy and palliative external beam radiotherapy to the l2s1 spine and pelvis with a dose of 30 gy/10 # during june 2010 .\nbone scan in july 2010 showed increased uptake in the sternum , l2 vertebra , bilateral acetabulam and bilateral iliac bones . in the month of august 2010\nugi endoscopy on 19 august 2010 showed an esophageal growth starting at 16 cm from upper esophageal sphincter ( ues ) and extending up to 23 cm with tof .\nhis x  ray chest was clear and the esophageal stent was seen in place .\nbronchoscopy was advised and done as per american association for respiratory care ( aarc ) criteria .\nthere was a huge gap in the posterior wall of the trachea with esophageal stent visible and protruding into the trachea and narrowing the lumen [ figure 1 ] . as the patient was severely symptomatic and\nthe situation could have progressed to complete obstruction of the trachea , tracheal stenting was done on 31 august 2010 .\nguide wire ( zebra ) was passed through the working channel of the bronchoscope and bronchoscope was withdrawn keeping the guide wire in trachea .\na 10-cm covered ultraflex tracheal stent [ figure 2 ] was passed over the guide wire and was deployed in proper position [ figure 3 ] covering the tof .\nthe whole procedure was done under vision by keeping the bronchoscope inserted through the left nares .\nhe was discharged after two days on 2 september 2010 and is doing well four months after the procedure .\ncheck bronchoscopy was performed four months after the tracheal stent placement and there was no migration or any other complication of the stent , except that the tracheal lumen had slightly narrowed down from the posterior side .\ntoday they are indicated for re - establishing patency of compressed or strictured central airways , supporting weakened cartilages or sealing of fistulas .\nstents are divided into four groups : \n polymer stents such as dumon stents , metallic stents such as palmz stents or uncovered wall stents , covered metallic stents such as the covered ultraflex stent , hybrid stents such as dynamic stents . \n \npolymer stents such as dumon stents , metallic stents such as palmz stents or uncovered wall stents , covered metallic stents such as the covered ultraflex stent , hybrid stents such as dynamic stents .\nairway and/or esophageal stent insertion provides an effective approach to improve the quality of life ( qol ) in patients with malignant tof .\nstents can be placed bronchoscopically in the airways and with endoscope in the esophagus to seal the defect and restore the patency of passages with resumption of oral feeds .\nalthough single tracheal or esophageal stents were successful in 91% of cases , 9% needed double stenting of both trachea as well as esophagus .\nour patient was in this category who did not remain symptom - free with esophageal stent alone and needed both esophageal and tracheal stents .\nnowadays , in cases of severe esophageal and tracheal obstructions , the pulmonologists are involved early and recent reports suggest double stenting to be a promising option .\nthere is no doubt that double stenting is the gold standard and should be practiced but the present case was under care of the oncologist and as the predominant symptom was dysphagia he called upon the gastroenterologist who performed endoscopy and on finding tof informed the oncologist .\nthe oncologist explained the huge financial burden of double stenting ( 50,000 to 60,000 inr for each stent ) and deferred the tracheal procedure .\nanyhow , the tracheal stenting was done not too late ( done within 10 days and during the same admission ) . the paper highlights and infers about the importance of this controversy .\nthis leads to frequent aspiration , the most frequent sign of tof being coughing after swallowing ; without prompt palliation , death occurs rapidly , with a mean survival time of between one and six weeks in patients who are treated with supportive care alone .\nherth et al . , have reported a mean survival of 252.9 days with combined airway  esophageal stent .\nour patient was successfully taking food and was not dyspnoeic four months after the stent placement .\nhowever , up to 20% of silicone stents have been reported to migrate , with resultant reocclusion .\nother problems of silicone stents include clinically significant stent obstruction with inspissated secretions due to impairment of mucociliary clearance , impedance of the cough reflex , lack of flexibility in the airway , high mucosal pressure and higher chance of bacterial colonization .\ninitially , to deploy the silicon stent , patients were administered general anesthesia and the procedure was done with rigid bronchoscope under fluoroscopic guidance .\nnowadays , these stringent requirements have been relegated to the past and large tofs are successfully sealed by deployment of self - expandable stents through flexible bronchoscope without the need of fluoroscopy .\nthe primary advantage of the expandable metallic stents is their easy delivery by means of flexible bronchoscope under topical anesthesia and their conformability to the airway anatomy due to their self - expanding characteristics . with the use of self - expandable metallic stents ( sems )\n, there is an increase in the qol in patients with inoperable esophageal and lung tumors .\nwe have used a covered sems which has an advantage over plastic or silicon stent not only in covering large defects , but also in having lower rates of migration along with adequate maintenance of patency of the passages .\nour patient had an increase in dyspnoea after placing the esophageal stent ; a similar phenomenon has been reported by nomori et al .\n, their two patients suffered from respiratory distress after placement of the esophageal stent because of compression of the trachea from the posterior wall .\nthey have further observed that for patients with both esophageal and tracheobronchial stenoses , a stent should be introduced into the tracheobronchus first .\nthe success rate for closure of tof using endoscopic methods varies from 87 100% . on repeat bronchoscopy ,\nour patient was comfortable , his stent was placed at the right position and there were no complications . in the large series by herth et al .\n, none of their patients developed stent migration or required repositioning of the stent and there were no complications of perforation or mediastinitis .\nthe american college of chest physicians guidelines for palliative care in patients with a malignant tof recommend stent insertion in both the tracheobronchial tree and the esophagus for symptomatic relief . to conclude , we report a case of ca esophagus post surgery who underwent chemotherapy and radiotherapy and later developed to fistula .\ninitial placement of an esophageal stent did not give him much of a reprieve and later , tracheal stenting helped him to get complete relief from his disabling symptoms .", "human": " the incidence of tracheo - esophageal ( to ) fistula is on the rise , especially after palliative management for esophageal malignancies . \n we report a case of cancer of esophagus who after chemotherapy and radiotherapy developed to fistula . \n placement of an esophageal stent helped him in taking food orally , but his cough and dyspnoea continued to worsen . \n fibreoptic bronchoscopy demonstrated a severely compressed trachea secondary to protrusion of esophageal stent which responded very well to an ultraflex - covered tracheal stent and the patient achieved relief from cough and dyspnoea . ", "section_names": "INTRODUCTION\nCASE REPORT\nDISCUSSION", "bigbird_pegasus": "<s> a male patient, ks, aged 60 years, suffering from esophageal cancer, received three cycles of tip- ( paclitaxel / ifosfamide / cisplatin ) based chemotherapy and palliative external beam radiotherapy to the l2s1 spine and pelvis with a dose of 30 gy/10 # during june 2010.<n> fibreoptic bronchoscopy ( fob ) showed a large rent in the posterior wall of the trachea with marked narrowing of the tracheal lumen because of protrusion of the esophageal stent. he was successfully managed with the insertion of an ultraflex covered tracheal stent and achieved relief from cough and dyspnoea.</s>", "longt5": "<pad> tracheo - esophageal fistula ( tof ) is a potentially life - threatening condition. various procedures have been tried including surgical repair, endoprostheses, endo - bronchial gluing and tracheal stents. other workers have shown good long - term results of palliative treatment with covered expandable metallic stents. we report a case of ca esophagus who after chemotherapy and radiotherapy developed to fistula ; esophageal stenting was done but patient was still having cough and dyspnoea. fibreoptic bronchoscopy ( fob ) showed a large rent in the posterior wall of the trachea with marked narrowing of the tracheal lumen because of protrusion of the esophageal stent. he was successfully managed with the insertion of an ultraflex - covered tracheal stent and achieved relief from cough and dyspnoea.</s>"}
{"article": "imaging    techniques play an important role in the diagnosis , staging , and follow - up of cancer patients .   while standard imaging techniques , such as computed tomography ( ct ) , are based on differences in the anatomical structure of the tissues , positron emission tomography ( pet )\nuses radiolabeled molecular probes to assess differences in biological or biochemical properties of tissues .  \nthe most commonly used tracer for pet is the glucose analogue 2-[f]fluoro-2-deoxy - d - glucose ( [ f]fdg ) , which provides an estimate of tissue glucose utilization .  \ntoday , [ f]fdg pet is widely used in clinical diagnoses of cancer , including lung cancer , non - hodgkin lymphoma , and glioblastoma .  \nbecause of this increased utility in oncology [ 57 ] , [ f]fdg pet is being evaluated as a tool to assess antitumor effects of standard or novel anticancer drugs in both human subjects and in animal models of cancer .  \npet imaging may provide evidence of biological responses of novel anticancer compounds , which , in turn , can facilitate the transition of compounds from preclinical to clinical investigation .  \none such novel compound is enzastaurin , which was developed as a protein kinase c - beta ( pkc- ) inhibitor .\nthe family of protein kinase c ( pkc ) has been implicated in processes that control tumor growth , survival , and progression .  \nin particular , pkc- activation has been recognized as an important contributor to malignant growth in diffuse large cell b cell lymphoma   and in glioblastoma .  \nrecently , enzastaurin has shown antitumor activity in xenograft models of the colorectal cancer cell line hct116 and in the glioblastoma cell line u87 mg .   while enzastaurin was designed as a selective pkc-   inhibitor , recent studies suggest that its antitumor activity is modulated by activation of gsk-3 and the pi3k / akt pathway .  \nin this study we evaluated the extent to which [ f]fdg pet imaging can accurately characterize the antitumor activity of enzastaurin in two different mouse xenograft tumor models .\nnonobese diabetic / severe combined immunodeficient ( nod / scid ) mice were raised and cared for by the indiana university simon cancer center transplant and xenograft core following the institutional guidelines of animal care .  \nthe glioblastoma cell line , u87 mg , and burkitt 's lymphoma cell line , raji , were obtained from the american type culture collection ( atcc , manassas , va , usa ) and cultured as recommended by atcc .  \nas previously published , u87 mg and raji cells express high levels of pkc- [ 12 , 13 ] .\ninjection , cells were resuspended in a 1 : 1 ratio of tumor cells : matrigel ( bd biosciences , bedford , mass , usa ) and burkitt 's lymphoma cell line , raji was resuspended in a 1 : 2 ratio of tumor cells : matrigel .  \neach mouse was injected s.c . in the right flank with 5  10 cells .  \nenzastaurin treatment was initiated when the tumors reached a volume of at least 150 mm .\nmice with similar tumor sizes were matched in the control and enzastaurin treated groups .  \nenzastaurin was suspended in 10% acacia ( fisher scientific , fair lawn , nj , usa ) in water and dosed by gavage twice daily at 75 mg / kg based upon weekly body measurements for each treated group .  \neach animal was anesthetized with acepromazine ( 1 - 2 mg / kg i.m . ) and torbugesic ( 2 mg / kg i.m . ) and placed on a custom bed for imaging .  \na static 15-minute pet study was performed using the indypet ii scanner [ 14 , 15 ] at 45 minutes posttracer injection .   following the pet study ,\nthe animal bed was moved to and mounted on an evs rs9 microct scanner , and a volumetric image that encompassed the tumor volume was imaged at approximately 90 micron spatial resolution .\nfdg utilization estimatesfdg uptake estimates are generated by placing rois on pet images acquired over the time period from 4560 minutes posttracer administration .  \nindices of tumor fdg uptake were generated by calculating a ratio of the tumor to muscle uptake and by calculating the standardized uptake value ( suv ) : \n\t\t\t\t\t\t\t\t\t ( 1)suvfdg=[4560ct(t)dt](id)/m . \n\t\t\t\t\t\t\t\t in ( 1 ) ct(t ) is the concentration of [ f-18 ] in the tumor from the pet image , m is the mass of the animal , i d is the dose of the tracer injected into the animal , and  is tissue density .  \n[ f]fdg was prepared by the hamacher method using a commercial synthesis unit provided by petnet / cti ( knoxville , tenn , usa ) .\nfdg uptake estimates are generated by placing rois on pet images acquired over the time period from 4560 minutes posttracer administration .  \nindices of tumor fdg uptake were generated by calculating a ratio of the tumor to muscle uptake and by calculating the standardized uptake value ( suv ) : \n\t\t\t\t\t\t\t\t\t ( 1)suvfdg=[4560ct(t)dt](id)/m . \n\t\t\t\t\t\t\t\t in ( 1 ) ct(t ) is the concentration of [ f-18 ] in the tumor from the pet image , m is the mass of the animal , i d is the dose of the tracer injected into the animal , and  is tissue density .  \n[ f]fdg was prepared by the hamacher method using a commercial synthesis unit provided by petnet / cti ( knoxville , tenn , usa ) .\nendpoints included tumor volume via calipers , tumor volume via ct , pet - determined measures for tumor , muscle , tumor / muscle ratio ,   and a standardized measure of uptake .  \nchanges from baseline for each endpoint were analyzed for each cell line ( u87 mg , raji ) and each time point ( week 2 , week 3 ) using nonparametric statistical methods ( wilcoxon rank - sum test ) to compare treated versus control animals .   due to the exploratory nature of the analyses , p - values were used to indicate trends and potential future research hypotheses , rather than to test and confirm prespecified hypotheses .\nwe first investigated whether two tumor cell lines provided acceptable tumor growth in nod / scid mice to allow reproducible imaging with [ f]fdg pet ( figure 1 ) .  \nwe used u87 mg cells as a representative cell line for solid tumors , and raji as a model for hematologic cancers .  \nboth the u87 mg ( figure 1(a ) ) and the raji ( data not shown ) tumor types grew consistently in nod / scid mice prior to drug treatment and [ f]fdg pet imaging reliably detected glucose uptake in xenografts as determined by standardized uptake value ( suv ) ( see materials and methods ) . in these feasibility studies\n, we also found that suv correlated with u87 mg tumor size as measured by ct ( figure 1(b ) ) .   based on these preliminary observations of initial tumor growth , we elected to use both tumor cell lines to evaluate enzastaurin - induced metabolic changes as detected by [ f]fdg uptake .  \nenzastaurin - induced metabolic changes were evaluated using [ f]fdg uptake in two independent experiments for each tumor cell line , u87 mg and raji , respectively ( table 1 ) .  \nconsistent with previous studies in nude mice , enzastaurin induced tumor growth delay in nod / scid mice implanted with u87 mg and raji ( figures 2(a ) and 2(b ) ) .  \nu87 mg cells grew slower than raji cells , and enzastaurin had a tumor growth delay mainly in the u87 mg tumor cell model ( figures 2(a ) and 2(b ) ) .  \na significant tumor growth delay was seen in u87 mg after treatment with enzastaurin over the period of 3 weeks ( figure 2(a ) ) .   in the raji xenograft model\n, there was a trend in the tumor growth delay , but not a statistically significant difference between vehicle and enzastaurin - treated groups ( figure 2(b ) ) .\n[ f]fdg pet   imaging was evaluated using suv ( figures 2(c ) and 2(d ) ) and tumor / muscle ratio ( figures 2(e ) and 2(f ) ) .  \nenzastaurin administration did not alter tumor glucose metabolism as measured by suv changes in u87 mg xenografts ( figure 2(c ) ) .  \ncompared to raji , the suv changes in u87 mg xenografts occurred at smaller signal intensities , and thus contributed to an overlap of suv measurements between vehicle- and enzastaurin - treated mice ( compare figures 2(c ) and 2(d ) ) .   in raji , suv uptake appeared to be increased at weeks 2 and 3 in enzastaurin - treated compared to vehicle - treated mice ( p < .10 at weeks 2 and 3 ; figure 2(d ) ) .  \nit is possible that metabolic heterogeneity of the tumor glucose metabolism in different areas of the tumor may have caused this difference in suv uptake .  \nin addition to suv , we also used tumor / muscle ratio to determine the metabolic effect of enzastaurin in tumors .  \nthe tumor / muscle ratio   uses muscle tissue with its low metabolic rate to normalize the tumor tissue [ f]fdg uptake .   based on this analysis\nthere was no clear evidence of a metabolic change induced by enzastaurin compared to vehicle treatment ( figures 2(e ) and 2(f ) ) .  \nhowever , for u87 mg there was a trend in fdg uptake in enzastaurin - treated mice ( p < .10 at week 3 ) , which was not observed in raji xenografts ( figures 2(e ) and 2(f ) , resp . ) .  \nafter enzastaurin treatment , we observed a trend in tumor size reduction for raji xenografts but not for u87 mg xenografts at week 2 ( p\nwhile the collective analysis of all animals from 2 independent experiments did not reveal a clear distinction between enzastaurin- and vehicle - treated animals , there were some animals that did show a metabolic change after enzastaurin treatment .  \nin these cases we saw a decline only after two weeks of treatment that was essentially undetectable after the third week of treatment ( figures 3(a)3(f ) and figures 4(a)4(f ) ) .  \nthe changes observed in u87 mg were different from changes observed in raji .   in u87 mg xenografts , [ f]fdg uptake declined after the 2nd week of treatment .  \nthe raji tumors were fast growing and had large areas of necrotic tissue and some areas with newly increased [ f]fdg uptake ( figure 5 ) .\nthe growth pattern of these tumors is partly responsible for the intertumoral heterogeneity seen in this study and may contribute to the lack of detecting enzastaurin - induced changes in the tumor .\nin this study we   used a specialized pet imaging approach which was developed to assess activity of anti - cancer agents in small animals .  \nchanges in [ f]fdg uptake were generally found to correlate with reduction in tumor size as determined by caliper measurements [ 17 , 18 ] .  \nour study uses a metabolic kinase inhibitor to compare drug - mediated tumor growth reduction with metabolic alterations in vivo . while previous imaging studies evaluated anti - tumor activity of cytotoxic agents , it is not clear how [ f]fdg pet imaging can help determine antitumor activity of kinase inhibitors .  \nin addition to its cost , the use of pet imaging may be limited due to the spatial resolution of current pet scanners .  \nthus , few studies have been published which evaluate the use of small animal imaging in drug discovery .  \nfor the first time , we assessed the anti - tumor activity of the serine / threonine kinase inhibitor enzastaurin by [ f]fdg uptake in mice .   because we used nod / scid instead of conventional nude mice\n, we first confirmed that [ f]fdg pet images could reproducibly be obtained in xenografts of glioblastoma and lymphoma .  \nthis feasibility assessment was important to establish the tumor size at which [ f]fdg uptake is detectable in mice .\ntumors had to be at least 150 mm in volume to be visualized by the scanner , and the best assessment was observed in tumors that were more than 400 mm ( figure 1 ) .  \nthis is consistent with other studies which reported on the need of specific tumor sizes for scanner assessment .\nthe subsequent studies with enzastaurin treatment did not provide clear evidence of enzastaurin - induced metabolic changes in either of the two tumor types examined .  \nhowever , there are several possibilities why enzastaurin - induced changes were not detected by [ f]fdg pet imaging .   \nfirst , it is possible that enzastaurin may not have a homogenous impact on the metabolic rate in the tumor tissue .  \nalthough pkc isoenzymes have been implicated in cell proliferation , their specific role during glucose metabolism is still not understood .  \non one hand , glucose can induce pkc- expression , and on the other hand , overexpression of pkc- reduces glucose uptake in cells .   hence , selective pkc- inhibitors have been investigated as potential treatments for diabetes .   whether such a pkc--dependent glucose regulation exists in tumor cells is not known .  \nconsidering the observation of this study , in which tumor growth delay and glucose metabolism are not correlated with enzastaurin activity in xenograft tumors , it is possible that enzastaurin is not able to modulate the complex glucose regulation in the tumor cells .  \nrecently , the antiangiogenic kinase inhibitor azd2171 was also evaluated in a small animal study for its metabolic change in tumors .  \ncompared to [ f]fdg pet imaging , only [ f ] fluoromethane proved as a useful tool to assess the anti - tumor activity of azd2171 .\ntherefore , it appears that only some kinase inhibitors will have metabolic changes in tumors , which can be assessed by [ f]fdg pet imaging .\nimplanted tumors tend to grow initially along the skin surface and infiltrate the underlying tissue to a lesser extent .  \nthis observation might explain why perhaps the caliper measurements can be used to demonstrate anti - tumor effects while the imaging of the deeper tissue by [ f]fdg or ct is not able to detect differences of treatment effect .   because of the inability to delineate clearly the borders of the infiltrating tumor tissue , the current study may underestimate the metabolic change and thus lead to false - negative imaging results .   in some animals , we used contrast dye to delineate better the tumor border in mice .  \n, future studies will need to be conducted with contrast imaging techniques to approximate the anatomical borders of the tumor .  \ntumor weight did not correlate with caliper measurements , because ct scans or caliper measurements were taken during the course of the study , while tumor weight was collected only at the end of the study , when animals were sacrificed , and tumors had become heterogeneous . finally , the observed [ f]fdg uptake signals are considerably lower relative to what is measured in humans .  \nthe low baseline level in the present xenograft study negatively impacted the ability to assess early changes in metabolism associated with treatment effect .  \nother factors influencing the low uptake signal are heterogeneity of glucose uptake in tumors , possible emergence of drug - resistant tumor cells , variability of pharmacokinetic exposure of the inhibitor , and the diffusion of tracer to the tumor site .   in summary ,\nour data are consistent with the hypothesis that shrinking tumor size ( assessed by caliper measurements ) does not equate to reduction in overall tumor metabolism .\nin fact ,  pockets  of drug - resistant tumor cells with increased glucose uptake and growth kinetics may become prevalent in certain areas of the tumor , while glucose reduction will be present in other areas .  \nadditional longitudinal pet imaging studies will have to examine in detail the variables which affect the accurate measurement of tumor response to drug treatment .  \nour study implies that [ f]fdg pet imaging will be useful only in a select type of tumors and perhaps detect antitumor activity only for a limited number of drugs .", "human": " \n background . \n the use of 2-[18f]fluoro-2-deoxy - d - glucose ( [ 18f]fdg ) may help to establish the antitumor activity of enzastaurin , a novel protein kinase c - beta ii ( pkc-ii ) inhibitor , in mouse xenografts . \n methods . \n the hematologic cell line raji and the solid tumor cell line u87 mg were each implanted in nod / scid mice . \n standard tumor growth measurements and [ 18f]fdg pet imaging were performed weekly for up to three weeks after tumor implantation and growth . \n results . \n concomitant with caliper measurements , [ 18f]fdg pet imaging was performed to monitor glucose metabolism . \n heterogeneity of glucose uptake in various areas of the tumors was observed after vehicle or enzastaurin treatment . \n this heterogeneity may limit the use of [ 18f]fdg pet imaging to measure enzastaurin - associated changes in xenograft tumors . conclusion . \n [ 18f]fdg pet imaging technique does not correlate with standard caliper assessments in xenografts to assess the antitumor activity of enzastaurin . \n future studies are needed to determine the use of [ 18f]fdg pet imaging in preclinical models . ", "section_names": "1. Introduction\n2. Material and Methods\n3. Results\n4. Discussion", "bigbird_pegasus": "<s> today, 2-[18f]fluoro-2-deoxy - d - glucose ( [ 18f]fdg ) positron emission tomography ( pet ) is widely used in clinical diagnoses of cancer, including lung cancer, non - hodgkin lymphoma, and glioblastoma. pet imaging may provide evidence of biological responses of novel anticancer compounds, which, in turn, can facilitate the transition of compounds from preclinical to clinical investigation. in this study<n>, we evaluated the extent to which [ 18f]fdg pet imaging can accurately characterize the antitumor activity of enzastaurin in two different mouse xenograft tumor models.<n> enzastaurin has shown antitumor activity in xenograft models of the colorectal cancer cell line hct116 and in the glioblastoma cell line u87 mg.<n> while enzastaurin was designed as a selective pkc- inhibitor, recent studies suggest that its antitumor activity is modulated by activation of gsk-3 and the pi3k / akt pathway. in this study, we used [ 18f]fdg pet imaging to assess the antitumor activity of enzastaurin in two different mouse xenograft tumor models.<n> enzastaurin was suspended in 10% acacia ( fisher scientific, fair lawn, nj, usa ) in water and dosed by gavage twice daily at 75 mg / kg i. in nod / scid mice. in this study.<n> this study, we found antitumor growth delay...<n>.<n>.<n> we did the anti anti - anti - anti - anti - anti - growth....<n>.<n>.........<n>.<n>.<n>...<n> was the anti anti anti - anti - anti - anti - anti - anti - anti - growth..<n>..<n>.<n>..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> was the growth..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> was the growth..<n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n><n> was the growth..<n>..<n>..<n>", "longt5": "<pad> positron emission tomography ( pet ) is widely used in clinical diagnoses of cancer, including lung cancer, non - hodgkin lymphoma, and glioblastoma. because of its increased utility in oncology, [ 18f]fluoro-2-deoxy - d - glucose ( [ 18f]fdg ) is being evaluated as a tool to assess antitumor effects of standard or novel anticancer drugs in both human subjects and in animal models of cancer. in this study we evaluated the extent to which [ 18f]fdg pet imaging can accurately characterize the antitumor activity of enzastaurin in two different mouse xenograft tumor models. we used nonobese diabetic / severe combined immunodeficient ( nod / scid ) mice and glioblastoma cell lines, u87 mg and burkitt's lymphoma cell line, raji, to evaluate enzastaurin - induced metabolic changes as detected by [ 18f]fdg pet imaging in two independent experiments for each tumor cell line ( u87 mg, raji ) and each time point ( week 2, week 3 ) using nonparametric statistical methods ( wilcoxon rank - sum test ) to compare treated versus control animals. enzastaurin administration did not alter tumor glucose metabolism as measured by suv changes in u87 mg xenografts. however, for u87 mg there was a trend in fdg uptake in enzastaurin - treated mice ( p <unk>.10 at week 3 ), which was not observed in raji xenografts. our study implies that [ 18f]fdg pet imaging will be useful only in a select type of tumors and perhaps detect antitumor activity only for a limited number of drugs.</s>"}
{"article": "as the silver tsunami continues through the us and globally , the number of drivers over the age of 75 will increase significantly . as of 2012 , there were 36 million older americans licensed to drive , which was a 34% increase from 1999 .\naccidents or unintentional injuries are the 7th leading cause of death in persons 65 and older and are often the result of impairment . in the 64 to 75 age group ,\ninjuries from motor vehicle accidents ( mvas ) are the leading cause of injury related death and the second leading cause in the 75 to 84 age group .\ndrivers who are 80 years old and older have 9 times greater fatality rate than drivers aged 25 to 69 .\nassessment of driving capability in the older adult is becoming an essential aspect of the comprehensive geriatric exam , even though many primary care providers ( pcps ) do not view themselves as experts in this area and may defer driving assessment and capability to the local department of motor vehicles ( dmv ) office .\nhowever , a survey conducted by the american association of retired persons ( aarp ) showed that 40% of people surveyed aged 50 and older believed that their pcp  could best determine their ability to drive safely  [ 5 , p. 92 ] .\nearlier assessment and intervention lead to prolonged health maintenance and independence , which is an essential aspect that the pcp must consider for the older adult driver .\naccording to the american association of nurse practitioners ( aanp ) ( 2012 ) , 80% of nurse practitioners ( nps ) practice in a primary care setting . currently , there are three np graduates to every one primary care physician graduate in the united states ( us ) , and nps are improving access to care , especially in rural areas where alternative transportation methods may not be available .\ndriver safety is considered a public and personal safety issue and the np has a duty to routinely assess and intervene when appropriate .\nvariations across state laws and regulations regarding drivers make it challenging to have a nationally accepted clinical guideline or standard of care specific to assessment of safe driving . driving regulations , laws , and reporting policies vary according to state and many providers are not fully aware of these laws and policies within the state where they practice . in one state , a healthcare provider can be sued for alerting the dmv of a person 's medical diagnosis , whereas , in another state , the healthcare provider is negligible if they do not report it .\nthese extremes in variability make it confusing and difficult for nps to know what to do and what to follow .\nreport a lack of specific guidelines for primary care providers to use when caring for an older adult driver in the office setting .\nnps caring for older adults do not have an efficient evidenced - based screening instrument for use during a routine 15-minute office visit .\nthe current guidelines published by the american medical association   in collaboration with the national highway traffic safety administration ( nhtsa ) are considered  opinion - based  according to one author ( [ 5 , 9 ] ) .\nanother source describes the guidelines as comprehensive but lengthy and cumbersome to use during a routine office visit and they are not supported by evidenced - based research .\nthe purpose of this critical incident study was to identify strategies utilized by nps in the assessment and intervention of older adult drivers in southeastern north carolina .\nthe aims of this study were to ( 1 ) determine current practice of np 's assessment of and intervention strategies with older adult drivers in southeastern north carolina ; ( 2 ) assess the nps knowledge deficits in assessing safe driving capability of the older adults ; and ( 3 ) assess nps current knowledge of resources available for older adult drivers and their families . assessment and intervention of safe driving in the older adult\nhealthcare providers have standards of care or published guidelines to assess , treat , and evaluate chronic diseases such as the jnc guidelines for hypertension .\na similar guideline for assessment , intervention , and evaluation of driving safety in the older adult would prove beneficial .\nthe aging baby boomer generation started turning 65 in 2011 and , by 2030 , 1 in every 5 persons will be 65 years old or older in the united states .\npersons 85 years old and older are growing at four times the rate of the us population .\namerican 's average life expectancy has increased at the same time death rates for the 65 to 84 age group have decreased . as our population ages , there is an increased need for specialized geriatric care that includes a comprehensive , holistic approach .\npersonal safety behaviors , including safe driving habits , are part of the shuler nurse practitioner model .\nthis theoretical framework guides the np to focus on prevention of disease and disability through maintenance of maximal function , improvement in healthcare status , rapidly responding to declines , and periodic routine assessments .\nthe schuler model assesses the physiological and the psychological needs and status of the older adult . through this holistic approach ,\nthe np assesses various areas of functional capability that affect the older adult 's ability to drive safely .\na literature review was performed using these databases : ebsco host , pubmed , nursing @ ovid , proaquest nursing and allied health , science direct , and web of science .\nkeywords used were as follows : older adult , elderly , geriatric , driving , safety , assessment , and nurse practitioner .\njohnson   interviewed 25 nps on their perceptions of their role in assessing driving ability in the older adult driver who lives in an urban region .\njohnson found nps to be comfortable performing the physical assessment as it relates to driving ability such as vision , hearing , and cognitive status , but they reported being uncomfortable approaching or discussing the topic of driving safety and/or driving termination .\njohnson also concluded that early assessment , discussions , and intervention of safe driving were preferred by the older adult , rather than a discussion of driving termination .\neven though this study focused on nps , many other healthcare disciplines such as physicians , social workers , and occupational therapists have a vested interest in driving safety of the older adult .\na qualitative research method developed by flanagan , the critical incident technique , was selected as the design for this study .\nthe critical incident technique is a tool used to create a functional description of behavioral activity . according to flanagan , obtaining a description of the activity\ncan be achieved by asking the persons who actually perform the work a series of brief , precise questions aimed at identifying behaviors .\nflanagan stressed that , in a critical incident study , the sample size is not determined by the number of participants but rather by the number of critical incidents observed or reported and whether the incidents represent adequate coverage of the activity being studied .\nthe primary objective of the critical incident technique is the development of a behavioral classification system or taxonomy to find solutions to practical problems or to determine the prevalence and distribution of critical behaviors .\ncritical incident studies have been widely used by health service researchers to identify and categorize behavioral responses of healthcare providers in significant and decisive situations [ 17 , 18 ] .\ncritical incident interviews aimed at identifying specific behaviors and strategies used by nps when assessing and intervening with older drivers were conducted with a sample of 21 nps recruited through the north carolina nurses association ( ncna ) council of nurse practitioners - coastal region .\nthe open - ended self - administered critical incident survey consisted of the following questions : ( 1 ) think of the last time you cared for an older adult driver in your practice .\nwhat assessment strategies or parameters did you use to determine if the driver was safe or not ?\n( 2 ) what strategies did you use to approach that driver about the issue of driving safety ?\n( 3 ) how did you make the determination to intervene if you felt that the older adult was not safe to drive ?\npermission was obtained through the institutional review board ( irb ) at an appropriate institution prior to initiating the study .\ndata analysis was performed using statistical package for the social sciences ( spss , version 20.0 ) to assess the demographic characteristics of respondents .\nthe narrative data obtained through the critical incident surveys was analyzed through an inductive classification process developed by flanagan .\nthe critical incidents were initially reviewed by an advanced practice nurse with a specialty in gerontology and an expert in using critical incident methodology to determine which incidents should be included in the analysis .\nincidents that were judged to be nearly identical or very similar were grouped together to form subcategories of behaviors .\nthe incidents were resorted and discussed by the research team to refine and determine the final set of categories .\npercentages of agreement between the researchers were calculated for each critical incident analysis . as an estimate of the importance of each category ,\nthe number of incidents sorted by the researchers was counted and placed into a hierarchical structure or taxonomy that identified categories and their related frequencies .\na total of 21 nurse practitioners in the southeast region of the united states ( us ) participated in this study .\nthe predominantly female sample ( n = 20 , 95% ) had a mean age of 48.3 years ( sd 11.3 years ; range 2968 years ) . the average length of employment as a nurse practitioner was 9.1 years ( sd 8.4 years ) .\nthe majority of the participants earned master 's degree ( n = 18 , 85.7% ) .\none held bachelor 's degree with a family nurse practitioner certificate , one had a doctorate of nursing practice ( dnp ) , and one received ph.d .\napproximately one - half of the participants ( 47.6% ) achieved specialty certifications reflecting widely varied areas of advanced nursing practice including : adult , geriatrics , psychiatric mental health , diabetes , oncology , hospice , and wound , ostomy , and continence nursing .\nnone of the study participants had reported attendance at a continuing education program on dealing with older drivers .\nninety - five percent ( n = 20 ) reported that they see older adults ( > 65 years ) who are still driving at least once a week or more often in clinical practice settings .\nwhen asked what age they usually start screening for driving ability , 76% ( n = 16 ) indicated that there was no specific age level .\ntwo participants ( 10% ) reported initiating driver 's safety screening between the ages of 50 and 65 years , while three ( n = 14% ) began screening at the age of 66 years and above .\nninety percent ( n = 19 ) involved family members in discussions about driving safety .\nsix categories of driver behavior prompted nps to consider performing an evaluation for driving safety .\nexamples of the circumstances that trigger an assessment of driving capabilities are presented in table 1 .\nthe participants ' self - rating of competence in assessing older driver 's safety reflected a moderate level of success at 6.6 ( sd 1.3 , 110 scale with 1 very poor and 10 excellent ) .\nself - ratings of comfort in approaching older adults about their driving safety were higher at 8.0 ( sd 2.3 , 110 scale ) .\na total of 89 incidents described strategies that nurse practitioners used in assessing an older driver 's safety . when the incidents were analyzed , 11 major categories emerged with an interrater agreement of 95% .\na listing of assessment categories and circumstances that trigger an assessment of driving capabilities is presented in table 1 . the largest category , assessing diminished short - term memory , forgetfulness , or dementia , accounted for 30 incidents ( 34% ) .\nthe use of the mental status exam or the montreal cognitive assessment ( moca ) was mentioned most frequently .\nnurse practitioners shared the following:i ask them about how many times they are getting lost [ while driving ] .\ni also ask them how many times do you  beep ' your horn at other people , and how many times do other people beep their horns at you ? that 's a big red flag to me .\nif they ca n't tell me how they drove here from their house , that 's another red flag.i had one patient whose daughter mentioned a concern about driving .\ni asked her [ the patient ] to draw a clock [ i used the clock drawing test to assess cognition ] and this was really abnormal even though the geriatrician had just done a mental status exam 8 months prior . there was a significant change.i [ conducted a ] mental status exam .\nthe trigger for me was having to repeat the same conversation over and over again to a patient who was asking the same questions over and over again , day to day , and week to week .\ni ask them about how many times they are getting lost [ while driving ] .\ni also ask them how many times do you  beep ' your horn at other people , and how many times do other people beep their horns at you ? that 's a big red flag to me .\nif they ca n't tell me how they drove here from their house , that 's another red flag .\ni asked her [ the patient ] to draw a clock [ i used the clock drawing test to assess cognition ] and this was really abnormal even though the geriatrician had just done a mental status exam 8 months prior . there was a significant change .\nthe trigger for me was having to repeat the same conversation over and over again to a patient who was asking the same questions over and over again , day to day , and week to week .\n the second largest category , identifying physical frailty , included 21 or 55% of the incidents ( n = 21 ) .\nspecific elements included  conducting a fall assessment ,   assessing [ the patient 's ] ability to turn from side to side , including limited range of motion in the neck ,  \n how well they can feel their feet ,  and  assessing whether or not the patient is able to use the dominate foot to control the pedals of the car .  participants added the following.i assess their physical ability on walking by  watching them walk in ' [ to the office ] and also look at their ability to get up on the exam table and also their balance.i [ look for ] patients who describe a poor balance and i assess vertigo or syncope .\ni also look for people who are losing visual field related to macular degeneration or other visual changes .\nmost people with this are already limiting their own driving.i observe my patients getting out of and then back into their car .\n  i assess their physical ability on walking by  watching them walk in ' [ to the office ] and also look at their ability to get up on the exam table and also their balance .\n  i [ look for ] patients who describe a poor balance and i assess vertigo or syncope .\ni also look for people who are losing visual field related to macular degeneration or other visual changes .\ni observe their gait , walking , balance , flexibility , and overall mobility .  behavioral incidents in the third largest category , assessing changes in sensory impairment ,\ni ask every patient when they had a last eye exam and will [ evaluate their vision ] with the snellen chart . \nif a person can not seem to hear me in a normal conversation , i 'll check their ears for impaction and the whisper test . \na fourth category , obtaining collateral information from family members , accounted for 11% ( n = 10 ) of the total number of incidents .\nas one participant stated that  a trigger is when an adult child makes a comment such as  i wo n't ride with him ' or that they will not allow their grandchildren to ride with the patient .  a fifth category , assessing for impulsivity / lack of judgment , accounted for 6% ( n = 5 ) of the total number of incidents , while a sixth category contained incidents that described evaluating medications for drowsiness side - effects ( n = 3 , 3% ) .\nto a far lesser extent , nurse practitioners described retrieving a self - report of impaired driving or motor vehicle accident ( n = 2 , 2% ) , evaluating symptoms of new onset neurologic disease ( n = 2 , 2% ) , assessing changes in functional status ( n = 2 , 2% ) , assessing history of drugs and/or alcohol abuse ( n = 1 , 1% ) , and evaluating postmyocardial infarction status ( n = 1 , 1% ) .\nthe two most common strategies were using therapeutic communication to initiate a nonthreatening conversation about driving safety and expressing concern for the older adult 's driving safely .\na total of 66 critical incidents were reported which described strategies that nurse practitioners use in practice to increase safety in older adults .\nwhen the incidents were analyzed , nine categories of behaviors were determined with an interrater agreement of 100% .\ncategories included the following : involving family members , using therapeutic communication , referring patient to occupational / physical therapy , conducting a vision examination , using a step approach to driving termination , using objective data , referring patient to the department of motor vehicles , referring patient to a medical specialist , and limiting medications on the beers list .\none study has shown that clinicians and older adult drivers are open to the idea of using a tiered approach to driving assessment in the older adult .\nthe largest category , involving family members , accounted for 24% ( n = 16 ) of the incidents .\nas one nurse practitioner stated the following.bring the family into it . ultimately , they are the ones to take the keys if the patient is resistant.others added the following .\n sometimes i will voice safety concerns that have been brought up by the family .\nif the family is present , i try to talk to them and coach them to do the right thing like take the keys or put the care in another place.i tell families to stop being the caregiver and go back to being a family member and make me the  bad guy ' .\ni do n't want to ride with you ' and that is a pretty strong message.it's important to work with families and ask them , \nwhy are you letting the most unable person in the room drive down the street ? ' it usually has to do with the way this family has made decisions in the past as well as cultural issues , and family dynamics .\nwhen i brought up the situation to the family , they agreed and the patient stopped driving until his medical situation improved .\nhe 's doing a lot better now.the second largest category involved the use of therapeutic communication strategies ( n = 14 , 21% ) .\none participant stated  ask the older adult about how they feel about their ability to drive .\ni show empathy toward him and his loss of independence and having to rely on family for transportation ,  and  i try to be honest about safety concerns.i used therapeutic communication .\ni told him the concerns such as him not being able to recall the names of the roads that he just drove on to get here.i talked to her conversationally about how she 's been doing and how her family has been doing .\ni started asking about driving when i asked her about her vision and eye glasses .\nthis made her feel comfortable first so then i asked about this [ the driving ] .\n  bring the family into it . ultimately , they are the ones to take the keys if the patient is resistant .\n  sometimes i will voice safety concerns that have been brought up by the family .\nif the family is present , i try to talk to them and coach them to do the right thing like take the keys or put the care in another place .  \ni tell families to stop being the caregiver and go back to being a family member and make me the  bad guy ' .\ni do n't want to ride with you ' and that is a pretty strong message . \n it 's important to work with families and ask them ,  why are you letting the most unable person in the room drive down the street ? '\nit usually has to do with the way this family has made decisions in the past as well as cultural issues , and family dynamics . when i brought up the situation to the family , they agreed and the patient stopped driving until his medical situation improved .\n i show empathy toward him and his loss of independence and having to rely on family for transportation ,  and  i try to be honest about safety concerns .  \ni told him the concerns such as him not being able to recall the names of the roads that he just drove on to get here . \n i talked to her conversationally about how she 's been doing and how her family has been doing .\ni started asking about driving when i asked her about her vision and eye glasses .\nthis made her feel comfortable first so then i asked about this [ the driving ] .\n a third largest category contained incidents that described incidents where the nurse practitioner referred the patient to occupational or physical therapy ( n = 10 , 15% ) , while 12% ( n = 8) involved conducting a vision screening examination .\neleven percent of the incidents ( n = 7 ) described using a step approach to driving termination .\nfirst thing is to eliminate driving at night and then i try to find out what 's the most important thing they want to drive to .\ni have one patient who only wants to drive 2 miles from his home to the gas station where he goes into buy his coffee and newspaper and then he drives home . for the longest time\nthis is the only driving he would do and then came the day when i did n't feel he was safe to do that anymore and we had him stop driving \ni do n't think you can just take it all away from them unless it 's really imminent that they are going to hurt themselves.work with patient to drive only at certain times of the day and to certain areas that are familiar .\ni had one patient who had very slow response times so we placed a restriction that he could only drive on certain roads and stay off main roads . \nfirst thing is to eliminate driving at night and then i try to find out what 's the most important thing they want to drive to .\ni have one patient who only wants to drive 2 miles from his home to the gas station where he goes into buy his coffee and newspaper and then he drives home . for the longest time\nthis is the only driving he would do and then came the day when i did n't feel he was safe to do that anymore and we had him stop driving \ni do n't think you can just take it all away from them unless it 's really imminent that they are going to hurt themselves . \n work with patient to drive only at certain times of the day and to certain areas that are familiar .\ni had one patient who had very slow response times so we placed a restriction that he could only drive on certain roads and stay off main roads . \nadditional categories reflected the importance of using objective data when discussing driving safety with older adults ( n = 5 , 7% ) and referring the patient to the department of motor vehicles ( n = 3 , 5% ) .\ntwo incidents ( 3% ) described referring the patient to a medical specialist , while one incident ( 2% ) described the importance of avoiding the use of inappropriate , high - risk medications with older adult drivers . when participants ( nurse practitioners ) were asked to list perceived barriers for driving cessation , the most frequently mentioned barriers included resistance from the patient with denial , lack of alternative transportation , spousal denial , and increased isolation .\na listing of the most frequent barriers that nurse practitioners face in working with older adult drivers is presented in table 4 .\nthe participants in this study closely represent the national np demographics . compared to the 2012 national aanp sample survey ,\nthe demographics of nps nationally were a mean age of 51 years , white ( 85.4% ) , black / african american ( 3% ) , female ( 9.4% ) , having a graduate level degree ( 97.2% ) , and having practiced as a np for 11 years .\nthis study identified strategies used by nps in the assessment and intervention of older adults in one geographical region .\nobvious limitations of this study are the limitation to one geographical area . to the author 's knowledge , this is one of the first studies to examine self - report behaviors and strategies of nps on this topic .\nclinical practice for assessing and intervening with older adult drivers varies significantly from provider to provider .\nnps are educated to practice holistically and place great importance on building rapport and trust with their patients and their families .\nthis trusting relationship will prove beneficial when a difficult conversation such as driving cessation is needed .\nimpaired cognition was the most common reason a np determined a need to intervene . assessing cognitive status , physical frailty , and sensory impairments were the most common physical exam strategies used .\nobtaining collateral information from family members ranked just below obtaining physical exam or objective data . using therapeutic communication techniques and a concern of safety for the older adult were the most common strategies used in approaching the older adult about driving .\nnps ranked the most helpful intervention was to involve family members and the least helpful intervention was the lack of family guidance from the provider . dealing with patient concerns about lack of transportation , especially in rural areas , and resistance to driving termination were the two most common perceived barriers .\nthe wide variation in ways which nps make the determination to address driving in older adults and the lack of consistent guidelines for dealing with this issue should be noted .\nas the supply of primary care physicians is expected to decrease , the number of nurse practitioners ( nps ) is expected to increase 94% between 2008 and 2025 .\nnps are trained to provide a holistic approach to patient care and approximately half of all nps practice in the primary care setting .\nstandardized curriculum for nurse practitioner students does not require faculty to address concerns of older adult drivers ; therefore , few nps graduate with this training .\nthis could be due to lack of clinical guidelines , and faculty are unclear as to what should be taught . as this is a public safety concern\nhaving difficult conversations with older adults such as driving cessation is time consuming and possibly threatens the patient - provider relationship .\nthere is a need for the development of clinical guidelines that nps can use efficiently during a routine office visit .\nnps feel comfortable using evidenced - based clinical guidelines to guide their clinical practice with common chronic disease management .\ndevelopment of an evidenced - based clinical guideline for assessment and intervention with older adult drivers would be used similarly .\nour social work and occupational therapist colleagues have been working on this issue for quite some time .\noccupational therapists have developed guidelines for them to use in assessment of older adult drivers .\nnps and np students should also be aware of community resources available in their areas of clinical practice .\nsimply making themselves aware of resources available to them and the older adult , such as the online aarp driver safety program that can be found at http://www.aarp.org/home-garden/transportation/driver_safety/   would prove beneficial .\nthis study shows the varied and inconsistent clinical practice of nps assessing and intervening with older adults drivers . who is to say that one strategy is better than the other ?\nit is clear that nps value the relationship they have with their patients and they value the need to intervene when public safety is at risk .\ndevelopment of evidenced - based clinical guidelines would prove beneficial for nps to use in clinical practice , as long as the guidelines were able to be used quickly and efficiently .", "human": " as the silver tsunami continues , assessing and intervening with older adult drivers are becoming an essential aspect of the comprehensive geriatric exam . the current lack of time efficient clinical guidelines is a concern and barrier for nps . \n the purpose of this study was to identify strategies currently used by nps . \n the critical incident technique was used to obtain data from a convenience sample of nps . \n a total of 89 incidents were collected . \n the perspective of the np can provide important information for developing clinical guidelines to promote individual and community safety . ", "section_names": "1. Introduction\n2. Literature Review\n3. Methods\n4. Results\n5. Critical Incident Analysis\n6. Discussion\n7. Clinical Implications\n8. Conclusion", "bigbird_pegasus": "<s> <n> background.<n> assessment of driving capability in the older adult is becoming an essential aspect of the comprehensive geriatric exam, even though many primary care providers ( pcps ) do not view themselves as experts in this area.<n> the nurse practitioner ( np ) has a duty to routinely assess and intervene when caring for older adult drivers.<n> methods.<n> this study was designed as a descriptive, exploratory, and mixed methods research.<n> data were collected through face - to - face, semistructured interviews.<n> results.<n> the analysis showed that, in general, the nps did notdiagnostically assess the older adult driver's driving status.<n> the nps interventions were mostly directed to the patient's cognitive and physical impairment.<n> conclusions.<n> nps routinely assess and intervene when caring for older adult drivers.<n> the np's assessment and intervention lead to prolonged health maintenance and independence, which is an essential aspect that the pcp must consider for the older adult driver.<n> earlier assessment and intervention lead to prolonged health maintenance and independence, which is an essential aspect that the pcp must consider for the older adult driver.</s>", "longt5": "<pad> objectives. to identify strategies utilized by nurse practitioners ( nps ) in the assessment and intervention of older adult drivers in southeastern north carolina. methods. critical incident interviews aimed at identifying specific behaviors and strategies used by nps when assessing and intervening with older adults drivers were conducted with a sample of 21 nps recruited through the north carolina nurses association council of nurse practitioners - coastal region. results. 89 incidents described strategies used by nps in assessing and intervening with older adults drivers. impaired cognition was the most common reason a np determined a need to intervene. assessing cognitive status, physical frailty, and sensory impairments were the most common physical exam strategies used. obtaining collateral information from family members ranked just below obtaining physical exam or objective data. using therapeutic communication techniques and a concern of safety for the older adult were the most common strategies used in approaching the older adult about driving. nps ranked the most helpful intervention was to involve family members and the least helpful intervention was the lack of family guidance from the provider. dealing with patient concerns about lack of transportation, especially in rural areas, and resistance to driving termination were the two most common perceived barriers. conclusion. this study shows the varied and inconsistent clinical practice of nps assessing and intervening with older adults drivers. it is clear that nps value the relationship they have with their patients and they value the need to intervene when public safety is at risk. development of evidenced - based clinical guidelines would prove beneficial for nps to use in clinical practice, as long as the guidelines were able to be used quickly and efficiently.</s>"}
{"article": "coronary heart disease ( chd ) is the cause of 17.1 million deaths per year throughout the world ( 1 ) .\nthus , chd is today the largest single contributor to global mortality and will continue to dominate mortality trends in the future .\nit has been reported that the majority of deaths ( 39% ) in low- and middle - income countries under the age of 70 years are due to chd ( 2 ) .\nit has been estimated that mi is 50% higher in south asians than in white people in the uk ( 5 ) .\npakistan is a developing south asian country with a population of over 187 million ( 6 ) .\nthe majority of the population of pakistan ( 67.5% ) live in rural areas and bear the greatest burden of heart disease ( 7 ) .\nthe framingham study ( 1961 , cited in kannel ) reported that obesity , hypertension , smoking , diabetes mellitus , and hypercholesterolemia were the major risk factors for the onset of chd ( 8) . another study showed that the high prevalence of mi risk factors in pakistan with more than 30% of the population over 45 years of age is affected by this disease ( 2 ) .\npunjab is the most developed and populated province accounting for more than 45% of the entire population of pakistan ( 9 ) .\nhowever , there is a paucity of data on the estimates of chd risk factor burden or of its control status in punjab , pakistan .\nmoreover , only a little information on mi risk factors has been reported in peshawar and rahim yar khan , pakistan ( 7 ) .\nthe objectives of the present study were to collect epidemiological data on mi in north punjab and to evaluate the environmental risk factors responsible for mi with a view to lessening the disease burden through modifications in lifestyle .\nthis population - based study was carried out in six regions of north punjab , pakistan . the urban population from lahore and islamabad and the rural population from faisalabad , gujranwala , gujrat , and sialkot\na total of 515 mi patients were included in this study and divided into 250 urban and 265 rural mi patients .\ndata were collected by trained qualified staff from the patients admitted to coronary care units ( ccu ) or equivalent cardiology wards of the participating hospitals .\nthis study was conducted in accordance with the good clinical practice ( gcp ) guidelines ( declaration of helsinki ) .\nthe study protocol was approved by the ethics committee of advanced studies and research ( ref # aeg - a - ad-25 - 17/zool/09 ) . written informed consent was obtained from all the participants .\nthe inclusion criteria were comprised of mi as the principal diagnosis and admission via the ccu and emergency wards .\nthe diagnosis of mi was based on severe chest pain of 30 minutes duration , characteristic electrocardiographic ( ecg ) patterns of mi , and significant elevation in cardiac enzymes such as creatine kinase - myocardial band ( ck - mb ) .\nthe analysis was focused on identifying the socioeconomic status ( i.e. income and education ) , lifestyle ( i.e. smoking , leisure time , and physical activity ) , dietary pattern , personal and family history of mi , and risk factors such as blood pressure , diabetes , high - density lipoprotein cholesterol ( hdl - c ) , and low - density lipoprotein cholesterol ( ldl - c ) . at this point ,\narterial pressure was measured three times using a sphygmomanometer . according to the european society of hypertension /\neuropean society of cardiology ( esh / esc ) criteria , cases with systolic blood pressure > 140 mmhg and diastolic blood pressure > 90 mmhg as well as those with a previous history of hypertension and current consumption of antihypertensive medication for blood pressure control were considered hypertensive .\nweight and height were also measured in order to calculate the body mass index ( bmi ) using the formula : weight ( in kilograms ) divided by the square of height ( in meters ) .\ncases with a bmi between 25 and 29 were considered overweight and subjects with a bmi  were considered obese , while those with a total cholesterol level  200 mg / dl were considered hypercolesterolemics . fasting blood samples ( 3 ml - 5 ml ) of all the participants were collected by trained staff and were sent to the laboratories of the participating hospitals for lipid profile and blood sugar measurement .\nsubjects with a fasting glucose level  126 mg / dl were considered hyperglycemic , and those with a history of diabetes mellitus and using glucose - lowering medicines were considered diabetic . disease treatment cost was expressed in pakistani rupees ( rs ) .\npatients not willing to sign the consent form and those with previous illnesses associated with hepatic and renal failure , human immunodeficiency virus ( hiv ) , or cancer were excluded from the study .\na descriptive analysis was conducted , and the study variables were checked for normal distribution .\nthe kruskal wallis , mann - whitney u , and chi - square tests were utilized in order to check associations between the different variables . a two - sample two - tailed t - test ( pooled variances ) for a p value < 0.05 was considered statistically significant .\nthis population - based study was carried out in six regions of north punjab , pakistan . the urban population from lahore and islamabad and the rural population from faisalabad , gujranwala , gujrat , and sialkot\na total of 515 mi patients were included in this study and divided into 250 urban and 265 rural mi patients .\ndata were collected by trained qualified staff from the patients admitted to coronary care units ( ccu ) or equivalent cardiology wards of the participating hospitals .\nthis study was conducted in accordance with the good clinical practice ( gcp ) guidelines ( declaration of helsinki ) .\nthe study protocol was approved by the ethics committee of advanced studies and research ( ref # aeg - a - ad-25 - 17/zool/09 ) . written informed consent was obtained from all the participants .\nthe inclusion criteria were comprised of mi as the principal diagnosis and admission via the ccu and emergency wards .\nthe diagnosis of mi was based on severe chest pain of 30 minutes duration , characteristic electrocardiographic ( ecg ) patterns of mi , and significant elevation in cardiac enzymes such as creatine kinase - myocardial band ( ck - mb ) .\nthe analysis was focused on identifying the socioeconomic status ( i.e. income and education ) , lifestyle ( i.e. smoking , leisure time , and physical activity ) , dietary pattern , personal and family history of mi , and risk factors such as blood pressure , diabetes , high - density lipoprotein cholesterol ( hdl - c ) , and low - density lipoprotein cholesterol ( ldl - c ) . at this point ,\narterial pressure was measured three times using a sphygmomanometer . according to the european society of hypertension / european society of cardiology ( esh / esc ) criteria , cases with systolic blood pressure > 140 mmhg and diastolic blood pressure > 90 mmhg as well as those with a previous history of hypertension and current consumption of antihypertensive medication for blood pressure control\nweight and height were also measured in order to calculate the body mass index ( bmi ) using the formula : weight ( in kilograms ) divided by the square of height ( in meters ) .\ncases with a bmi between 25 and 29 were considered overweight and subjects with a bmi  were considered obese , while those with a total cholesterol level  200 mg / dl were considered hypercolesterolemics . fasting blood samples ( 3 ml - 5 ml ) of all the participants were collected by trained staff and were sent to the laboratories of the participating hospitals for lipid profile and blood sugar measurement .\nsubjects with a fasting glucose level  126 mg / dl were considered hyperglycemic , and those with a history of diabetes mellitus and using glucose - lowering medicines were considered diabetic . disease treatment cost was expressed in pakistani rupees ( rs ) .\npatients not willing to sign the consent form and those with previous illnesses associated with hepatic and renal failure , human immunodeficiency virus ( hiv ) , or cancer were excluded from the study .\na descriptive analysis was conducted , and the study variables were checked for normal distribution . the kruskal wallis , mann - whitney u , and chi - square tests were utilized in order to check associations between the different variables . a two - sample two - tailed t - test ( pooled variances ) for a p value < 0.05 was considered statistically significant .\nthe total number of the male patients was 356 ( 69.13% ) as compared to 159 ( 30.88% ) females in this study .\nthe mean age of the participants from the rural areas was 56.8  14.34 and from the urban areas was 55.7  11.26 with a range of 20 - 80 years , while 53.79% of the patients were in the range of 41 - 60 years of age ( p = 0.270 ) among the rural and urban populations in both genders .\ntables 1 and 2 show that among the urban and rural populations , mi was much more common in the males than in the females ( p = 0.015 ) , which was highly statistically significant . however , the male mi patients were younger than their female counterparts .\nthe relative difference regarding the mi prevalence between the sexes was greater among the younger subjects of up to 60 years old and smaller among the subjects of more than 60 years of age .\nthe demographic characteristics of the male and female subjects are summarized in table 1 .  \n( % ) or mean  sd .   rural , rural population ( faisalabad , gujranwala , gujrat , and sialkot ) ; urban , urban population ( lahore and islamabad ) .  \nthe body mass index was considered normal at  25 and overweight at > 25 for both men and women according to the world health organization .\nabbreviations ; nstemi , non - st - segment elevation myocardial infarction ; and stemi , st - segment elevation myocardial infarction .  \nsmoking was more common ( table 2 ) in the mi patients in the rural areas ( 33% ) than those in the urban areas ( 28% ) ( p = 0.205 ) .\ntwenty - six percent of the selected mi cases had hyperlipidemia ( cholesterol level  200 mg / dl ) .\nthe prevalence of hypertension was 36% as compared to diabetes ( 19.4% ) in the mi patients ( table 2 ) . as is evident in tables 3 and 4 , the hdl - c level reduced , while the ldl - c level and hypertension rose with age . as is shown in figure 1 , the patients with a first - degree relative positive family history experienced mi at a younger age at a bmi  25 .  \nabbreviations : bmi , body mass index ; hdl , high - density lipoprotein ; ldl , low - density lipoprotein ; nstemi , non - st - segment elevation myocardial infarction ; and stemi , st - segment elevation myocardial infarction .   abbreviations\n; bmi , body mass index ; hdl , high - density lipoprotein ; ldl , low - density lipoprotein ; nstemi , non - st - segment elevation myocardial infarction ; and stemi , st - segment elevation myocardial infarction .\nfigure 2 depicts the relationship between the monthly income and the overall cost ( i.e. ecg , computerized tomography ( ct scan ) , angiography , surgery , and medication ) of the mi patients ( p = 0.917 ) . according to the kruskal test , however ,\nthe mean monthly cost of medicines and physicians fees was 2381.132 rs ( 24.24 usd ) .\nsmoking was more common ( table 2 ) in the mi patients in the rural areas ( 33% ) than those in the urban areas ( 28% ) ( p = 0.205 ) .\ntwenty - six percent of the selected mi cases had hyperlipidemia ( cholesterol level  200 mg / dl ) .\nthe prevalence of hypertension was 36% as compared to diabetes ( 19.4% ) in the mi patients ( table 2 ) . as is evident in tables 3 and 4 , the hdl - c level reduced , while the ldl - c level and hypertension rose with age . as is shown in figure 1 , the patients with a first - degree relative positive family history experienced mi at a younger age at a bmi  25 .  \nabbreviations : bmi , body mass index ; hdl , high - density lipoprotein ; ldl , low - density lipoprotein ; nstemi , non - st - segment elevation myocardial infarction ; and stemi , st - segment elevation myocardial infarction .   abbreviations ; bmi , body mass index ; hdl , high - density lipoprotein ; ldl , low - density lipoprotein ; nstemi , non - st - segment elevation myocardial infarction ; and stemi , st - segment elevation\nfigure 2 depicts the relationship between the monthly income and the overall cost ( i.e. ecg , computerized tomography ( ct scan ) , angiography , surgery , and medication ) of the mi patients ( p = 0.917 ) . according to the kruskal test , however ,\nthe mean monthly cost of medicines and physicians fees was 2381.132 rs ( 24.24 usd ) .\nrisk factors associated with chd in the pakistani population have been relatively insufficiently studied ( 10 ) .\nnevertheless , a thorough knowledge of these factors in the different regions of punjab , pakistan , is of a great importance in order to develop national health strategies for their control .\nthe current study found that chd and its risk factors such as hypertension , diabetes , and obesity are on the increase in our country .\nour data revealed that the male mi patients from the rural and urban areas of punjab , pakistan , were relatively young ( 41 - 60 years ) .\ngender difference was also common among our study population ( p = 0.015 ) , which chimes in with previous studies reporting that middle - aged men have 2 to 5 times higher risk of mi than women ( 11 , 12 ) . women of young age are protected from the risk of chd ( 13 ) , and hormone replacement therapy reduces the risk of heart disease in postmenopausal women ( 14 ) .\nestrogen is thought to be a major contributor to premenopausal women s tendency to have normal blood pressure , higher levels of hdl - c , and lower triglyceride levels compared to men ( 15 , 16 ) . in the current study\n, a high prevalence of overweight was found among the patients from the urban areas ( p = 0.0041 ) as compared to those from the rural areas .\nthis may be due to less physical inactivity and unhealthy dietary practice , encompassing the high consumption of saturated fats and refined carbohydrates as well as the low consumption of fruits and vegetables among the residents of urban areas .\nour data on the bmi demonstrated that the patients with a positive family history of mi suffered heart disease even at a lower bmi  25 , which may be due to consanguineous marriages in pakistan ( 18 ) .\nour results showed that a 56% st - elevation myocardial infarction ( stemi ) continues to be a major public health concern in pakistan .\n19 ) also underlined stemi , by comparison with non - st - elevation myocardial infarction ( nstemi ) , as a major issue in pakistan . in our study , sedentary lifestyle ( 70% ) and smoking ( 60% ) were reported predominantly among the male mi patients .\nsmoking deteriorates hdl - c ( 14 ) , raises the blood pressure , and releases free radicals which are injurious to heart s health .\nwu et al . ( 20 ) reported that the cessation of smoking can reduce the risk of heart disease by 65% .\nfaisal et al . ( 21 ) reported a 26% prevalence rate of sedentary lifestyle among patients with chd in peshawar , pakistan .\nfurthermore , smokers of all age groups have 2 - 3 times higher death rates than non - smokers ( 22 ) . it has also been proven by an animal study that physical exercise improves the left ventricular function ( 23 ) . in the present study , hypertension ( 36% )\nemerged as the most important risk factor for the onset of mi , and its incidence was much higher among the patients from the urban areas than among those from the rural regions .\nthis finding is concordant with the results of a previous study reporting that hypertension is much higher in pakistan than in the other south asian countries ( 24 ) .\nhypertension is one of the most important risk factors responsible for atherosclerotic events ( 25 ) .\nsimilar to serum cholesterol , the blood pressure also tends to increase with age , and more prominently in women than in men ( 26 ) . in our study ,\nhyperlipidemia and diabetes were detected in 26% and 19.4% of our mi patients , respectively . according to the interheart study\n, hyperlipidemia is a significant risk factor for chd in south asia ( 27 ) .\ntype ii diabetes is a major public health issue in pakistan ( 28 ) and is an important cause of cardiovascular disease ( 29 , 30 ) .\nthe data available in the literature show a more frequent occurrence of other chd risk factors among diabetic patients ( 31 ) .\nan earlier study reported that plasma ldl - c increases by about 40% between 20 and 60 years of age ( 32 ) .\nlow- and middle - income individuals are faced with a great socioeconomic burden in the pursuit of their treatments .\nthe diagnosis of heart disease via ecg , ct scan , echocardiography , and angiography is costly , while the main burden of disease faced by the patient is at the time of surgery .\nour data showed that the mean calculated cost per patient for surgery was 600000 rs ( 6108.19 usd ) , which sometimes drastically affects the financial capacity of the patient .\nindeed , patients have to consult their physicians every month , and medicines as well as physicians fees are expensive . in our study ,\nthe mean calculated monthly cost of medicines and physicians fees per patient was 2381.132 rs ( 24.24 usd ) .\neven low - income patients are compelled to pay these high expenses , which may contribute to hypertension .\none - third of pakistani people live in poverty and as such can not afford the increasing burden of such a costly disease .\nour data demonstrated that the mi patients living in the urban areas , in comparison with those living in the rural regions , had a high level of mi risk factors ( i.e. physical inactivity , hypertension , and diabetes ) and should , therefore , be treated as a high - risk group for prevention and treatment .\nmoreover , this study demonstrated that effective risk factor control is still poor in punjab , pakistan .\naccordingly , public health programs , comprising lifestyle interventions and different pharmacological therapies , should be implemented in order to reduce the risk of chd in pakistan .\npreventive efforts are needed to start early in life and should continue throughout the life course .\nthe most significant limitation of the present study is its small sample size of mi patients from punjab province , pakistan .\nbe that as it may , our findings could assist in future well - targeted intervention and awareness campaigns , aimed at residents of urban areas in particular , with a view to lessening the burden of chd .", "human": " background : coronary heart disease ( chd ) is an important cause of morbidity and mortality in pakistan . \n the temporal trends in the risk factors for myocardial infarction ( mi ) and the impact of socioeconomic status on these risk factors remain ambiguous.objectives:the objectives of the present analysis were to investigate the potential association between various risk factors and mi in north punjab , pakistan , and to assess the status of the control of the risk factors associated with mi in this population.patients and methods : the present study included 515 patients admitted to the coronary care units or equivalent cardiology wards of the participating hospitals between 2011 and 2012 in north punjab , pakistan . \n the analysis was focused on identifying the socioeconomic status , lifestyle , family history of mi , and risk factors ( i.e. hypertension , diabetes , smoking , and hyperlipidemia ) . a structured questionnaire was designed to collect data . the lipid profile was recorded from the investigation chart of every patient . for statistical analysis , the kruskal wallis , mann - whitney u , wilcoxon , and chi - square tests were used.results:mi was common in the males at the age of 41 - 60 years as compared to the females ( p = 0.015 ) . \n patients with a positive parental history of chd experienced mi at a younger age ( p = 0.0001 ) at a body mass index ( bmi )  25 kg / m2 . \n sedentary lifestyle ( 70% ) and smoking ( 60% ) had a male predominance . \n hypertension accounted for nearly 37% , hyperlipidemia 26% , and diabetes 19.4% of the rural and urban subjects ( p < 0.01 ) . \n high - density lipoprotein cholesterol decreased ( up to 34 mg / dl ) , while low - density lipoprotein cholesterol and hypertension increased with age . \n the mean monthly cost of medicines and physicians fees per patient was 2381.132 pakistani rupees ( 24.24 usd).conclusions : higher bmi , positive family history , smoking , hypertension , hyperlipidemia , and diabetes were the strong predictors of mi in north punjab , pakistan . \n preventive efforts are needed to start early in life and continue throughout the life course . ", "section_names": "1. Background\n2. Objectives\n3. Patients and Methods\n3.1. Study Design\n3.2. Data Collection\n3.3. Data Analysis\n4. Results\n4.1. Co-Morbid Conditions and Family History Related to Myocardial Infarction\n4.2. Economic Burden\n5. Discussion", "bigbird_pegasus": "<s> abstractbackgroundcoronary heart disease ( chd ) is today the largest single contributor to global mortality and will continue to dominate mortality trends in the future.methodsenvironmental risk factors for myocardial infarction ( mi ) were evaluated in 515 mi patients from urban and rural areas of punjab, pakistan.<n> data were collected by trained qualified staff from the patients admitted to coronary care units ( ccu ) or equivalent cardiology wards of the participating hospitals.<n> this population - based study was carried out in six regions of punjab, pakistan, including the urban population from lahore and islamabad and the rural population from faisalabad, gujranwala, gujrat, and sialkot a total of 515 mi patients were included in this study and divided into 250 urban and rural mi patients.<n> data were collected by trained qualified staff from the patients admitted to ccu or equivalent cardiology wards of the participating hospitals.<n> this study was conducted in accordance with the good clinical practice ( gcp ) guidelines ( declaration of helsinki ).<n> the data were analyzed using spss.resultsthe majority of the mi patients lived in the rural areas.<n> the mean body mass index ( bmi ) was 2381.132 rs ( 24.24 usd ; nstemi, non - st - elevation myocardial infarction ; and stemi, non - st -., s,,, s,,, s,,, the patients were the patients were in the patients were.<n>.<n> the patients.<n> the patients were..<n>. the patients were...<n> the patients were..<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n> the patients, the patients were.<n>, the patients were.<n> the patients were, the patients were.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>, the patients were, the patients were.<n>, the patients were, the patients were, the patients were.<n>, the patients were the patients were the patients were the patients were the patients were the patients were", "longt5": "<pad> background : coronary heart disease ( chd ) is the cause of 17.1 million deaths per year throughout the world and will continue to dominate mortality trends in the future.objectives:the objectives of the present study were to collect epidemiological data on mi in north punjab and to evaluate the environmental risk factors responsible for mi a view to lessen the disease burden through modifications in lifestyle.patients and methods : this population - based study was carried out in six regions of north punjab, pakistan. the urban population from lahore and islamabad and the rural population from faisalabad, gujranwala, gujrat, and sialkot were divided into 250 urban and 265 rural mi patients. data were collected by trained staff from the patients admitted to coronary care units or equivalent cardiology wards of the participating hospitals.results:the mean age of the participants from the rural areas was 56.8 14.34 and from the urban areas was 55.7 11.26, with a range of 20 - 80 years, while 53.79% of the patients were in the range of 41 - 60 years of age ( p = 0.270 ) among the rural and urban populations in both genders. the male mi patients were younger than their female counterparts ( p = 0.015 ). smoking was more common in the mi patients in the rural areas ( 33% ) than those in the urban areas ( 28% ) ( p = 0.205 ). hypertension was 36% as compared to diabetes ( 19.4% ) in the mi patients. smoking was more common in the mi patients in the rural areas ( 33% ) than those in the urban areas ( 28% ) ( p = 0.205 ). hypertension was 36% as compared to diabetes ( 19.4% ) in the mi patients. smoking was more common in the mi patients in the rural areas ( 33% ) than those in the urban areas ( 28% ) ( p = 0.205 ). hypertension was 36% as compared to diabetes ( 19.4% ) in the mi patients. the mean monthly cost of medicines and physicians fees was 2381.132 rs ( 24.24 usd).conclusions : our"}
{"article": "enteric viruses are major etiologic agents of acute gastroenteritis among infants and young children worldwide .\nrotavirus , norovirus , adenovirus , and astrovirus are the recognized viral causes of pediatric gastroenteritis .\nthe world health organization ( who ) data showed that each child practically has viral diarrhea irrespective of race and socioeconomic status within the first 5 years of life and this has great economic burden for the system of public health services and all society [ 2 , 3 ] .\nviral intestinal infections are the most common cause of acute infectious diarrhea in the pediatric group and accounted for approximately 70% of episodes of acute infectious diarrhea in children .\nthere is paucity of information as regards viral enteropathogens of diarrhea in many developing countries including nigeria .\nthe reason(s ) attributed to this may be as a result of the poor health care system in the country where important health issues are taken for granted such as the aforementioned case .\nthus , as a result of the nonperformance of viral tests for diarrheal patients , information on viral enteropathogens is lost and thus measures to implement control strategies become difficult . against this background\n, this study was carried out to ascertain the prevalence of rotavirus , adenovirus , and norovirus infection in young children with diarrhea in two primary health centers in edo state , nigeria .\nit also aimed at assessing the coinfection rates of the viral agents , age , seasonal distribution of infection , and the association between clinical symptoms and viral diarrhea .\nthis study was carried out in two primary health centers located in ikpoba - okha local government area of edo state , nigeria .\nthe health centers attend to the primary health needs of the people within and around the locality .\ncases attended to include malaria , diarrhea , immunization of infants and children , antenatal and postnatal cases , and other minor health issues within the scope of the health personnel .\nthe two primary health centers are aduwawa and evbomodu primary health centers and they are neighboring communities with a fast growing population made up of indigenes with new residents from the main city alongside other inhabitants from other parts of the country . a total of two hundred and eighty - two ( 282 ) stool specimens comprising 223 diarrhea and 59 nondiarrhea stool specimens were collected from children aged between 0 and 36 months attending two primary health centers . as regards children with diarrhea , males were 121 while females were 102 .\nverbal informed consent was obtained from patients or guardian of the children prior to sample collection .\nthe samples were collected from patients at the time of clinic visit as well as other times when the child defecates .\nsterile wide mouth specimen containers were used for specimen collection and they were processed within 6 hours of collection .\nrotavirus , adenovirus , and norovirus were detected by the immunochromatographic technique ( ict ) .\nrotavirus and adenovirus were detected using vikia rota - adeno rapid test device manufactured by biomerieux , france .\nbriefly , 2 drops of liquid stool specimen was added to the specimen dilution buffer and shaken vigorously to homogenize .\ntwo drops of the diluted sample was transferred to the sample well of the test device ( cassette ) and was timed for 10 minutes .\nsimilarly , norovirus was detected using rida quick norovirus ( ni403 ) test device manufactured by r - biopharm ag , germany .\nbriefly , 1  ml of sample dilution buffer ( diluent ) was placed in a separate labeled test tube and 100  ml of liquid stool was added to it and shaken vigorously to homogenize .\nthis was allowed to settle for 2 minutes and 250  l of the supernatant was placed in a clean labeled test tube .\nsix drops of conjugate 1 was added to the test tube and was shaken vigorously to homogenize .\nthe mixture was emptied into the sample well of the test device and incubated for 10 minutes at room temperature .\nfour drops of conjugate 2 was added to the reaction window of the test device and incubated for 1 minute at room temperature .\n10 drops of wash buffer was added to the reaction window and was allowed to stay until the buffer was completely absorbed .\nsix drops of substrate was added to the reaction window and timed for 3 minutes .\nstatistical analysis was carried out using odd ratio and chi - square (  ) tests .\na total of 223 children with diarrhea were tested for three viral agents ( rotavirus , adenovirus , and norovirus ) .\na total of 95 ( 42.6% ) were positive for at least one viral agent while none of the 59 children without diarrhea was positive for any viral agent .\nthe overall result showed that rotavirus had a prevalence of 63 ( 28.3% ) ( table 1 ) .\nthe sex distribution of enteric viruses showed that males had 54 ( 44.6% ) positive cases while females had 41 ( 40.2% ) , and this was not statistically significant ( p = 0.60 ) .\nage group distribution of infection showed that 712 months had the highest infection rate with 48 ( 58.5% ) and was closely followed by 06 months which had 32 ( 50.8% ) .\nthere was a statistical significance between age group and infection ( p < 0.0001 ) ( table 2 ) .\nthe pattern of coinfecting viruses showed rotavirus - adenovirus mixed infection as the most prevalent with 12 ( 5.4% ) ( table 3 ) .\nthe seasonal pattern of enteric viruses showed that rainy season had 60 ( 46.9% ) while dry season had 35 ( 36.8% ) , and this was not statistically significant ( p = 0.17 ) .\nthe distribution of enteric viruses according to health centers was not statistically significant ( p = 0.89 ) ( table 4 ) .\nthe distribution of viral agents with respect to clinical symptoms is showed in table 5 .\nthe prevalence of rotavirus , adenovirus , and norovirus infections was investigated among children with diarrhea .\nthe results of this study when compared to other studies carried out in nigeria and other parts of the world showed that the incidence of viral agents varied from one locality to another .\nthe 28.3% of rotavirus in this study is lower than 55.9% in ilorin , nigeria , 35% in jos , nigeria , 33.3% in two districts in nigeria , and 39% in ghana . it is higher than 27% in zaria , nigeria , 28.1% in edo state , nigeria , 9.2% in botswana , and 16.9% in korea .\nthe 19.3% of adenovirus in this study is lower than 22.3% in northwestern nigeria   and 23.0% in tanzania . it is higher than 6.7% in nigeria , 3.0% in south africa , and 7.8% in botswana .\nthe 3.6% of norovirus in this study is lower than 37.3% in nigeria , 16.4% in ghana , 39% in brazil , 11.6% in korea , and 15% in ghana .\nthe differences among studies reporting viral infections in different countries might be explained by the different age group , seasonal variations , and viral detection methods used .\nthere was a statistical significance between infection and age group ( p < 0.0001 ) .\nage group of 712 months had the highest prevalence of viral diarrhea with 48 ( 58.8% ) .\nthis is consistent with the report of moyo et al . , who also found 712 months as the group with the highest infection .\nthe reason for this may be due to the fact that it is the period of activities for many children .\ncrawling and walking stages are at this period and in the process , children could pick harmful materials into their mouth especially in unhygienic conditions .\nit was observed in this study that , within the first year of life , viral infection rate was 84.2% and in the second year , it was 97.9% .\nthis is in accordance with other studies where infection was most prevalent in children within the first 2 years of life [ 11 , 16 , 19 , 20 ]\n. the relatively low prevalence of viruses among older children could be partly due to immunity acquired through previous exposures . in this study ,\ncoinfection rate was 7.6% , and rotavirus - adenovirus coinfection was the highest with 12 ( 5.4% ) .\nthis , however , did not agree with the reports of chung et al .   and koh et al . , who had rotavirus - norovirus mixed infection as the most prevalent .\nthe seasonal pattern of viral infection was not statistically significant ( p = 0.17 ) , though infection was more during the rainy season ( 46.9% ) than in the dry season ( 36.8% ) .\nreports from nigeria have showed that viral diarrhea occurs throughout the year but with variations with respect to seasons [ 8 , 13 , 16 ] .\nviral diarrhea with respect to the two primary health centers did not show statistical significance ( p = 0.89 ) , as infection rates for evbomodu and aduwawa health centers were 43.0% and 42.1% , respectively . the most commonly associated clinical symptom observed in this study with rotavirus , adenovirus , and norovirus positive cases was  vomiting  with 55.6% , 55.8% , and 75.0% , respectively .\nthis finding is similar to other studies [ 2325 ] where vomiting was the most commonly associated symptom with viral diarrhea .\nrotavirus positive patients with respect to clinical symptoms such as fever , dehydration , and abdominal pain were low in this study compared to other studies [ 23 , 26 , 27 ] which reported high percentage of clinical symptoms .\nsimilarly , for adenovirus positive patients , fever , dehydration , and abdominal pain were low compared to other studies with moderate symptoms [ 13 , 24 , 28 , 29 ] .\nhowever , as regards norovirus positive patients , fever , dehydration , and abdominal pain were also low , but other studies with norovirus showed moderate to high clinical symptoms [ 25 , 30 , 31 ] .\nthus , the differences in clinical symptoms with viral diarrhea as seen from the different studies may be attributed to seasonal variations , geographical location , nutritional status of the patients , and type of viral pathogens causing the infection .\ncoinfection of viral agents was found to be 7.6% and the most common clinical symptom was vomiting .\nthis is worrisome considering the burden of these viruses on the young children in this locality .\nthe fact that viral diagnostic tests are not routinely done or rarely done in any of the hospitals in this locality means that such vital information on viral diarrhea is missed out due to the poor attention given to health care in the country .\nthus , there is need to test stool specimens of clinically confirmed diarrheal patients for enteric viruses as this will go a long way in reducing the wasteful use of antibiotics which are used as blind treatment for persistent diarrhea that may be of viral origin .\nfinally , the primary health care centers should be provided with all the necessary diagnostic test materials to address cases of viral diarrhea .", "human": " enteric viruses have been shown to be responsible for diarrhea among children during their early childhood . \n this study was carried out to determine the prevalence of rotavirus , adenovirus , and norovirus infection in young children with diarrhea in two primary health centers in edo state , nigeria . \n a total of 223 stool specimens were collected from children aged 036 months with clinical signs of diarrhea and 59 apparently healthy age - matched children as control . \n these specimens were investigated for three viral agents using immunochromatographic technique ( ict ) . \n the overall results showed that at least one viral agent was detected in 95/223 ( 42.6% ) of the children with diarrhea while the control had none . \n the prevalence of rotavirus was 28.3% , adenovirus 19.3% , and norovirus 3.6% . \n there was a significant association between age group and infection ( p < 0.0001 ) . \n seasonal pattern of enteric viruses was not statistically significant ( p = 0.17 ) . \n the overall coinfection rate was 7.6% and rotavirus - adenovirus coinfection had the highest with 5.4% . \n rotavirus was the most prevalent viral agent . \n coinfections are not uncommon among the population studied . \n the most commonly associated clinical symptom of viral diarrhea in this study was vomiting . \n viral diagnostic tests are advocated for primary health care facilities in this locality . ", "section_names": "1. Introduction\n2. Patients and Methods\n3. Results and Discussion\n4. Conclusion", "bigbird_pegasus": "<s> rotavirus, norovirus, adenovirus, and astrovirus are the recognized viral causes of pediatric gastroenteritis worldwide.<n> there is paucity of information as regards viral enteropathogens of diarrhea in many developing countries including nigeria.<n> this study was carried out to ascertain the prevalence of rotavirus, adenovirus, and norovirus infection in young children with diarrhea in two primary health centers in edo state, nigeria.<n> it also aimed at assessing the coinfection rates of the viral agents, age, seasonal distribution of infection, and the association between clinical symptoms and viral diarrhea.<n> a total of two hundred and eighty - two ( 282 ) stool specimens comprising 223 diarrhea and 59 nondiarrhea stool specimens were collected from children aged between 0 and 36 months attending two primary health centers.<n> the stool specimens were processed using the immunochromatographic technique and the coinfection rates of the viral agents were assessed.<n> rotavirus, adenovirus, and norovirus were detected by the immunochromatographic technique.<n> coinfection rate of the viral agents was 7.6%, 58.8%, and 5.4%, respectively.<n> age group 712 months had the highest prevalence of viral diarrhea with 48 ( 58.8% ).<n> rotavirus and norovirus mixed infection was the most prevalent with 12 ( 5.4%.<n> the most common clinical symptoms were vomiting was the most common clinical symptom was vomiting.<n> coinfection rate of viral infection rate was.<n> coinfection rate was.<n> coinfection rate of viral infection rate was.<n> the co infection rate was.<n> viral infection rate was.<n> the prevalence of viral infection rate was.<n> viral infection rate was.<n> viral infection rate was low in the clinical symptoms were low.<n> the clinical symptoms were low.<n> the most clinical symptoms were the clinical symptoms were the clinical symptoms were low.<n> the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were..<n> was the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were the clinical symptoms were..<n><n> was the clinical symptoms were..<n><n><n><n><n> was the clinical symptoms were the clinical was", "longt5": "<pad> background : viral infections are the most common cause of acute infectious diarrhea in children. there is paucity of information as regards viral enteropathogens of diarrhea in many developing countries including nigeria.objectives:this study was carried out to ascertain the prevalence of rotavirus, adenovirus, and norovirus infection in young children with diarrhea in two primary health centers in edo state, nigeria.materials and methods : this study was carried out in two primary health centers located in ikpoba - okha local government area of edo state, nigeria.results:a total of 223 children with diarrhea were tested for viral agents ( rotavirus, adenovirus, and norovirus ). the overall result showed that rotavirus had a prevalence of 63 ( 28.3% ). the age group distribution of infection showed that 712 months had the highest infection rate with 48 ( 58.5% ) and was closely followed by 06 months which had 32 ( 50.8% ). the pattern of coinfecting viruses showed rotavirus - adenovirus mixed infection as the most prevalent ( 5.4% ). the seasonal pattern of enteric viruses showed that rainy season had 60 ( 46.9% ) while dry season had 35 ( 36.8% ), and this was not statistically significant ( p = 0.17 ). the distribution according to health centers was not statistically significant ( p = 0.89 ). the most commonly associated clinical symptom observed in this study was vomiting with 55.6%, 55.8%, and 75.0%, respectively. coinfection of viral agents was found to be 7.6% and the most common clinical symptom was vomiting.conclusion:there is need to test stool specimens of clinically confirmed diarrheal patients for enteric viruses as this will go a long way in reducing the wasteful use of antibiotics which are used as blind treatment for persistent diarrhea that may be of viral origin. finally, the primary health care centers should be provided with all the necessary diagnostic test materials to address cases of viral diarrhea.</s>"}
{"article": "an 81-year - old female with oavs presented to a general dentist for a dental implant consultation .\nher medical history was remarkable for an epibulbar dermoid and previous grafting of an anterior mandibular defect at the age of 16 .\nafter a routine examination , the patient was referred to an oral and maxillofacial surgeon for implant treatment planning .\nthe surgeon requested a maxillofacial cbct scan extending from the level of the nasal fossa through the inferior border of the mandible , and from the anterior border of one ramus to the anterior border of the contralateral ramus . upon radiographic examination ,\nthe bilateral paramedian area of the mandible appeared abnormally heterogeneous with a poorly defined border on the right .\nthe mandibular canals anterior to the right second molar and the left mental foramen were untraceable ( fig .\n1 ) . multiplanar reconstructions revealed a large , heterogeneous , expansile entity of mixed density along the facial side of the mandible , extending from the mandibular left premolar area to the mesial aspect of the mandibular right third molar , and from the level of the root apices through the inferior border of the mandible .\neffacement of the facial cortical plate without an effect on the neighboring teeth was observed ( fig .\n3 ) . three - dimensional volume rendering depicted the considerable size of the entity in question ( fig .\n4 ) . a cartilaginous neoplasm could not be ruled out based on cbct imaging and an incisional osseous biopsy was therefore performed .\nhematoxylin and eosin - stained slides prepared after formalin fixation and decalcification were reviewed ( fig .\ngrowth or overgrowth is a recognized sequela of ccgs . almost all patients that seek corrective surgery following ccg overgrowth in the mandibular body or condyle present with facial asymmetry .\nthis happens even when the grafts are placed bilaterally due to their unpredictable growth potential . for a definitive diagnosis to be made , radiographic examination followed by a histopathological evaluation is indicated.9 most of the published cases of ccg overgrowth in the mandible were described radiographically using panoramic images and/or multi - detector computed tomography ( mdct).10111415161718 yang et al.9 reviewed 68 cases of ccg overgrowth in the maxillofacial region .\nthe authors described a case of overgrowth of a ccg that replaced the right mandibular body using panoramic , lateral cephalometric , and posteroanterior skull radiographs , and mdct .\nnone of the radiographs demonstrated asymmetry due to the inherent limitations of this imaging modality .\nmdct allowed better visualization of the facial deformity and chin deviation in all dimensions.9 the advantage of the 3-dimensional visualization of such complex cases using mdct is indisputable .\nhowever , plain radiography is still commonly used due to its availability , low cost , and reduced patient exposure to ionizing radiation .\nthe authors reported 4 cases that demonstrated low - attenuation grafts with occasional foci of high attenuation , clear borders between the graft and host bone , and lateral and superior rims of ossification using mdct .\nthe follow - up period of these cases ranged from 5 months to 8 years .\na clear border was only seen in the case in which only 5 months had elapsed since surgery .\nfukuta et al.16 published a case of recurrent overgrowth of a ccg placed for hemimandibular reconstruction using panoramic images , mdct , and a nuclear medicine bone scan .\nthese images were of poor quality , but the authors noted the deviation of the mandible on mdct on 2 occasions ( before each corrective operation ) and increased uptake of the radionuclide by the graft on the third day after surgery .\nthis profound growth potential may have been due to the patient 's young age ( 2 years old ) .\nsimilarly , samman et al.18 demonstrated an increase in isotope uptake by the graft using technetium scintigraphy , supporting the theory that ccgs have an inherent growth potential .\nkaban et al.11 described the incorporation and calcification of a ccg replacing the mandibular condyle , and ultimately resembling a normal condyle upon periodic follow - up .\nunfortunately , the quality of the images was poor in the previous articles , which made us unable to evaluate the imaging findings .\neckardt et al.10 described a case of ccg reconstruction after hemimandibulectomy in which follow - up was performed at regular intervals , up to 6 years after surgery , using panoramic images .\nthe authors used linear and angular measurements to calculate the ratio between the operated and unoperated side to evaluate overgrowth versus growth retardation .\nalthough this approach is inaccurate , as panoramic images are prone to positioning errors and unpredictable distortion between successive images and within the same image;19 significant growth of the ccg along the vertical dimension was evident .\nko et al.13 accurately used landmarks on lateral and posteroanterior cephalometric radiographs to assess ccg growth .\nthe authors noted that the follow - up period was critical when evaluating overgrowth ; the longer the follow - up period , the more growth they found in their sample .\njang et al.20 described the case of a ccg extending from the angle of the mandible and replacing the condyle using ct .\nthe graft appeared stable with no signs of resorption or overgrowth at 10 months after surgery .\nschatz and ginat8 pointed out that autografts have the disadvantage of resorption hindering their cosmetic effect .\nthe authors demonstrated a low - attenuation cartilage graft with a peripheral rim of ossification using an axial mdct image .\nkaracaolan et al.21 also demonstrated that cartilage grafts had a tendency to undergo resorption , using magnetic resonance imaging ( mri ) after a 12-month follow - up period to assess the degree of resorption .\nthe majority of the grafts had a low signal with a few foci of high signal near the soft tissue periphery on follow - up imaging .\nno article in the literature described similar growth or changes in synthetic cosmetic implants in the soft tissue .\nhowever ; cosmetic implants , like autogenous grafts , can become incorporated into the underlying bone .\nother complications associated with cosmetic implants include migration , extrusion , erosion , and foreign bone reaction.8 with the increased use of radiographic imaging to diagnose and treat a variety of dental and medical conditions , there is an increased likelihood of incidental findings , such as implants that were not expected based on the patient 's history .\na history of implants for cosmetic purposes may not be elicited because the patient may not feel that they are important to the issue being discussed .\nalthough most implants and grafts will present as benign - looking entities within the soft tissue that can easily be interpreted as such , some may present as unusual entities that may mimic a more serious disease , such as a benign or malignant neoplasm .\nthe common management of facial defects in oavs includes reconstructive surgery , often using implants or grafts to improve patients ' cosmetic appearance .\nwe present the case of an incidentally found cosmetic graft . according to the patient ,\nan autogenous rib graft was harvested and sectioned to augment the mandibular symphysis . on imaging ,\nattempts to recover previous medical and surgical notes were unsuccessful , as the surgeon who performed the procedure in 1950 was deceased .\nthe exact surgical technique used was unclear ; however , the graft had maintained its proper anatomical location and aesthetic shape for over 65 years .\nthe most probable surgical technique may have involved the surgeon dicing the osteocartilage into multiple pieces and creating a tunnel between the mandibular periosteum and overlying mucosa to hold the diced cartilage graft in place during the healing period.21 to our knowledge , this is the last published case of an anterior mandibular costochondral graft . no case with long - term follow - up\nhas been published and a review of the literature concerning imaging related to cosmetic facial grafts did not identify any similar cases .\nclinical correlations , imaging , and histology were essential to render a final diagnosis of costochondral graft material .\nthe histopathology suggested a benign cartilaginous process ; however , the anterior mandible is a rare site for benign cartilaginous neoplasms , and without proper clinical and radiographic correlations the lesion could have been misdiagnosed .\nhowever , mandibular osteochondromas have almost exclusively been reported in the condyle.22 the characteristic imaging findings of an osteochondroma , involving a pedunculated or sessile bony cortical mass continuous with the underlying bone , were absent .\nfacial implants and grafts are found incidentally in many cbct studies performed for dental treatment .\na thorough knowledge of their normal appearance is important in order to recognize what is abnormal .\nbased on imaging alone , chondrosarcoma was initially considered due to the speckled diffuse flocculent calcification and the infiltration into adjacent normal bone .\nchondrosarcomas occur where cartilaginous tissues may be present and may occasionally occur in the symphyseal region.23 schatz and ginat8 discussed the imaging appearance of these augmentation materials using ct and mri .\nchin augmentation materials such as hydroxyapatite , silicone implants , and cartilage grafts have been described .\nthe authors concluded that cartilage grafts appear to have a soft tissue density that  may form a rim of calcification or ossification.8 our case involved a more diffuse calcification pattern , which may have been due to the longer follow - up period .\nalthough most are well defined and radiographically homogeneous , being of relatively inert non - biological material , immune reactions to some may stimulate alterations in the appearance of surrounding tissues .\nbiological implants may undergo growth and differentiation , causing their appearance to mimic neoplastic lesions .\nwe present the case of a costochondral graft in the soft tissue anterior and facial to the mandible , with changes mimicking a cartilaginous neoplasm . in light of the fact that chondrosarcomas are known to occur in the anterior rib cage , an evaluation of random growth\na vascularized graft is thought to be more controlled in growth than a nonvascularized graft .\nthis is the first case to report the cbct imaging features of a long - standing graft in the anterior mandible .", "human": " to our knowledge , the imaging features of costochondral grafts ( ccgs ) on cone - beam computed tomography ( cbct ) have not been documented in the literature . \n we present the case of a ccg in the facial soft tissue to the anterior mandible , with changes mimicking a cartilaginous neoplasm . \n this is the first report to describe the cbct imaging features of a long - standing graft in the anterior mandible . \n implants or grafts may be incidental findings on radiographic images made for unrelated purposes . \n although most are well - defined and radiographically homogeneous , being of relatively inert non - biological material , immune reactions to some grafts may stimulate alterations in the appearance of surrounding tissues . \n biological implants may undergo growth and differentiation , causing their appearance to mimic neoplastic lesions . \n we present the case of a cosmetic autogenous ccg that posed a diagnostic challenge both radiographically and histopathologically . ", "section_names": "Case Report\nDiscussion", "bigbird_pegasus": "<s> an 81-year - old female with osteoarthropathy, multipleavus, and previous facial bone grafting presented for a dental implant consultation.<n> her medical history was remarkable for an epibulbar dermoid and previous grafting of an anterior mandibular defect at the age of 16.<n> she denied any symptoms or signs of trauma.<n> the bilateral paramedian area of the mandible appeared abnormally heterogeneous with a poorly defined border on the right.<n> multiplanar reconstructions revealed a large, heterogeneous, expansile entity of mixed density along the facial side of the mandible, extending from the mandibular left premolar area to the mesial aspect of the mandibular right third molar, and from the level of the root apices through the inferior border of the mandible.<n> three - dimensional volume rendering depicted the considerable size of the entity in question.</s>", "longt5": "<pad> a costochondral graft in the soft tissue anterior and facial to the mandible is a rare site for benign cartilaginous neoplasms. we present the case of a costochondral graft in the soft tissue anterior and facial to the mandible, with changes mimicking a cartilaginous neoplasm. in light of the fact that chondrosarcomas are known to occur in the anterior rib cage, an evaluation of random growth a vascularized graft is thought to be more controlled in growth than a nonvascularized graft. this is the first case to report the cbct imaging features of a long - standing graft in the anterior mandible.</s>"}
{"article": "  in recent years , with economic development and social modernization , the number of diabetic patients has been increasing worldwide , including developing countries , posing a global problem in terms of human suffering as well as medical costs [ 1 , 2 ] . the international diabetes federation ( idf ) estimated the number of diabetic patients to be 366 million in 2011 , and that it will reach 552 million by 2030 unless effective measures are taken .    at present\n, complex interactions between genetic factors and environmental factors in the pathogenesis of diabetes are undergoing extensive study .\nhowever , the relationships between genetic and environmental factors are difficult to verify , and direct obtainment of information from humans has intrinsic limitations due to significant ethical restrictions .\nthe use of experimental animal models is essential to resolve these problems , and results of basic research in animal models of diabetes may be useful to clarify the pathogenetic mechanism of human diabetes as well as the causes of complications and in the development of drugs for diabetes .\nin fact , many animal models of diabetes have contributed to clinical research of diabetes .\nit is important to develop animal models that correspond to various pathological conditions of human diabetes , and it is urgently necessary to develop models of diabetic complications that can reflect human diabetes , because the number of patients with type 2 diabetes ( t2d ) is rapidly increasing and progression of complications significantly affects the prognosis of diabetic patients .\nalthough there are many t2d model animals such as goto - kakizaki ( gk ) rats , zucker diabetic fatty ( zdf ) rats , and otsuka long - evans tokushima fatty ( oletf ) rats , and these animal models show diabetic complications , severe diabetic retinopathy has not been observed in the existing models . in these circumstances ,\nspontaneously diabetic torii ( sdt ) rat ( figure 1 ) has been established as a model of nonobese t2d with three major complications , including ocular complications [ 46 ] .\nthis paper provides an overview of the findings from sdt rats such as pathology of diabetes .\n  in 1988 , shinohara found five nonobese diabetic rats with polydipsia , polyphagia , polyuria , and sugar urine among approximately 12-month - old elderly male sprague - dawley ( sd ) rats , which were bred at the laboratory of torii pharmaceutical co. , ltd .\n( 305 males and 306 females ) after purchase from charles river laboratories japan inc . for long - term studies of spontaneous lesions .\nthese animals were mated with young normal female rats of the same strain to successfully generate diabetic f1 , and then attempts were made to preserve the diabetic trait in a closed colony ( figure 2(a ) ) . in 1991 , some animals in the diabetes - preserved colony developed diabetes at 4 to 5 months of age , leading to sib mating based on positive urine sugar in male rats . in 1997 , a new inbred strain of nonobese t2d rats was established and named sdt rat [ 46 ] . in the process of strain breeding ,\nthe prevalence of diabetes in male rats was 90% or more in the f4 generation and 100% in the f9 and subsequent generations .\ndiabetes tended to occur earlier in later generations and occurred at approximately 4 months of age in the f7 .\nthis strain of rats was characterized by the development of diabetes only in males since its discovery , but the disease was sporadically observed in females aged 9 months or older in the f7 and subsequent generations . currently , sdt rat is distributed by clea japan , inc .\n  a clear sex difference is observed in the onset of diabetes in sdt rats ( figure 2(b ) ) .\nwhile males developed diabetes at approximately 20 weeks of age with a cumulative incidence of 100% at 40 weeks , females developed it at 45 weeks with a cumulative incidence of as low as 33% at 65 weeks .\nit is suggested that this sex difference may be partly attributed to estrogen , which inhibits the development of diabetes in females .\nthe survival rate at 65 weeks was 92% in males and 97% in females , showing that the rats survive hyperglycemia without insulin treatment ( figure 2(c ) ) .\nthe fasting and nonfasting blood glucose levels markedly increased at 20 weeks and thereafter , reaching 700  mg / dl or more at 30 weeks with polyuria characterized by severe sugar urine as well as polydipsia / polyphagia ( figure 2(d ) ) .\nin sdt rats , development of hyperglycemia may be more dependent on decreased insulin secretion than insulin resistance , as shown by the fact that the blood insulin concentration tended to be lower than that in normal sd rats even before the onset of diabetes , and marked hypoinsulinemia developed after the onset of hyperglycemia [ 8 , 9 ] , indicating that this strain of rat is a model of nonobese t2d associated with impaired insulin secretion . compared with normal sd rats , body weight and body - mass index ( bmi )\nwere similar before the onset of diabetes , but decreased with age after the onset ( figure 2(e ) ) [ 6 , 8 , 10 ] .\nit is clinically known that glucose tolerance decreases before the onset of t2d . in oral glucose tolerance test ( ogtt ) in sdt rats ,\nglucose tolerance markedly decreased at least 2 months before manifestation of hyperglycemia ( around 14 weeks old ) , and the rate of rise in blood sugar level after glucose load increased with age . in male rats ,\nthe severity of impaired glucose tolerance before the onset of diabetes was closely correlated with the age at onset of disease .\nimpaired glucose tolerance was related to decreased insulin secretory response after glucose load , and decrease in the fasting plasma insulin concentration and loss of insulin secretory response after glucose load were observed after the onset of diabetes ( figure 3 ) [ 8 , 11 ] .\nin addition , the insulin secretion level in pancreatic -cells from sdt rats after glucose treatment markedly decreased at 12 weeks of age and thereafter compared with normal sd rats . likewise , the mrna expression levels for glut2 and glucokinase in the isolated pancreatic islets markedly decreased at 12 weeks and thereafter in sdt rats . in female rats ,\nglucose tolerance also decreased at 25 weeks and thereafter , but insulin was secreted after glucose load , indicating that some factors cause insulin resistance or insulin requirement in the females , unlike in the males .\nit has also been reported that increased insulin secretion from hypertrophic pancreatic islets delayed the onset of hyperglycemia in high - fat diet - fed sdt rats .   \nas for the biochemical parameters , urine protein , blood urea nitrogen ( bun ) , glycated hemoglobin ( hba1c ) , and triglycerides ( tg ) markedly increased with the development of hyperlipidemia at 35 weeks of age and thereafter .\nin male rats , the blood tg concentration after fat load was high with normal tg absorption from the small intestine before the onset of diabetes , suggesting that the tg clearance is already impaired before the onset of disease . it is also suggested that not only the impairment of tg clearance , but also increased tg absorption from the small intestine occurs after the onset of disease .\nin addition , increased tg absorption may result from the physical increase in tg inflow associated with diabetes - related hyperphagia - induced hypertrophy of the small intestine as well as the increase in enzymes involving in tg absorption in the small intestine [ 15 , 16 ] . plasma ghrelin levels , an orexigenic hormone , of sdt rats were significantly higher than those of sd rats at 38 weeks of age .\nactive ghrelin production and suppression of insulin or leptin may be concerned with diabetic hyperphagia . in female rats as well , free fatty acids and tg were higher at 25 weeks of age before the onset of diabetes , compared with normal sd rats .\nsdt rats fed high - sucrose diet showed dyslipidemia and insulin resistance ; however , the incidence of hyperglycemia was suppressed .\nthe milder degrees of pancreatic abnormalities in high - sucrose fed sdt rats may be considered as the reason .   as for the glucose metabolism - related enzymes in the liver , glucokinase mrna level and glycogen content in the liver decreased in sdt rats at 16 weeks of age , suggesting that glucose metabolism in the liver is already abnormal before the onset of diabetes .\nafter the onset of disease , mrna expression of gluconeogenesis enzymes such as phosphoenolpyruvate carboxykinase ( pepck ) , fructose-1,6-bisphosphatase ( fbpase ) , and glucose-6-phosphatase ( g6pase ) increased [ 15 , 19 ] .  \nin sdt rats , the number of pancreatic islets and the area of -cells decreased with almost normal glucose tolerance at 10 weeks of age , compared with normal sd rats of the same age .\naround 8 weeks , pancreatic islets with congestion and capillary dilation were sporadically found with those with hemorrhage and edema in the same sections ( figures 4(a ) and 4(b ) ) .\nlater , probably accompanying findings such as inflammation and fibrosis in or around the pancreatic islets extended , and fibrosis , hemosiderin deposition and marked decrease in -cells were observed in almost all pancreatic islets at 20 weeks ( figures 4(c ) and 4(d ) ) . in sdt rats that developed diabetes , atrophy of pancreatic islets occupied by collagenous fibers and virtual disappearance of -cells was observed ( figures 4(e ) and 4(f ) ) [ 5 , 6 , 8 ] .\nthese changes in pancreatic islets starting from hemorrhage were observed in female rats around the same time with those in males .\nhigher sensitivity to streptozotocin ( stz ) , that has selective toxicity to pancreatic -cells , is also suggesting a pancreatic weakness of sdt rats .   during the course of the disappearance of -cells ,\nno lymphocyte infiltration was observed , unlike in type 1 diabetes ( t1d ) models such as nonobese diabetic ( nod ) mice   or biobreeding ( bb ) rats , but the concentration of interleukin-18 ( il-18 ) , an inflammatory cytokine , transiently increased at 9 weeks , resulting in a corresponding increase in interferon gamma ( ifn- ) and nitric oxide ( no ) production by spleen cells and peripheral leukocytes , respectively , as well as macrophage infiltration around the pancreatic islet tissue . in sdt rats , the number of white blood cells is increased at 8 weeks .\nit was immunohistologically found that the il-18 receptor and inducible no synthase ( inos ) were expressed in pancreatic islet cells .\nthese findings indicate that the development of diabetes in sdt rats may be due to the damage of pancreatic islets resulting from a transient increase in the il-18 concentration through direct effects on the cells and secondary effects via local macrophage infiltration .  \npancreas transplantation is generally performed in patients with t1d , but exceptionally in those with t2d , improving insulin sensitivity in both cases . in sdt rats\n, it is suggested that the elimination of glucose toxicity following pancreas allotransplantation may induce the pancreatic expression of pancreatic and duodenal homeobox 1 ( pdx-1 ) , a homeodomain transcription factor , inhibiting the destruction of pancreatic islets and promoting the regeneration of pancreatic islets and -cells [ 23 , 24 ] .\nbased on the results of genetic analyses using two control strains , seven quantitative trait loci ( qtls ) involved in the impairment of glucose tolerance are currently mapped on the rat genome ( table 1 ) [ 2527 ] . in a backcross experiment with brown norway ( bn ) rats ,\nqtls involved in the impairment of glucose tolerance in sdt rats were identified on chromosomes 1 , 2 , and x , which were named gisdt1 , gisdt2 , and gisdt3 , respectively .\nit is found that homozygosity or hemizygosity for the sdt allele in each of these qtls markedly increases the risk of hyperglycemia ( diabetes ) , and the interactions between the qtls synergistically worsen glucose intolerance . in an intercross experiment with f344 rats , furthermore , qtls involved in the impairment of glucose tolerance in sdt rats were identified on chromosomes 3 , 8 , 13 , and 14 , which were named dmsdt1 , dmsdt2 , dmsdt3 , and dmsdt4 , respectively . to evaluate the effects of these qtls on the development of diabetes ,\n test was performed using f2 rats with normal glucose tolerance and those with diabetes , showing that dmsdt1 is the most influential on the development of diabetes .\nsubsequently , congenic rats were generated by transferring dmsdt1 to f344 rats , and histological analysis was performed , revealing histopathological changes such as inflammation and fibrosis in the pancreas in the congenic rats .\nthese results show that dmsdt1 is the major locus responsible for pancreatic lesions in sdt rats .\n  of many diabetic ocular complications , retinopathy , cataract , and neovascular glaucoma ( hemorrhagic glaucoma ) are the most important clinically .\nsdt rat is the first diabetic model with all of these complications [ 5 , 6 , 2832 ] .   \nfurther progression of the disease was characterized by proliferative retinopathy , with tractional retinal detachment primarily in the optic disc due to fibrovascular membrane resulting from retinal neovascular vessels ( figure 5(a ) ) [ 5 , 6 , 2832 ] .\nthe vascular pathological examination by trypsin digestion method showed a few capillary aneurysms , but revealed capillary narrowing and pericyte loss in sdt rats ( figure 5(b ) ) . in fluorescein angiography\n, abnormal retinal vasodilatation was observed in some animals and may correspond to venous beading in human retinopathy [ 5 , 2832 ] .\nin addition , severe fluorescein leakage almost corresponding to the area affected by tractional retinal detachment [ 2832 ] ( figures 5(c ) and 5(d ) ) was revealed .\nthe prevalence of diabetic retinopathy was 8% at 35 to 50 weeks of age , but increased to approximately 80% at 51 to 60 weeks and 100% at 61 to 82 weeks .   at 44 weeks\n, electroretinogram ( erg ) revealed the delay and reduction of oscillatory potentials ( ops ) and a- and b - waves [ 31 , 33 ] , as is the case with human diabetic retinopathy .  \nit is known that not only microangiopathy , but also neurodegeneration occurs in the human diabetic retina . in comparison of changes in the death of neuroretinal cells as well as expression of glial fibrillary acidic protein ( gfap : a marker protein for glial cells ) and water channel aquaporins ( aqps ) over time in sdt rats , the aqp expression profile in astrocytes in the nerve fiber layer shifted from aqp-4 to aqp-1 in the retinas of sdt rats at 40 weeks , when the apoptosis of retinal ganglion cells ( rgcs ) was accelerated .\naqp-0 was predominantly expressed in the bipolar cells of the nondiabetic rat , whereas it was also expressed in the retinal nerve fibers of diabetic rat .\nthe disrupted water transport between astrocytes and retinal nerve fibers may be associated with the apoptosis of rgc induced by diabetes [ 34 , 35 ] .   in sdt rats , the angiotensin ii ( aii )\nconcentration in circulating blood was low at 15 , 30 , and 45 weeks , but the angiotensin - converting enzyme ( ace ) activity specifically increased in the eye without change in the aortic ace activity at 45 weeks . in addition , continuous treatment with aii resulted in increased retinal expression of the vascular endothelial growth factor ( vegf ) gene .\nthese findings suggest that specifically increased aii formation in the eye may play an important role in retinal vegf expression in sdt rats .\nfurthermore , advanced glycation end products ( ages ) such as carboxymethyllysine ( cml ) were expressed with vegf in the retina and may be involved in retinopathy in sdt rats . on the other hand ,\nangiogenesis was observed with vegf expression , but it has been reported that retinal neovascularization is not associated with retinal nonperfusion in sdt rats , unlike human diabetic retinopathy . unlike human diabetic retinopathy , the retinal capillary bed is hardly obstructed in sdt rats , indicating that increased expression of the pigment epithelium - derived factor ( pedf ) results in the suppression of diabetic retinal vascular disorder and less obstruction of the retinal capillary bed in sdt rats .    in human retinopathy , severely advanced retinal ischemia\nis finally associated with angiogenesis in the iris and anterior chamber angle , presenting with neovascular glaucoma . in sdt rats as well , advanced retinopathy is associated with fibrovascular membrane around the iris and sometimes with anterior chamber hemorrhage .\nneovascular membrane around the pupil may cause posterior synechiae and might develop neovascular glaucoma finally .\nsdt rat is a first model of iris neovascularization and consequent neovascular glaucoma [ 5 , 6 , 28 , 29 ] ( figure 5(e ) ) .   in male sdt rats ,\nthe prevalence of cataract is virtually 100% at 40 weeks of age . starting with opacity at the posterior pole of the lens ,\nthe findings of mature cataract are finally observed ( figures 5(f ) and 5(g ) ) .\npathological findings include swollen lens fibers , liquefaction , vacuolation , abnormal configuration , and formation of morgagnian droplets as well as partial proliferation of fibroblastoid cells .\nadvanced cataract is associated with capsular rupture , probably related to swollen lens [ 5 , 6 , 2832 ] .   \nthese ocular complications in sdt rats have been shown to be prevented by normalizing blood glucose with insulin treatment or pancreas transplantation and demonstrated to result from the long - term exposure to high blood glucose [ 31 , 40 ] .\ncorneal disorder , optic neuropathy , and uveitis are also known as ocular complications in t2d . though uveitis is not observed in sdt rats , corneal disorder and optic neuropathy are not well investigated . in sdt rats\n, renal lesions appeared at 24 weeks of age , including the thickening of the glomerular loop and glycogen deposition in the tubular epithelium ( armanni - ebstein lesion ) , dilatation of the renal tubule lumen , and increased hyaline casts .\nas for the glomerular lesions , slight thickening of the loop was apparent at 24 weeks and consistent with mesangial proliferation as shown by pas , masson 's trichrome stain , and type iv collagen immunostaining ( figures 6(a)6(f ) ) .\nmesangial proliferation intensified with age , and nodular lesions ( kimmelstiel - wilson - like nodules ) suggestive of more severe glomerular lesions were slightly observed at 68 weeks ( figure 6(g ) ) . on the other hand , the renal tubular lesions markedly increased with age , with a severe increase in tubular glycogen deposition at 50 and 68 weeks ( figure 6(h ) ) . in addition , urine volume , urine protein , and urine albumin increased with blood glucose at 24 weeks and thereafter , and these changes may be consistent with the development and progression of renal lesions [ 41 , 42 ] .\nthese renal lesions were also improved by blood glucose control with insulin and thus shown to result from the exposure to high blood glucose [ 41 , 42 ] .   in a study evaluating the involvement of oxidative stress and no in the mechanism for the progression of diabetic nephropathy in sdt rats , the blood asymmetric dimethylarginine ( adma ) concentration and urinary excretion of oxidative stress markers 8-hydroxydeoxyguanosine ( 8-ohdg ) and nitrogen oxide ( nox ) increased in sdt rats at 36 weeks , compared with insulin - treated sdt rats and normal sd rats .\nin addition , renal tissue analysis revealed glomerular hypertrophy and mesangial proliferation , and immunostaining analysis showed that the glomerular 8-ohdg , endothelial no synthase ( enos ) , and nitrotyrosine scores increased .\nin sdt rats , enos and no increased despite the increase in adma and may thus play an important role in the progression of diabetic nephropathy together with oxidative stress .\nmetformin , an amp - activated kinase ( ampk ) activator , decreased renal 8-ohdg levels and subsequent podocyte loss , in spite of the limited effects on hyperglycemia .  \nboth motor nerve and sensory nerve are impaired under in diabetes . in an electrophysiological and morphological study of diabetic peripheral neuropathy ( dpn ) in sdt rats ,\nthe motor nerve conduction velocity ( mncv ) was not different from that in normal sd rats until 6 months of age , but gradually decreased thereafter to 82% and 76% of that in normal sd rats at 10 and 12 months , respectively ( figure 7(a ) ) .\nincreased nerve sorbitol and fructose contents and decreased myo - inositol contents in sdt rats indicate that the polyol pathway is prominently involved in dpn .\nranirestat , an aldose reductase inhibitor ( ari ) decreased sciatic nerve sorbitol levels and improved impaired sciatic mncv .   in the sural nerve cross - section\n, no neurologic deficit was observed , but degenerated nerves increased in sdt rats . in morphometry ,\nthe myelinated nerve area was not clearly different between the two groups at 6 months , but decreased in sdt rats at 12 months compared with normal sd rats .\nthe number of blood vessels in the nerve sheath was not clearly different ; however , occluded / thickened epineurial arterioles were found in sdt rats ( figures 7(b)7(e ) ) [ 45 , 47 ] .\nthe increased intima possibly results decrease of nerve perfusion and may contribute to development of dpn in sdt rats . in summary , it is shown that sdt rats develop peripheral neuropathy associated with t2d after the onset of disease , including functional / morphological abnormalities of peripheral nerves and vascular lesions .   \nautonomic nerve is part of the peripheral nervous system and transmits impulses from the central nervous system to peripheral organ systems . in diabetes , autonomic nerve\nsymptoms probably due to diabetic diarrhea are observed in sdt rats . in charcoal propulsion test , gastrointestinal motility increased in sdt rats with higher fecal water content at 28 weeks of age\nin addition , jejunum and ileum weights and mucosal weight increased , and the lumen diameter and villous height were longer indicating that more nutrients are absorbed with longer villi in diabetes [ 15 , 16 , 48 ] .   in a study of voiding dysfunction in sdt rats ,\nvoiding pressure , voided volume per micturition , and intermicturition interval tended to increase from 22 weeks to 36 weeks of age compared with normal rats .\nimmunodeficiency , delayed wound healing , skin ulcer , and osteoporosis are well known . among these complications ,\nosteoporosis has been reported in sdt rat . in a study of bone lesions in sdt rats with focus on bone density and bone morphometry , bone formation and resorption decreased in sdt rats at 36 weeks of age compared with normal sd rats , but improved in insulin - treated sdt rats .\nbone density and strength also decreased in sdt rats compared with normal sd rats ( figure 8) .\nbone lesions in sdt rats were characterized by decreased bone density and low - turnover bone lesions , as seen with t2d primarily due to decreased insulin secretion , and improved with insulin treatment , indicating the deep involvement of diabetic pathology [ 50 , 51 ] .\nthe study treating carvedilol , a  blocker possessing an antioxidant effect , is also suggesting the involvement of oxidative stress on this low - turnover bone disease in sdt rats .\ncurrently , sdt rats are used for the development and application of several diabetic drugs .\nin addition to insulin [ 31 , 41 ] , sulfonylurea ( tolbutamide ) and dpp iv inhibitor ( jtp-76209 ) , -glucosidase inhibitor ( voglibose ) , sglt inhibitor ( phlorizin ) [ 15 , 54 ] , and perilla ( shiso ) tea   lowered the blood glucose level of sdt rats .   \nit has been reported that diabetic microangiopathy is caused by increased tissue protein kinase c - beta ( pkc- ) activity at high blood glucose levels . in sdt rats at 32 weeks of age , abnormal retinal function such as delayed ops in erg were observed .\nin addition , peripheral and autonomic neuropathies such as decreased caudal mncv , electrocardiographic coefficient of variation of r - r interval ( cvr - r ) , and thermal hypoalgesia were observed .\nthese diabetic complications were improved after 12-week treatment with a pkc- inhibitor jtt-010 . however , histopathological changes including retinal thickening primarily in the optic disc at 68 weeks of age were not improved .\nsince the tissue pkc activity increased after the onset of diabetes in sdt rats , jtt-010 may have suppressed diabetic neuropathy by inhibiting the pkc- activity .\nhowever , the retinal histopathological findings were not affected in sdt rats that developed diabetes along earlier , indicating that factors other than pkc- activation are deeply involved in the progression of ocular complications in sdt rats .\nbenfotiamine , a transketolase activator that reduces major pathways involved in diabetic microvascular complications ( polyol pathway , hexosamine pathway , age pathway , and diacylglycerol - protein kinase c ( dag - pkc ) pathway ) also exhibits effects on peripheral nerve function in sdt rats .   in a large - scale clinical study\n, it was reported that candesartan , an aii type 1 receptor blocker ( arb ) , inhibited the progression of retinopathy in type 2 diabetic patients . in an efficacy study of an telmisartan for the progression of ocular lesions in sdt rats , the blood glucose level was not changed , but blood pressure was decreased by telmisartan . under these conditions , delayed ops and a - wave in erg were prevented by telmisartan . in fluorescein fundus angiography , fluorescein leakage in sdt rats was decreased by telmisartan , suggesting that the arb may inhibit the development of proliferative retinopathy in sdt rats .\nit has also been reported that arbs ( candesartan and olmesartan ) improved coronary angiogenesis , cardiomyocyte fibrosis , and hypertrophy associated with the progression of diabetes in sdt rats [ 59 , 60 ] .\nin addition , candesartan decreased the pentosidine , a biomarker for age , content in the lens / vitreous body in sdt rats at 44 weeks of age , and immunohistologically , it inhibited the accumulation of pentosidine in the retinal vascular wall and decreased retinal vegf mrna expression .\nthese findings indicate that arbs can inhibit the development of proliferative diabetic retinopathy by inhibiting age formation .\nfurthermore , it has been reported that cataract and retinopathy in sdt rats were prevented by ari fidarestat   and ranirestat , age inhibitor aminoguanidine , and 1/ blocker nipradilol .  \nwith application of gene therapy , the soluble vegf receptor ( sflt-1 ) gene was introduced into the retina in sdt rats to evaluate the preventive effect of sflt-1 expressed in the retina against diabetic retinopathy . at 57 weeks of age , fluorescein fundus angiography revealed that the development of retinopathy was inhibited in the retina engineered to express sflt-1 using an adeno - associated virus ( aav ) vector as compared with the contralateral nave retina .\nsince the local introduction of sflt-1 gene in the retina with the use of an aav vector is effective in preventing the development of retinopathy in sdt rats , gene therapy for diabetic retinopathy with antiangiogenic factors will be a promising therapeutic option for human patients [ 65 , 66 ] .\nproliferative retinopathy , especially , resulting from retinal neovascular vessels is a unique characteristic of this model .\nin addition , diabetic neuropathy ( e.g. , mesangial proliferation , nodular lesion ) and diabetic peripheral / autonomic nephropathy ( e.g. , decreased ncvs , hypoalgesia , diarrhea , and voiding dysfunction ) seem to be caused by postprandial long - term hyperglycemia in sdt rats .\nbone disorder such as decreased bone density and low - turnover bone lesions are also observed . at younger age ,\nglucose intolerance , caused by pancreatic islet lesions with inflammatory cell infiltration and fibroblasts , is also a characteristic of this animal .\ntaking advantage of these features , sdt rat has been used for evaluating antidiabetic drugs and drugs / gene therapy for diabetic complications .\nalthough there are insurmountable discrepancies between human and rodents , sdt rat seems to be a better animal model of diabetes than other models .   in conclusion\n, findings indicate that the sdt rats should be a potential t2d model for studies on the pathogenesis and treatment of diabetes and its complications .", "human": " the spontaneously diabetic torii ( sdt ) rat is an inbred strain of sprague - dawley rat and recently is established as a nonobese model of type 2 diabetes ( t2d ) . \n male sdt rats show high plasma glucose levels ( over 700  mg / dl ) by 20 weeks . \n male sdt rats show pancreatic islet histopathology , including hemorrhage in pancreatic islets and inflammatory cell infiltration with fibroblasts . \n prior to the onset of diabetes , glucose intolerance with hypoinsulinemia is also observed . as a result of chronic severe hyperglycemia \n , the sdt rats develop profound complications . in eyes , \n retinopathy , cataract , and neovascular glaucoma are observed . \n proliferative retinopathy , especially , resulting from retinal neovascular vessels is a unique characteristic of this model . in kidney , mesangial proliferation and nodular lesion are observed . both peripheral neuropathy such as decreased nerve conduction velocity and thermal hypoalgesia and autonomic neuropathy such as diabetic diarrhea and voiding dysfunction have been reported . \n osteoporosis is another complication characterized in sdt rat . \n decreased bone density and low - turnover bone lesions are observed . \n taking advantage of these features , sdt rat has been used for evaluating antidiabetic drugs and drugs / gene therapy for diabetic complications . in conclusion , \n the sdt rat is potentially a useful t2d model for studies on pathogenesis and treatment of diabetic complications in humans . ", "section_names": "1. Introduction\n2. Origin of Animals and Establishment of Inbred Strain\n3. Phenotype and Clinical Characteristics\n4. Analysis of Responsible Genes\n5. Complications\n6. Application to Treatment\n7. Conclusion", "bigbird_pegasus": "<s> the number of patients with type 2 diabetes ( t2d ) is rapidly increasing worldwide, and progression of complications significantly affects the prognosis of diabetic patients.<n> although many animal models of t2d have been established, severe complications such as diabetic retinopathy have not been observed in existing models.<n> therefore, it is urgently necessary to develop animal models that can correspond to various pathological conditions of human diabetes.<n> although there are many t2d model animals such as goto - awley kakizaki rats, zucker diabetic fatty ( zdf ) rats, and otsuka long -phagis tokushima fatty ( oletf ) rats, these animal models show diabetic complications, severe diabetic retinopathy has not been observed in the existing models. in recent years, spontaneously diabetic to ( sdt ) rat, a nonobese t2d model with three major complications, including ocular complications, has been established.<n> this paper provides an overview of the findings from sdt rats such as pathology of diabetes.</s>", "longt5": "<pad> spontaneously diabetic torii ( sdt ) rats have been established as a model of nonobese type 2 diabetes ( t2d ) with major complications, including ocular complications. this paper provides an overview of the findings from sdt rats such as pathology of diabetes.</s>"}
{"article": "as rising health care costs continue to draw attention , the rate of increase in medicare expenditures , which significantly exceeded those of the overall u.s . health care system ( 9.3 versus 6.9 percent in 2005 ) , is of particular concern to policymakers .\nthe escalation in medicare part a spending is consuming a greater share of federal revenue , and current projections suggest that medicare outlays will exceed dedicated revenues by 45 percent of total expenditures in 2012 with the hospital insurance trust fund remaining solvent until 2018 . underlying\nchronic conditions are a leading cause of illness , disability , and death among medicare beneficiaries and account for a disproportionate share of health care expenditures . while approximately 14 percent of medicare beneficiaries have heart failure , they account for 43 percent of medicare spending .\napproximately 18 percent of medicare beneficiaries have diabetes , yet they account for 32 percent of medicare spending .\nthus , to limit increases in overall program expenditures , congress is actively pursuing strategies to contain costs of the chronically ill subset of beneficiaries . with many approaches to chronic dm and little agreement on the most effective approach ,\nthe 2003 medicare modernization act included several demonstration projects to assess the various approaches and inform medicare 's chronic dm strategy .\nsection 721 of the act , known as mhs , tests one approach in which commercial vendors provide dm interventions to fee - for - service beneficiaries with chronic illnesses .\nthese 3-year demonstration projects were awarded to eight companies , with the first programs becoming operational in august 2005 , and the eighth and final program becoming operational in january 2006 .\nthe pilots follow a randomized - controlled design and require that vendors reimburse the medicare program in full if they are unable to achieve budget neutrality ( inclusive of vendor fees ) .\nwhile official results of phase i are not due for over a year , three vendors have withdrawn early ( lifemasters , mckesson , and cigna as subcontractor to healthways ) and , in the preliminary evaluation of the first 6 months , the remaining projects have failed to achieve medical cost savings in excess of vendor fees ( mccall , cromwell , and bernard , 2007 ) .\nthese early results lend support to a growing body of literature concluding that commercial dm programs do not generate medical cost savings.the u.s . congressional budget office ( 2004 )\nreview of the dm literature concluded that   there is insufficient evidence to conclude that disease management programs can generally reduce the overall cost of health care services .\nthe most recent review by mattke and colleagues , which included 317 individual studies , reported that \n when the costs of the intervention were appropriately accounted for and subtracted from any savings , there was no conclusive evidence that disease management leads to a net reduction of direct medical costs .\n at the end of phase i , cms will face the decision of whether to expand mhs to a second phase .\nif the early trends are indicative of the final phase i results , policymakers should consider the changes that must be made to the commercial dm model to improve the likelihood of achieving cost savings and then assess whether the model is sufficiently compelling , when compared to other chronic care management strategies , to justify pursuing it .\nthis article contributes to this process by describing the characteristics of the current commercial dm model that limit its ability to attain short - term medical cost savings and then discussing the changes required to overcome them .\nprior to the initiation of a dm program , three questions should be answered to inform dm program design and set realistic expectations for the outcomes that will be realized : ( 1 ) what is the timeframe over which medical cost savings are expected to be achieved ? ( 2 ) given this timeframe , which categories of medical costs have the potential to be reduced ? ( 3 ) is there sufficient opportunity in a given population to achieve this targeted reduction in medical costs ?\nthe current commercial dm model suffers from a mismatch between the expectation of a short - run return on investment and an intervention that targets medium to long - term medical cost savings .\nthus , the first step toward fixing the current dm model is to develop an internally consistent approach .\nthe answer to the first question should be guided by the financial requirements of the stakeholder seeking to pursue dm for their population .\nalthough savings can be realized in the short , medium , and long term from altering the course of disease progression , most payers seek a short - term return on their investments . for - profit organizations strive to maximize shareholder value and , along with nonprofit organizations , are hesitant to invest in long - term interventions when their population has significant turnover and they are not confident that the program will reduce medical costs .\nthe 3-year timeframe of the first phase of mhs reflects this focus on short - term medical cost savings . in the short term\n, reductions may be more easily achieved for certain types of costs incurred by chronically ill populations . in the commercially insured , medicare and medicaid populations ,\nthe single largest health expenditure is in patient utilization ( nearly 33 percent in 2005 ) with 13.3 percent of all emergency department visits associated with a hospital admission ( mccaig and newar , 2006 ) .\ndiagnoses for which timely and effective outpatient care reduces the risk of hospitalization ( billings et al . , 1993 ) .\nthe second and third largest health expenditures , physician and clinical services and prescription drugs , typically increase as part of successful interventions targeting chronic illness ( u.s . congressional budget office , 2004 ; linden , 2006 ; ofman et al .\n. therefore , the primary opportunity for commercial dm programs to realize short - term medical cost savings is via reductions in costly avoidable hospitalizations and the emergency department visits that often lead to them ( linden , 2006 ) .\nfurther , a focus on avoiding the first admission during the intervention period is critical given that hospitalizations for chronic illnesses are relatively rare events and individuals may only experience one hospitalization over the entire course of a program . if the first admission is missed , the dm program may not have another opportunity to reduce the participant 's medical costs . before initiating a dm program in a given population ,\na numbers needed to decrease ( nnd ) analysis should be conducted to assess whether there is sufficient opportunity for an intervention to achieve medical cost savings .\nan nnd factors in variables including population - specific hospitalization rates , average cost per hospitalization , and the fees that will be charged by the vendor to project the percent of hospital admissions that need to be prevented to achieve a given savings target .\ntwo recent studies using this analysis ( linden , 2006 ; linden and biuso , 2006 ) calculated that between 11 and 74 percent of hospitalizations needed to be reduced for a dm program to break even on fees .\nan nnd for the mhs projects estimates a 15-percent reduction in all cause hospitalizations and an 82-percent reduction in disease - specific admissions ( congestive heart failure and diabetes ) to break even on fees alone ( table 1 ) .\nan nnd also informs the size of the population that should be included in a dm intervention and the fees that should be paid to vendors . the disease - specific hospitalization rate and\nthe percent of hospitalizations required to break even will vary in relation to the disease severity of the population ; in a sicker population with a higher attendant admissions rate , a lower percent of hospitalizations will need to be decreased to break even .\nhowever , a narrowly focused program targeting only the sickest patients addresses only a small fraction of the total disease burden and is unlikely to achieve the goals of dm at the population level . to determine a reasonable fee schedule\n, the percent of hospitalizations the vendor expects to decrease in the specific population should be estimated and then , given the client 's average cost of a hospitalization , fees should be set below the expected savings . under these two considerations , both dm vendors and their clients\nare best served by a program that is able to reduce the greatest percent of hospitalizations in the largest chronically ill population . to achieve this ,\neach of the three components of the typical commercial dm model must be successfully executed .\nfirst , individuals within the target population at risk for a near - term hospitalization must be accurately identified .\nsecond , they must be enrolled and actively participate in the program for a meaningful period of time .\nthird , the program must include interventions that modify or close deficits in participant and/or provider behavior ( i.e. , self - care and care - seeking behaviors and medical treatment or management ) that lead to near - term hospital admissions .\nas currently structured , the commercial dm model is not optimally executing any of the three components .\nthe typical approach , the barriers to realizing short - term cost savings , and recommendations to address the shortcomings are discussed for each component in the following section and summarized in table 2 .\ndm programs typically use medical claims to identify patients with a specific chronic condition who were hospitalized in the prior year and then target them to receive an intensive intervention of regularly scheduled outbound calls from clinical staff .\nparticipants with no medical claims for a hospitalization or emergency department visit in the prior year are classified as low risk and typically receive only quarterly mailings .\na recent study conducted in a large managed care population reveals the problem with this approach ( linden and goldberg , 2007 ) .\nmembers hospitalized for a chronic illness in a given year were categorized by prior year hospitalization status .\nthe claims - based identification and stratification methodology , identical to that typically employed by dm companies , showed that only 6.4 percent of patients hospitalized in the current year had been hospitalized in the prior year .\nthus , the vast majority of current year hospitalizations came from members who would have been misclassified by a dm company as low risk , unidentified due to lack of claims data , or newly enrolled in the health plan . had these members been enrolled in a dm program that targeted only high risk patients based on prior hospitalizations they would have received either a minimal intervention or no intervention at all , making it highly improbable that the program could have prevented their hospitalizations .\ndm programs are increasingly using predictive modeling to improve claims - based identification of individuals at risk for high medical costs .\nthese statistical models use past medical claims and other basic demographic data to predict future costs .\nhowever , it requires past claims history in order to achieve any reasonable degree of accuracy , and it still fails to incorporate many factors that explain health care utilization that are not reflected in administrative data , such as predisposing and enabling factors and perceived need . a recent study comparing the accuracy of several commercial models to predict high - cost participants based on their past claims history found that all models significantly underpredicted high - cost individuals and overpredicted low - cost individuals ( winkelman and mehmud , 2007 ) .\nthe best fitting model underpredicted costs by 73 percent in the highest cost percentile ( 99 - 100 ) and underpredicted costs by 52 percent in the 96 - 99th percentile of costs .\nthese models fared worse when no past claims history was available and therefore would be uninformative for new entrants to a population .\ngiven the importance for dm programs to prospectively identify individuals who will incur high costs in the near future , such low predictive ability can lead dm vendors to miss the patients most likely to have an acute episode in the near term . in light of these shortcomings , dm programs should look beyond claims data to other sources of patient data .\npsychometrically validated health risk assessments ( hras ) developed to predict future hospitalizations should be used in conjunction with claims - based models and they offer a compelling alternative when no claims history is available .\nseveral instruments have been developed specifically for the senior population ( boult et al . , 1993 ) and achieve reasonably good predictive accuracy ; the sensitivity - specificity tradeoff measured by an area under the curve is consistently around 70 percent ( wagner et al . , 2006 ) .\nat program initiation these surveys can be distributed at the population level to improve identification , and then readministered quarterly to find incident cases as well as track changes in risk status of previously surveyed participants .\nmany dm programs have such tools available but use them on a very limited basis ; thus , increasing their use would not require a fundamental overhaul of the identification approach and , if administered electronically , would minimize the incremental cost .\nthere are two other potential approaches to identify patients at risk for a near - term hospitalization .\na direct referral from the patient 's physician is the most accurate means of identifying suitable candidates for a dm program . despite the fact that many dm programs have a channel for such direct referrals , physicians rarely use them .\nphysicians may not be aware of patient eligibility for dm or may not support the program .\nthe broader issue of how to engage physicians in dm is discussed at the end of this section .\nelectronic medical records ( emr ) and other repositories of clinical data that include medication lists and laboratory values are rich sources of up - to - date patient information .\nhealth systems such as kaiser permanente rely heavily on their emr for such purposes ( hyatt , taylor , and budge , 2004 ) , but outside of integrated delivery systems , third - party access to emr data would have to be negotiated .\nthus , while both of these strategies are promising , under the current health care delivery system supplementing claims - based identification with hras is the most compelling approach to improve identification of high risk patients .\nthis process is labor intensive and time consuming , limiting the number of eligible persons that can be contacted in a timely fashion .\nfurther , people are often wary of discussing health - related issues with strangers over the telephone and potential participants must be convinced that the program is legitimate . in commercial dm programs ,\nenrollment rates are quite low and vary by disease , with asthma program enrollment rates averaging 10 percent and congestive heart failure program enrollment rates averaging 30 percent of the eligible population ( lewis , 2007 ) .\nvendors in the mhs project are strongly incentivized to maximize enrollment within the required opt - in approach and have achieved high enrollment rates in the first 6 months of the mhs projects ranging from 65 to 92.3 percent ( mccall , cromwell , and bernard , 2007 ) .\nhowever , mean time - to - agreement ranged from 37 to 100 days , revealing that in the best case it took over a month to enroll beneficiaries in the program .\nfurther , those agreeing to participate were considerably healthier compared to non - participants , indicating that the beneficiaries who could most benefit from dm require even greater effort to enroll .\nan hra is also helpful in the enrollment process as it identifies individuals who are ready to consider changing their health behaviors and as a result are more likely to enroll in the program .\nthe percentage of individuals in any given population that are ready to change their behavior is not easily quantified as it is highly dependent on how readiness to change is defined and differs by the particular behaviors that are targeted .\nmost survey instruments include questions based on prochaska 's ( 1979 ) stages of change psychosocial model for determining the level of readiness to change .\nparticipants who are at least contemplating change , once identified , should be contacted by program representatives trained in behavior change methods , such as motivational interviewing .\nsuch techniques help participants overcome ambivalence and increase likelihood of enrollment ( miller and rollnick , 1991 ) .\nrepresentatives who are not trained in these methods may be too directive or confrontational , which can reverse a prior commitment to change ( amrhein et al . , 2003 ) and discourage participation . given the expense associated with telephonic enrollment , programs implemented in large populations should consider the use of interactive voice recognition ( ivr ) or web - enabled technologies to maximize the outreach to eligible participants .\na tradeoff exists between the narrow - and - deep telephonic approach and the wide - and - shallow approach that ivr technologies facilitate .\nan optimal enrollment model would include a technologically - based outreach process that draws on motivational interviewing methods . however , this combination is not currently mature enough to be widely available .\nthus , the choice of approach should be driven by the broader decision on the size of the population targeted to receive the intervention .\nfor example , one employer - based program achieved a 90-percent hra response rate when a $ 500 rebate on medical premiums was offered , compared to a 20-percent response rate with no incentive ( finkelstein and kosa , 2003 ) .\na recent study demonstrated that even modest incentives were effective in motivating overweight employees to lose weight .\nafter 3 months , individuals who received $ 14 for their participation lost 4.7 pounds on average compared to only 2 pounds in the control group ( finkelstein et al . , 2007 ) .\nphysician incentives can further bolster enrollment by sharing the cost savings associated with the program or by providing a pay - for - performance initiative in which they are paid for enrolling and supporting their patients in the program .\nwhile incentives increase program costs , at the right level they may be offset by a concomitant increase in enrollment and active engagement assuming that the sub sequent intervention reduces medical costs .\nfor participants classified as high risk , most commercial dm programs share a common intervention approach focused on improving process measures ( e.g. , increasing regular testing of glycosylated hemoglobin [ hba1c ] in diabetics ) in order to avoid costly complications in the future .\nsince most process measures are performed periodically ( i.e. , diabetics should receive an hba1c test between two and four times per year ) , the core dm intervention is comprised of patient calls around the time that these tests should occur . a recent study conducted by healthways , inc .\nreported that program participants with diabetes ( 245,668 unique members with diabetes from 25 different health plans across the united states ) received no more than four calls in their first 12 months of the program ( coberley et al . , 2007 ) .\nwhile periodic calls to participants have proven adequate to elicit improvements in screening rates ( coberley et al . , 2007 ) , they are insufficient to pick up on signs that patients are at risk for a near - term emergency department visit or hospitalization .\nfurther , there is evidence to suggest that most clinical practice guidelines for chronic illnesses are not modified to consider the needs of older patients with multiple and complex comorbidities ( boyd et al . , 2005 ) .\nthus , it is possible that this emphasis on adherence to practice guidelines focuses on the wrong aspects of care for this population and may have a detrimental effect on outcomes .\nseveral interventions have been shown to be successful at reducing avoidable admissions , but they require a greater frequency of patient contact than is currently the norm .\nmost participants at highest risk of a near - term hospitalization need to be assessed daily .\none strategy is to use outbound calls conducted by individuals proficient in behavior change methodologies .\nremote telemonitoring ( rtm ) technology offers an alternative strategy for assessing patient status and is typically less costly than daily outbound calls . via rtm ,\nthe signs or symptoms of an impending acute exacerbation triggers an alert to a nurse who can respond immediately and triage the patient to the appropriate ambulatory care setting .\nfor example , daily monitoring of congestive heart failure patients catches symptoms including weight gain , lower extremity edema , and increasing dyspnea that are typically present in the 8 to 12 days prior to hospitalization ( schiff et al . ,\na recent systematic review of rtm reported that , in the majority of studies of chronic obstructive pulmonary disease and cardiac diseases , rtm led to significant decreases in hospitalizations , emergency department visits , and length of stay ; studies of diabetes and hypertension had mixed results ( pare , jaana , and sicotte , 2007 ) .\nhowever , rtm is expensive and , in diabetes , it is estimated to cost between $ 300 and $ 400 per patient per year when sponsored by a physician practice ( adler - milstein et al . , 2007 ) .\nother interventions shown to reduce near - term avoidable admissions include the provision of seasonal influenza vaccinations ( nichol , baken , and nelson , 1999 ) and a monthly pharmacist review of a patient 's medication profile ( hepler and strand , 1990 ) .\nthe latter may substantially reduce avoidable hospitalizations caused by drug - related problems such as untreated indications , use of the medication without indication , improper drug selection , subtherapeutic dosage , overdose , adverse re actions , interactions , and failure to receive the drug ( strand , morley , and cipolle , 1990 ) .\none of the biggest challenges in commercial dm is engaging physicians to support the program .\nthese programs have little ability to collaborate with physicians , many of whom are skeptical of dm initiatives and view them as disruptive to the physician - patient relationship ( leider , 1999 ) . without explicit endorsement from their physician\n, many patients will not enroll or adhere to the intervention provided by the dm program ( leider , 1999 ) .\nthis is problematic as physicians are well positioned to identify potential participants and persuade them to participate in a dm program .\nfurther , when physicians are actively involved in the intervention process , it is more likely that a dm program will be able to effectuate sufficient change in a patient 's clinical condition to avoid an acute exacerbation .\na recent article on the role of physicians in dm reports several barriers to physician engagement including a lack of financial incentive , a lack of technology to facilitate communication , and the need for a trusted practice - based program champion ( kuraitis , 2007 ) .\nleider ( 1999 ) suggests five core strategies to achieve physician buy - in for disease management programs .\nthese include ( 1 ) educating physicians on the goals of the dm program , ( 2 ) identifying champions with positive views of the program , ( 3 ) setting clear goals and expectations for physicians who participate in the program , ( 4 ) demonstrating that a relatively easy program works before attempting a more complex or controversial program , and ( 5 ) sharing the gains by rewarding physicians for their time and effort supporting the program . while such strategies are likely to strengthen physician support of commercial dm , they raise the broader question of the appropriate role for each player in supporting chronic dm .\nsome view commercial dm companies as filling a gap in our acute care focused delivery system that has consistently failed to deliver high - quality care to those with chronic illnesses .\nhowever , the flaws of a third - party work - around are evident in the increased fragmentation of care that results from a lack of coordination between dm vendors and traditional care delivery settings . a compelling alternative is wagner 's chronic care model that includes a primary care - based medical home\n. proponents of this model believe that the primary care team is the entity best suited to deliver chronic care management ( geyman , 2007 ) . in this model\n, the primary care physician leads a team of specialists , nurses , dieticians , pharmacists , and health educators to provide and coordinate all the care for a chronically ill population .\nwith evidence of cost reduction and quality improvement from group health cooperative and kaiser permanente , primary case - based dm enjoys empirical support ( mcculloch et al . , 2000 ) .\nrecent pay - for - performance programs that attempt to align payment incentives with high - quality chronic care also reflect a belief that chronic care is the responsibility of physicians and the systems in which they operate ( rosenthal et al . , 2007 ) .\ndm programs typically use medical claims to identify patients with a specific chronic condition who were hospitalized in the prior year and then target them to receive an intensive intervention of regularly scheduled outbound calls from clinical staff .\nparticipants with no medical claims for a hospitalization or emergency department visit in the prior year are classified as low risk and typically receive only quarterly mailings .\na recent study conducted in a large managed care population reveals the problem with this approach ( linden and goldberg , 2007 ) .\nmembers hospitalized for a chronic illness in a given year were categorized by prior year hospitalization status .\nthe claims - based identification and stratification methodology , identical to that typically employed by dm companies , showed that only 6.4 percent of patients hospitalized in the current year had been hospitalized in the prior year .\nthus , the vast majority of current year hospitalizations came from members who would have been misclassified by a dm company as low risk , unidentified due to lack of claims data , or newly enrolled in the health plan . had these members been enrolled in a dm program that targeted only high risk patients based on prior hospitalizations they would have received either a minimal intervention or no intervention at all , making it highly improbable that the program could have prevented their hospitalizations .\ndm programs are increasingly using predictive modeling to improve claims - based identification of individuals at risk for high medical costs .\nthese statistical models use past medical claims and other basic demographic data to predict future costs .\nhowever , it requires past claims history in order to achieve any reasonable degree of accuracy , and it still fails to incorporate many factors that explain health care utilization that are not reflected in administrative data , such as predisposing and enabling factors and perceived need . a recent study comparing the accuracy of several commercial models to predict high - cost participants based on their past claims history found that all models significantly underpredicted high - cost individuals and overpredicted low - cost individuals ( winkelman and mehmud , 2007 ) .\nthe best fitting model underpredicted costs by 73 percent in the highest cost percentile ( 99 - 100 ) and underpredicted costs by 52 percent in the 96 - 99th percentile of costs .\nthese models fared worse when no past claims history was available and therefore would be uninformative for new entrants to a population .\ngiven the importance for dm programs to prospectively identify individuals who will incur high costs in the near future , such low predictive ability can lead dm vendors to miss the patients most likely to have an acute episode in the near term . in light of these shortcomings , dm programs should look beyond claims data to other sources of patient data .\npsychometrically validated health risk assessments ( hras ) developed to predict future hospitalizations should be used in conjunction with claims - based models and they offer a compelling alternative when no claims history is available .\nseveral instruments have been developed specifically for the senior population ( boult et al . , 1993 ) and achieve reasonably good predictive accuracy ; the sensitivity - specificity tradeoff measured by an area under the curve is consistently around 70 percent ( wagner et al . , 2006 ) .\nat program initiation these surveys can be distributed at the population level to improve identification , and then readministered quarterly to find incident cases as well as track changes in risk status of previously surveyed participants .\nmany dm programs have such tools available but use them on a very limited basis ; thus , increasing their use would not require a fundamental overhaul of the identification approach and , if administered electronically , would minimize the incremental cost .\nthere are two other potential approaches to identify patients at risk for a near - term hospitalization .\na direct referral from the patient 's physician is the most accurate means of identifying suitable candidates for a dm program . despite the fact that many dm programs have a channel for such direct referrals , physicians rarely use them .\nphysicians may not be aware of patient eligibility for dm or may not support the program .\nthe broader issue of how to engage physicians in dm is discussed at the end of this section .\nelectronic medical records ( emr ) and other repositories of clinical data that include medication lists and laboratory values are rich sources of up - to - date patient information .\nhealth systems such as kaiser permanente rely heavily on their emr for such purposes ( hyatt , taylor , and budge , 2004 ) , but outside of integrated delivery systems , third - party access to emr data would have to be negotiated .\nthus , while both of these strategies are promising , under the current health care delivery system supplementing claims - based identification with hras is the most compelling approach to improve identification of high risk patients .\nthis process is labor intensive and time consuming , limiting the number of eligible persons that can be contacted in a timely fashion .\nfurther , people are often wary of discussing health - related issues with strangers over the telephone and potential participants must be convinced that the program is legitimate . in commercial dm programs ,\nenrollment rates are quite low and vary by disease , with asthma program enrollment rates averaging 10 percent and congestive heart failure program enrollment rates averaging 30 percent of the eligible population ( lewis , 2007 ) .\nvendors in the mhs project are strongly incentivized to maximize enrollment within the required opt - in approach and have achieved high enrollment rates in the first 6 months of the mhs projects ranging from 65 to 92.3 percent ( mccall , cromwell , and bernard , 2007 ) .\nhowever , mean time - to - agreement ranged from 37 to 100 days , revealing that in the best case it took over a month to enroll beneficiaries in the program .\nfurther , those agreeing to participate were considerably healthier compared to non - participants , indicating that the beneficiaries who could most benefit from dm require even greater effort to enroll .\nan hra is also helpful in the enrollment process as it identifies individuals who are ready to consider changing their health behaviors and as a result are more likely to enroll in the program .\nthe percentage of individuals in any given population that are ready to change their behavior is not easily quantified as it is highly dependent on how readiness to change is defined and differs by the particular behaviors that are targeted .\nmost survey instruments include questions based on prochaska 's ( 1979 ) stages of change psychosocial model for determining the level of readiness to change .\nparticipants who are at least contemplating change , once identified , should be contacted by program representatives trained in behavior change methods , such as motivational interviewing .\nsuch techniques help participants overcome ambivalence and increase likelihood of enrollment ( miller and rollnick , 1991 ) .\nrepresentatives who are not trained in these methods may be too directive or confrontational , which can reverse a prior commitment to change ( amrhein et al . , 2003 ) and discourage participation . given the expense associated with telephonic enrollment , programs implemented in large populations should consider the use of interactive voice recognition ( ivr ) or web - enabled technologies to maximize the outreach to eligible participants .\na tradeoff exists between the narrow - and - deep telephonic approach and the wide - and - shallow approach that ivr technologies facilitate .\nan optimal enrollment model would include a technologically - based outreach process that draws on motivational interviewing methods . however , this combination is not currently mature enough to be widely available .\nthus , the choice of approach should be driven by the broader decision on the size of the population targeted to receive the intervention .\nfor example , one employer - based program achieved a 90-percent hra response rate when a $ 500 rebate on medical premiums was offered , compared to a 20-percent response rate with no incentive ( finkelstein and kosa , 2003 ) .\na recent study demonstrated that even modest incentives were effective in motivating overweight employees to lose weight .\nafter 3 months , individuals who received $ 14 for their participation lost 4.7 pounds on average compared to only 2 pounds in the control group ( finkelstein et al . , 2007 ) .\nphysician incentives can further bolster enrollment by sharing the cost savings associated with the program or by providing a pay - for - performance initiative in which they are paid for enrolling and supporting their patients in the program .\nwhile incentives increase program costs , at the right level they may be offset by a concomitant increase in enrollment and active engagement assuming that the sub sequent intervention reduces medical costs .\nfor participants classified as high risk , most commercial dm programs share a common intervention approach focused on improving process measures ( e.g. , increasing regular testing of glycosylated hemoglobin [ hba1c ] in diabetics ) in order to avoid costly complications in the future .\nsince most process measures are performed periodically ( i.e. , diabetics should receive an hba1c test between two and four times per year ) , the core dm intervention is comprised of patient calls around the time that these tests should occur . a recent study conducted by healthways , inc . reported that program participants with diabetes ( 245,668 unique members with diabetes from 25 different health plans across the united states ) received no more than four calls in their first 12 months of the program ( coberley et al . , 2007 ) . while periodic calls to participants have proven adequate to elicit improvements in screening rates ( coberley et al . , 2007 )\n, they are insufficient to pick up on signs that patients are at risk for a near - term emergency department visit or hospitalization .\nfurther , there is evidence to suggest that most clinical practice guidelines for chronic illnesses are not modified to consider the needs of older patients with multiple and complex comorbidities ( boyd et al . , 2005 ) .\nthus , it is possible that this emphasis on adherence to practice guidelines focuses on the wrong aspects of care for this population and may have a detrimental effect on outcomes .\nseveral interventions have been shown to be successful at reducing avoidable admissions , but they require a greater frequency of patient contact than is currently the norm .\nmost participants at highest risk of a near - term hospitalization need to be assessed daily .\none strategy is to use outbound calls conducted by individuals proficient in behavior change methodologies .\nremote telemonitoring ( rtm ) technology offers an alternative strategy for assessing patient status and is typically less costly than daily outbound calls . via rtm , the signs or symptoms of an impending acute exacerbation triggers an alert to a nurse who can respond immediately and triage the patient to the appropriate ambulatory care setting .\nfor example , daily monitoring of congestive heart failure patients catches symptoms including weight gain , lower extremity edema , and increasing dyspnea that are typically present in the 8 to 12 days prior to hospitalization ( schiff et al . ,\na recent systematic review of rtm reported that , in the majority of studies of chronic obstructive pulmonary disease and cardiac diseases , rtm led to significant decreases in hospitalizations , emergency department visits , and length of stay ; studies of diabetes and hypertension had mixed results ( pare , jaana , and sicotte , 2007 ) .\nhowever , rtm is expensive and , in diabetes , it is estimated to cost between $ 300 and $ 400 per patient per year when sponsored by a physician practice ( adler - milstein et al . , 2007 ) .\nother interventions shown to reduce near - term avoidable admissions include the provision of seasonal influenza vaccinations ( nichol , baken , and nelson , 1999 ) and a monthly pharmacist review of a patient 's medication profile ( hepler and strand , 1990 ) .\nthe latter may substantially reduce avoidable hospitalizations caused by drug - related problems such as untreated indications , use of the medication without indication , improper drug selection , subtherapeutic dosage , overdose , adverse re actions , interactions , and failure to receive the drug ( strand , morley , and cipolle , 1990 ) .\none of the biggest challenges in commercial dm is engaging physicians to support the program .\nthese programs have little ability to collaborate with physicians , many of whom are skeptical of dm initiatives and view them as disruptive to the physician - patient relationship ( leider , 1999 ) . without explicit endorsement from their physician\n, many patients will not enroll or adhere to the intervention provided by the dm program ( leider , 1999 ) .\nthis is problematic as physicians are well positioned to identify potential participants and persuade them to participate in a dm program .\nfurther , when physicians are actively involved in the intervention process , it is more likely that a dm program will be able to effectuate sufficient change in a patient 's clinical condition to avoid an acute exacerbation .\na recent article on the role of physicians in dm reports several barriers to physician engagement including a lack of financial incentive , a lack of technology to facilitate communication , and the need for a trusted practice - based program champion ( kuraitis , 2007 ) .\nleider ( 1999 ) suggests five core strategies to achieve physician buy - in for disease management programs . these include ( 1 ) educating physicians on the goals of the dm program , ( 2 ) identifying champions with positive views of the program , ( 3 ) setting clear goals and expectations for physicians who participate in the program , ( 4 ) demonstrating that a relatively easy program works before attempting a more complex or controversial program , and ( 5 ) sharing the gains by rewarding physicians for their time and effort supporting the program . while such strategies are likely to strengthen physician support of commercial dm , they raise the broader question of the appropriate role for each player in supporting chronic dm\nsome view commercial dm companies as filling a gap in our acute care focused delivery system that has consistently failed to deliver high - quality care to those with chronic illnesses . however , the flaws of a third - party work - around are evident in the increased fragmentation of care that results from a lack of coordination between dm vendors and traditional care delivery settings .\na compelling alternative is wagner 's chronic care model that includes a primary care - based medical home .\nproponents of this model believe that the primary care team is the entity best suited to deliver chronic care management ( geyman , 2007 ) . in this model\n, the primary care physician leads a team of specialists , nurses , dieticians , pharmacists , and health educators to provide and coordinate all the care for a chronically ill population .\nwith evidence of cost reduction and quality improvement from group health cooperative and kaiser permanente , primary case - based dm enjoys empirical support ( mcculloch et al . , 2000 ) .\nrecent pay - for - performance programs that attempt to align payment incentives with high - quality chronic care also reflect a belief that chronic care is the responsibility of physicians and the systems in which they operate ( rosenthal et al . , 2007 ) .\nthe current commercial dm model has shortcomings within each program component that severely limit the short - term medical cost savings that can be achieved . by relying on claims data\n, individuals at risk for a near - term hospitalization can not be accurately identified .\nbehavior change specialists and physicians are not actively engaged to support recruitment and intervention efforts .\nfinally , participants are contacted too infrequently to detect impending acute episodes . while there are few easy solutions to address the flaws in this model , there are several evidence - based changes that could be implemented to increase the likelihood of achieving short - term medical cost savings .\nthese include : ( 1 ) drawing on clinical data and health risk assessments for patient identification and risk stratification ; ( 2 ) using behavior change experts in conjunction with patient and physician incentives for enrollment , participation , and retention ; and ( 3 ) tailoring the intervention to the risk level of the participant with the participants at highest risk for a near - term admission receiving daily monitoring via rtm as well as monthly medication reviews , quarterly process reminders , and seasonal interventions .\nit is critical that changes be made to all dm program components as they are interdependent ; improving identification will only lead to medical cost savings if the enrollment process and interventions are properly designed .\nhowever , making the model more robust could substantially increase the cost of implementing the program , increasing the medical cost savings required to deliver net savings .\nplacing this discussion in the context of mhs , at the conclusion of phase i cms will have to determine whether to authorize a second phase .\nalong with an assessment of beneficiary and provider satisfaction , process improvements , and health outcomes , cms will assess the financial outcomes .\nthe results of a simple nnd calculation suggest that , on average , a dm vendor participating in the mhs demonstration would have to reduce all - cause hospitalizations by about 15 percent to break even on fees alone .\nif dm can only impact congestive heart failure and diabetes ( the primary and secondary conditions targeted by mhs ) , the percentage decrease in hospitalizations needed to achieve the cost savings target lies closer to the 82-percent reduction estimate .\nthe mhs interim report reflected few statistical or substantive differences in the rate of hospitalizations , 30-day readmissions , and emergency room visits between the intervention and control group after 6 months .\nthus , in light of the dm model flaws , achieving a 15-percent reduction in all - cause admissions or an 82-percent reduction in disease - specific admissions is unlikely for the current programs .\nif vendors implement the changes previously discussed , a sufficient reduction in hospitalizations may be achieved before the final mhs evaluation is conducted . however , this will require further investment in the interventions on top of the current monthly fees that range from $ 74 to $ 159 per beneficiary ( mccall , cromwell , and bernard , 2007 ) . thus the question remains as to whether commercial dm can achieve net cost savings in the chronically ill population .\nultimately cms will have to assess the potential for commercial dm to be more cost effective than alternative approaches currently under study in other demonstration projects in deciding how to proceed with managing the chronically ill .", "human": " interim results of the medicare health support ( mhs ) demonstration projects suggest that commercial disease management ( dm ) is unable to deliver short - term medical cost savings . \n this is not surprising given the current dm program focus on compliance with process measures that may only lead to cost savings in the long term . \n a program focused on reducing near - term hospitalizations is more likely to deliver savings during the initial 3-year phase of mhs . \n if the early trends in mhs are indicative of the final results , cms will face the decision of whether to abandon commercial dm in favor of other chronic care management strategies . \n this article supports the upcoming assessment by describing the characteristics of the current commercial dm model that limit its ability to deliver short - term medical cost savings and the changes required to overcome these limitations . ", "section_names": "Introduction\nMedical Cost Savings in DM Programs\nCurrent DM Model and Suggested Changes\nIdentification\nEnrollment\nIntervention\nPhysician Engagement\nImplications for Medicare Health Support", "bigbird_pegasus": "<s> as rising health care costs continue to draw attention, the rate of increase in medicare expenditures, which significantly exceeded those of the overall u.s. health care system, is of particular concern to policymakers.<n> the 2003 medicare modernization act included several demonstration projects to assess the various approaches and inform medicare's chronic disease management ( dm ) strategy. with many approaches to chronic dm and little agreement on the most effective approach, the 2003 medicare modernization act included several demonstration projects to assess the various approaches and inform medicare's chronic dm strategy.<n> the literature concludes that disease management programs can generally reduce the overall cost of health care services.<n> however, early results from the eight demonstration projects in which commercial vendors provide dm interventions to fee - for - service beneficiaries with chronic illnesses have not resulted in cost savings. to guide future decision making<n>, we outline a series of recommendations to improve the experimental dm programs.</s>", "longt5": "<pad> this article describes the characteristics of the commercial disease management ( dm ) model that limit its ability to achieve short - term medical cost savings and then discusses the changes required to overcome them. the commercial dm model has shortcomings within each program component that severely limit the short - term medical cost savings that can be achieved. by relying on claims data, individuals at risk for a near - term hospitalization can not be accurately identified. behavior change specialists and physicians are not actively engaged to support recruitment and intervention efforts. finally, participants are contacted too infrequently to detect impending acute episodes. while there are few easy solutions to address the flaws in this model, there are several evidence - based changes that could be implemented to increase the likelihood of achieving short - term medical cost savings. these include : ( 1 ) drawing on clinical data and health risk assessments for patient identification and risk stratification ; ( 2 ) using behavior change experts in conjunction with patient and physician incentives for enrollment, participation, and retention ; and ( 3 ) tailoring the intervention to the risk level of the participant with the participants at highest risk for a near - term admission receiving daily monitoring via remote telemonitoring as well as monthly medication reviews, quarterly process reminders, and seasonal interventions.</s>"}
{"article": "is cancelled because it emphasized on loading learner s accumulator minds and interrogating in tests as jean piaget said the main goal of education must be training of innovators who could think not to repeat .\nit is training of investigators and researchers not those who adopt whatever is said ( 1 ) .\nobviously , it is not possible to train new generation for the living in a changeable society for present and next days without new planning to change functions and works of education system including goals , contents , teaching and learning methods also evaluation and assessment methods ( 2 ) contemporary , in domain of training science , evaluation has received such an importance that identified as an independent and specialized scientific field . because of the importance of evaluation some specialists in domain of curriculum development like tiler presented it as a center of education process ( 3 ) .\nevaluation indicated as the last link for the  teaching - learning  process which is used in the end of educational period to separate students with different learning process .\nif it could present suitable information permanently through feedbacks to students , it would be more effective to improve learning .\nit is found that the educational and evaluation method could not be able to meet the needs of learning in many times during the process of english learning as a foreign language .\nmost of the approaches in secondary schools are theoretical ones , while using the teaching application and performance method many of the english concepts are more tangible and likable and english learning would be more profound and stable permanent ( 4 ) .\nlanguage educational specialists suggest that the best method in language learning is creating desired possibilities and training through different practices so that there would be a satisfied learning experience ( 5 ) . while the traditional evaluation method frequently aiming the lower classes of cognitive domain , the achievement evaluation of the student\nshould be composing of the test s results and the teacher s distinguishing of the student s educational state ( 6 ) . to achieve english learning goals ,\nthe authentic assessments could be a suitable alternative for usual and traditional assessments which are still using in these classes .\nin authentic assessments methods there are often real and natural situations to evaluate the performance of the learners assessed directly ( 7 ) .\nthere is not any research in our country related to the title of this study at the level of the university but similar studies have been done at the level of education .\nkhoramabadi ( 2008 ) in his doctoral on the subject of  the effect of applying traditional and alternative methods on achievement motivation , attitude and academic achievement of the students  observed the results including : students who their performance have been tested using alternative methods in comparison with those who are assessed by traditional ones , encounter more achievement motivation .\nthey have position attitude to school and get higher educational achievement in psychomotor and cognitive domain ( 8) . kowsari ( 2000 ) in a study entitled  survey of acquaintance amount and application of assessment methods through the student s learning by teachers of secondary schools  obtained the following results : the selection of aware and specialized persons in assessment as instructor in teacher training center and in - service periods  acquaintance of students with the topic of assessments , considering two types of scores that is theatrical , pragmatic and performing in assessment of student learning  appropriate more class hours and decrease the content of lesson books ( 9 ) .\nfirozfard and gholam nattaj ( 2006 ) in a research entitled :  how could we improve the teaching - learning process by using the new assessment approach ( process center and formative )  presented the following results : it represents a real , stable and profound learning new assessment approach- this plan gets more interest of students cooperation in teaching process and changes the traditional atmosphere of the class -it decrease the stress and agitation of the final test using different tools of new assessment approach and increase noticeable confidence of student in learning ( 10 ) .\nhopkins ( 1987 ) showed in a study that the more improvement and disputable matter in assessment is differences in level of instructor skills in using tools and methods .\nlack of acquaintance of instructors , effective tools and methods in formative assessment are the example of their weakness in evaluation ( 11 ) .\nlee ( 1994 ) surveyed research named  the effect of assessment approach on reported study strategy use  and found that the students tend to use different study strategies according to the type of given exam . the deep process strategies in his studies while surface strategies were correlated to paper- pencil test ( 12 ) .\nbrokhart and durkin ( 2003 ) , in a research named  classroom assessment , student motivation and achievement in high school  , showed that the type of assessment causes different perception of presented homework and different efficiency in students .\npolicy and validity prospect for performance- based assessment  showed that performance assessments encourage the divergent thinking and concentration on high level or complex skills , besides the knowledge application in concrete situations these methods provide the proper background to involve them with subjects individually or in group by encouraging students to find different solutions and consider special value for educational goals .\nthe general goal of present research is  the comparison of learning and memorization rate of english , based on authentic and traditional assessment  .\nthe main hypothesis : using authentic assessment approach is more effective than traditional assessment on the rate of students english learning and memorization ( 14 ) . \n\nhypothesis 1 : the rate of performance learning in authentic assessment is more than the traditional ones.hypothesis 2 : the rate of memorization in authentic methods is more than the traditional ones.hypothesis 3 : the rate of post - test scores is more in authentic assessment in comparison with traditional one.hypothesis 4 : the attitude toward test in authentic methods is more positive than the traditional ones . \n \nhypothesis 1 : the rate of performance learning in authentic assessment is more than the traditional ones .\nhypothesis 2 : the rate of memorization in authentic methods is more than the traditional ones . hypothesis 3 : the rate of post - test scores is more in authentic assessment in comparison with traditional one . hypothesis 4 : the attitude toward test in authentic methods is more positive than the traditional ones .\nthe research method is semi - experimental and the sample includes 60 students selected by simple random sampling .\nassessment devices used in the research were : 1-academic achievement pre - test of english .\n2-academic achievement post - test 3-revised questionnaire of attitude toward tests ( saas - r).4-english performance test before carrying the authentic and traditional assessment approaches into execution , two groups had been taken the scholar academic achievement pre - test in order to assure not to be any significant differences between two groups . after the execution of above mentioned method ( about 14 weeks ) , the academic achievement post - test , and performance test and attitude toward tests ( saas - r ) were performed . moreover , 2 months after post - test , it was replicated to measure the rate of memorization . in order to analyze data the statistical method , the dependent and independent t- tests were used to determine mean differences of two groups and k2 test was applied to assign the differences of two groups attitude toward tests .\nhypothesis 1 : the rate of students performance learning in authentic assessments is more than the traditional ones . as the calculated ( t=4/527 ) in confidence level of 99% ( a=0/01 ) and ( df=29 ) is more than tc(=2/756 ) , the null hypothesis is rejected and the research hypothesis is approved .\nit means that there is significant difference between the rate of students performance learning in authentic assessment and traditional assessment .\nthe mean of authentic assessment is bigger , so the rate of students performance learning in authentic assessment is more .\nt - test statistics to determine the discrepancy of performance learning in authentic & traditional assessment .\nhypothesis 2 : the rate of post - test scores is more in authentic assessment in comparison with traditional one  as the calculated ( t=1.29 ) in confidence level of % 95 ( a=0.05 ) and ( df=58 ) is less than tc ( = 2 ) , the null hypothesis is approved and alternative one is rejected .\nit implies that there was no significant difference between two groups post - test scores .\nt - test statistics to determine the discrepancy of post - scores in authentic & traditional assessment .\nhypothesis 3 : the rate of memorization in authentic methods is more than the traditional ones . because the calculated ( t=3.908 ) in confidence level of % 99 ( a=0.01 ) and ( df=29 ) is more than tc ( = 2.756 ) , the null hypothesis is rejected and alterative one is approved .\nit means that there is significant difference between the rate of english memorization in authentic and traditional methods .\nthe mean of authentic assessment is bigger , so the memorization rate of it is more .\nt - test statistics to determine the discrepancy of memorization in authentic & traditional assessment .\nhypothesis 4 : the attitude toward test in authentic methods is more positive than the traditional ones .\nk is used to inferential analysis of this hypothesis . as calculated k ( 566.66 ) in confidence level of 99% ( a=0.01 ) and ( df=3 ) is bigger than k of table ( = 11.345 ) , it implies that there is significant difference among the observed and expected frequencies statistically and the null hypothesis is rejected and research hypothesis is approved .\nit means that the students attitude toward test in authentic methods is more positive than the traditional ones\nhypothesis 1 : in order to determine this effect the rate of gained scores from students performance learning test were surveyed among two groups ( control and experimental groups ) .\nthe results imply that the rate of students performance learning in authentic methods are more in comparison to traditional assessments performance statistically .\nthese results are associated with the results of other researcher as lee ( 7 , 12 - 15 ) hypothesis2 : to determine this effect the student academic achievements in authentic groups were surveyed in comparison to traditional groups .\nthe gained results show that there is nt signification difference between the scores of two group in academic achievement test in cognitive domain .\nthese results are similar to other researchers findings as : ( 1 , 7 , 13 , 15 ) .\nhypothesis 3 : in the case of this hypothesis , the results imply that there is significant difference between the scores of two groups .\nhypothesis 4 : the mean of attitude scores of students included in authentic assessment group was surveyed in comparison to traditional assessment one .\nit means that the authentic assessment group has more positive attitude toward the tests and has higher perception of self - academic .\nthey evaluate the school goals more internalized and meet more self - regulation and motivation .\nthe results are similar to the findings of ( 13 , 14 , 17 , 18 ) .\nconsidering the results of this research , some suggestions are as follow : \n * most teachers are familiar with traditional assessments methods but they do nt have systematic and enough knowledge with authentic and new assessment methods .\nso it is suggested to be presented the teachers necessary awareness and knowledge about these kinds of assessments through the co - service courses.*it is suggested that the writers of english class books should concentrate on the materials that , firstly they are needed for real life and secondly they should be commensurable and able to evaluate directly though performance tests and other alternative methods.*noticing that assessment methods follow the assessments goals it is suggested to curriculum planners and teachers consider the assessments goals , the evaluated subject , the features of learners and other related consideration before using any assessment method.*as the teaching based on performance assessments is time - consuming , it is suggested to be considered more time during the course.*it is suggested to the teachers to use different kinds of assessment methods until the students can show their abilities better according to their personal features ( for example : cognitive styles).*it is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones , and not to limit their choices just to one of these methods .\nit would be better they consider the methods complementary that assess different educational goals . \n \nmost teachers are familiar with traditional assessments methods but they do nt have systematic and enough knowledge with authentic and new assessment methods .\nso it is suggested to be presented the teachers necessary awareness and knowledge about these kinds of assessments through the co - service courses .\nit is suggested that the writers of english class books should concentrate on the materials that , firstly they are needed for real life and secondly they should be commensurable and able to evaluate directly though performance tests and other alternative methods . noticing that assessment methods follow the assessments goals it is suggested to curriculum planners and teachers consider the assessments goals , the evaluated subject , the features of learners and other related consideration before using any assessment method . as the teaching based on performance assessments is time - consuming , it is suggested to be considered more time during the course .\nit is suggested to the teachers to use different kinds of assessment methods until the students can show their abilities better according to their personal features ( for example : cognitive styles ) . it is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones , and not to limit their choices just to one of these methods .", "human": " background : the aim of present study was to investigate the learning and memorization rate of english based on authentic and traditional assessment approaches in sari secondary schools.methods:it was performed in semi- experimental method . \n the sample included 60 first year high school male students , selected randomly . \n then it has been divided in two groups as experimental and control groups . \n assessment devices used in this research included : academic achievement pre - test of english , academic achievement post - test revised questionnaire of attitude toward tests ( saas - r ) , and english performance test before carrying the authentic and traditional assessment approaches into execution , two groups had been taken the scholar academic achievement pre - test in order to assure not to be any significant differences between two groups . \n after the execution of above mentioned method ( about 14 weeks ) , the academic achievement post - test , and performance test and attitude toward tests ( saas - r ) were performed . moreover , 2 months after post - test , it was repeated to measure the rate of memorization . in order to analyze data the statistical method , \n the dependent and independent t- tests were used to determine mean differences of two groups and k2 test was applied to assign the differences of two groups attitude toward tests.results:the results implied that : the rate of students performance learning in authentic assessments is more than the traditional ones.conclusion:there was no significant difference between two group s post - test scores . \n the rate of memorization in authentic methods is more than the traditional ones . \n the attitude toward tests in authentic methods is more positive than the traditional ones . ", "section_names": "1. INTRODUCTION\n2. MATERIALS AND METHODS\n3. RESULTS\n4. DISCUSSION AND CONCLUSION\n5. SUGGESTIONS", "bigbird_pegasus": "<s> background : secondary school and higher education evaluation and assessment are the last link for the teaching - learning process which is used in the end of educational period to separate students with different learning process. to achieve english learning goals, the authentic assessments could be a suitable alternative for usual and traditional assessments which are still using memorization in these classes.<n> the aim of this study was to investigate the effect of using authentic and traditional assessment methods on achievement motivation, attitude and academic achievement of the students.methods:this was an experimental study with a cross - sectional design.<n> the statistical population included all students of seyyed - al - shohada university of medical sciences.<n> the sample size was 100 which consisted of 50 male and 50 female students with the mean age of 16.65 years.<n> students were evaluated by using authentic and traditional methods.<n> the students academic achievement was evaluated by using authentic and traditional assessment methods.<n> the data were analyzed by spss software version 16.<n> descriptive statistics and chi - square test were used to analyze the data.results:the findings showed that the rate of students academic achievement post - test in the two groups was significantly different ( p<unk>0.001 ).<n> there was no significant difference between the rate of post - test scores in the two groups ( control and experimental groups).conclusion : the rate of students academic achievement post - test in the rate of students post - post - test.<n> the rate of post - post - post - post - post - post - test.<n> the students.<n> the students.<n> the students.<n> the students.<n> the students.<n> the students.<n><n><n><n> the students.<n>.<n>.<n>....<n>...<n>.<n>.....<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>....<n>.<n>..<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>", "longt5": "<pad> background : evaluation indicated as the last link for the teaching - learning process which is used in the end of educational period to separate students with different learning process. if it could present suitable information permanently through feedbacks to students, it would be more effective to improve learning.objectives:the general goal of present research is the comparison of learning and memorization rate of english, based on authentic and traditional assessment.materials and methods : the research method is semi - experimental and the sample includes 60 students selected by simple random sampling. assessment devices used in the research were : 1academic achievement pre - test of english ; 2academic achievement post - test 3-revised questionnaire of attitude toward tests ( saas - r).results : the rate of students performance learning in authentic assessments is more than the traditional ones. the rate of memorization in authentic methods is more than the traditional ones. the rate of memorization in authentic methods is more than the traditional ones.conclusion:it is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones, and not to limit their choices just to one of these methods. it is suggested to curriculum planners and teachers not to consider the authentic assessments in contrast to traditional ones, and not to limit their choices just to one of these methods.</s>"}
{"article": "breast cancer is the most common malignancy in women and number one cause of death in women between the ages of 45 and 55 in the united states .\nalthough metastatic disease , considered incurable , is rarely seen at the time of initial diagnosis , approximately 20% of women with operable breast cancer eventually relapse , with about 70% of the relapses as distant metastases [ 25 ] .\napproximately 80% of women with metastatic breast cancer have skeletal metastases , which are often the result of bone marrow infiltration of malignant cells with subsequent progression and invasion of the skeletal cortex [ 69 ] .\nthe most common complications of skeletal metastases are pathologic fractures , spinal cord compression as the result of vertebral compression fracture or extension of the tumor beyond the epidural space , and hypercalcemia [ 79 ] .\nfurthermore , skeletal metastases sometimes require surgery or radiation therapy to treat pain or an impending fracture .\nbone marrow metastases result in the invasion and destruction of the bone tissue matrix by tumor cells .\nalthough bone marrow infiltration by metastases is commonly present among breast cancer patients , total bone marrow infiltration resulting in profound pancytopenia is extremely rare .\na 62 year - old female presented with increased fatigue that was interfering with her activities of daily living .\nher breast exam was notable for a fixed , 1 cm left axillary lymph node .\nher white blood cell ( wbc ) count was 3.2 k/l , hemoglobin ( hgb ) was 6.8 g / dl , and platelet count was 3 k/l .\nmultiple imaging studies , including computed tomography ( ct ) of the chest , abdomen and pelvis , as well as a bone scintography were completed as part of the initial diagnostic work up .\nthe bone scintography scan showed diffuse skeletal metastatic disease involving multiple vertebrae and the pelvis .\na mammogram had also been performed and showed an irregular spiculated nodule in the upper inner left breast .\nthe patient subsequently underwent a core needle biopsy of an enlarged left axillary lymph node .\nthe biopsy revealed a metastatic lobular carcinoma strongly positive for both estrogen and progesterone receptors ( er and pr ) and negative for her2 and e - cadherin by immunohistochemical staining . to further evaluate the patient s profound pancytopenia , which required frequent transfusion of packed red blood cells ( prbc ) and platelets , the patient underwent a bone marrow biopsy .\nthe pathology showed that the metastatic carcinoma had entirely replaced the bone marrow ( figure 1 ) .\nthe tumor cells were positive by immunohistochemical staining for cytokeratin ae1/ae3 , er and pr , but were negative for her2 , consistent with metastatic breast cancer .\nafter much discussion of the risks and benefits of therapy in view of profound pancytopenia , the patient initiated systemic therapy with doxorubicin administered as a continuous three day infusion ( 20 mg / m / day ) on a 21 day cycle in the inpatient setting .\na continuous infusion of doxorubicin was selected based on small , prior studies suggesting that acute and chronic toxicities , including bone marrow suppression , may be lessened when doxorubicin is administered as a continuous versus bolus infusion [ 1113 ] .\nthe doxorubicin dose was reduced by 50% due to increased transaminases that normalized with subsequent cycles of therapy .\nthe second cycle was given at full dose , but was complicated by febrile neutropenia requiring hospitalization .\nafter 3 cycles of therapy , continuous doxorubicin was switched to monthly liposomal doxorubicin ( 40 mg / m ) for ease of administration in the outpatient setting since the patient s platelets had sufficiently recovered . as shown in figure 2 ,\napproximately four months after commencing treatment , her wbc rose to 5.4 k/l , hgb increased to 11.6 g / dl and platelet count improved to 131 k/l .\napproximately thirteen months after beginning the treatment , the patient experienced a near full recovery from her pancytopenia with no evidence of anemia or thrombocytopenia .\nher laboratory tests showed wbc of 4.8 k/ , rbc of 4.00 m/l , hgb of 12.8 g / dl and platelet count of 160 k/l at that time , indicating a remarkable response to treatment ( figure 2 ) .\nafter four cycles of liposomal doxorubicin , the patient was transitioned to endocrine therapy with an aromatase inhibitor , letrozole .\nher laboratory profile remained stable 43 months after initiation of continuous doxorubicin . in her last 12 months of life , her disease progressed in the liver , bone , orbit and brain .\nshe was treated with radiation to the orbital metastasis and brain metastases , but declined further systemic chemotherapy . in her last month of life , her platelets dropped to 15 with normal white blood count and hemoglobin levels .\nshe ultimately died from complications of metastatic breast cancer 44 months after her initial diagnosis .\n. however , bone marrow failure as the herald of this disease is not typically seen .\nvery limited data exists as to the safest and most efficacious manner to treat patients with profound pancytopenia due to metastatic solid tumor involvement . in this case , the patient s thrombocytopenia was particularly worrisome , requiring daily platelet transfusions .\nthere was also concern that cytotoxic chemotherapy would exacerbate the patient s thrombocytopenia and increase bleeding risk .\nthe patient s dramatic response to chemotherapy with full platelet recovery is also highly unusual . for our patient , continuous doxorubicin successfully  unpacked  the bone marrow despite a low baseline platelet level , and without increasing the need for more frequent platelet transfusion or risk of catastrophic bleeding . given the rarity of this presentation , it is currently unknown if the majority of similar patients experience near full recovery of hematopoietic function after initiation of appropriate systemic treatment for metastatic disease .\npancytopenia is not a common presentation in patients with metastatic breast cancer . in several studies ,\npancytopenia was noted as the consequence of adjuvant chemotherapy with alkylating agents and topoisomerase ii inhibitors rather than metastatic disease .\nsome have suggested that the use of growth factor support such as filgrastim or peg - filgrastim may also contribute to the risk of developing pancytopenia related to myelodysplastic syndrome or acute myeloid leukemia , although that association has not been completely established .\nsaito et al . reported on a metastatic breast cancer patient with pancytopenia who had evidence of concurrent therapy - related acute myeloid leukemia and bone marrow metastasis . in our case ,\nthis has rarely been described in the literature and includes both patients with both positive and negative outcomes from therapy . several reports highlight patients who have responded to systemic therapy including low dose capecitabine , endocrine therapy and trastuzumab monotherapy [ 2832 ] .\n. reported on a case of a patient with bone marrow metastasis from breast cancer .\nthe patient developed pancytopenia with disseminated intravascular coagulation ( dic ) and was given weekly paclitaxel therapy with blood transfusion and g - csf injections .\ntherapy was ineffective and the patient died of gastrointestinal hemorrhage due to complications of pancytopenia that were likely caused by dic and metastatic disease .\nour patient experienced similar bone marrow metastasis and pancytopenia , but was able to achieve sustained disease control through doxorubicin chemotherapy followed by aromatase inhibitor therapy , without bleeding complications .\nin addition , laboratory tests at the time of diagnosis did not show any evidence of dic in our case .\nin addition to continuous doxorubicin , our patient received zoledronic acid as a part of management of osseous metastasis from breast cancer .\nmany studies have focused on the prevention of breast cancer due to subclinical bone marrow metastasis caused by dormant disseminated tumor cells ( dtcs ) in the bone marrow [ 1921 ] .\nalthough dtcs appear to be associated with a higher risk of distant recurrence , they are not known to cause abnormalities in peripheral blood laboratory tests .\nsolomayer et al . demonstrated the impact of zoledronic acid on dtcs in primary breast cancer patients .\nthe authors found that dtc - positive patients treated with zoledronic acid were more likely to become dtc - negative following a 12 month treatment interval and concluded that treatment with zoledronic acid improved the elimination of dtcs .\nthe role of bisphosphonates in preventing skeletal metastases in patients with high risk early stage breast cancer is controversial [ 20,2327 ] .\nthe contribution of zoledronic acid in bone marrow recovery in this instance is not known .\nbreast cancer has a tendency to metastasize to the bone marrow , but does not commonly cause bone marrow failure .\nthe case presented describes a patient who developed complete bone marrow infiltration by estrogen receptor positive metastatic breast cancer that led to transfusion dependent pancytopenia .\nthe patient received treatment with continuous doxorubicin and zoledronic acid followed by endocrine therapy , which resulted in complete recovery of normal bone marrow function for 3 years .\ndrug therapy is a consideration in patients with bone marrow infiltration with good performance status .", "human": " complete bone marrow infiltration with profound pancytopenia is very uncommon in breast cancer . \n bone marrow metastasis can frequently occur following development of metastatic breast cancer \n . however , bone marrow failure as the herald of this disease is not typically seen . \n very limited data exists as to the safest and most efficacious manner to treat patients with profound pancytopenia due to metastatic solid tumor involvement . in this case , the patient s thrombocytopenia was particularly worrisome , requiring daily platelet transfusions . \n there was also concern that cytotoxic chemotherapy would exacerbate the patient s thrombocytopenia and increase bleeding risk . \n the patient s dramatic response to chemotherapy with full platelet recovery is also highly unusual . for our patient , continuous doxorubicin successfully  unpacked  the bone marrow despite a low baseline platelet level , and without increasing the need for more frequent platelet transfusion or risk of catastrophic bleeding . given the rarity of this presentation , it is currently unknown if the majority of similar patients experience near full recovery of hematopoietic function after initiation of appropriate systemic treatment for metastatic disease . ", "section_names": "1. Introduction\n2. Case report\n3. Discussion\n4. Conclusion", "bigbird_pegasus": "<s> approximately 80% of women with metastatic breast cancer have skeletal metastases, which are often the result of bone marrow infiltration of malignant cells with subsequent progression and invasion of the skeletal cortex.<n> bone marrow metastases result in the invasion and destruction of the bone tissue matrix by tumor cells. although bone marrow infiltration by metastases is commonly present among breast cancer patients, total bone marrow infiltration resulting in profound pancytopenia is extremely rare. a 62 year - old female presented with increased fatigue that was interfering with her activities of daily living. her breast exam was notable for a fixed, 1 cm left axillary lymph node.<n> her breast exam was notable for a fixed, 1 cm left axillary lymph node. her white blood cell ( wbc ) count was 3.2 k/l, hemoglobin ( hgb ) was 6.8 g / dl, and platelet count was 3 k/l.<n> a bone scintography scan showed diffuse skeletal metastatic disease involving multiple vertebrae and the pelvis.<n> a core needle biopsy of an enlarged left axillary lymph node revealed a metastatic lobular carcinoma strongly positive for both estrogen and progesterone receptors and negative for her2 and e - cadherin by immunohistochemical staining. to further evaluate the patient s profound pancytopenia, which required frequent transfusion of packed red blood cells ( prbc ) and platelets, the patient underwent a bone marrow biopsy.<n> the patient experienced a near full recovery of pancycytopenia.<n> the patient...<n> the patient.<n> the patient.<n> the patient s thrombocycycycycycycycycycycytop.<n>.<n>.<n>.<n>.<n> pcycycycycycycycycycycycycycycycycycycycycycycycycycycycycy.<n> pancy.<n> pcycycycycycycycycycycycycycycycycycycycycycycycycycy.<n> pcycycycycy.<n><n><n><n><n><n><n><n>.<n>.<n>.<n>.<n>.<n><n><n>.<n><n><n><n><n><n><n>.<n>.<n>.<n>.<n>.<n><n>.<n>.<n><n>.<n><n>.<n><n>.<n>.<n>", "longt5": "<pad> breast cancer has a tendency to metastasize to the bone marrow, but does not commonly cause bone marrow failure. the case presented describes a patient who developed complete bone marrow infiltration by estrogen receptor positive metastatic breast cancer that led to transfusion dependent pancytopenia. the patient received treatment with continuous doxorubicin and zoledronic acid followed by endocrine therapy, which resulted in complete recovery of normal bone marrow function for 3 years. drug therapy is a consideration in patients with bone marrow infiltration with good performance status.</s>"}
{"article": "moderate to severe gastroesophageal reflux in neonates and infants is often a complex interaction of developmental and anatomic conditions that limits adequate enteral intake and may be associated with significant morbidity .\ncommon comorbidities in infants with gastroesophageal reflux include failure to thrive , prematurity , neurological impairment , and chronic respiratory conditions , all of which can be exacerbated by anatomic anomalies that further predispose to the development or progression of gastroesophageal reflux .\nalthough a laparotomy will often correct a congenital or acquired anatomic anomaly , the surgical adhesions that form as a result of a laparotomy may complicate subsequent surgical therapy for gastroesophageal reflux .\nmany studies document the safety and long - term efficacy of laparoscopic nissen fundoplication for the treatment of gastroesophageal reflux in infants and children .\nthe laparoscopic approach is feasible as a primary procedure and a secondary procedure after failure of a previous open or laparoscopic reflux operation .\nhowever , few studies have examined the efficacy of laparoscopic nissen fundoplication in infants and children after previous laparotomy for diseases or problems unrelated to reflux .\nthe purpose of this study is to examine our experience with open and laparoscopic nissen fundoplication in a population of infants with a history of previous neonatal laparotomy for diseases unrelated to gastroesophageal reflux .\nan institutional review board - approved retrospective review ( irb # 05091500 ) of our surgical procedure database at the children 's hospital of pittsburgh was conducted to identify all infants with a history of neonatal laparotomy who subsequently required surgical therapy for gastroesophageal reflux .\nstudy dates were january 1 , 2000 through september 1 , 2005 . during the period reviewed ,\n32 infants were identified with a history of neonatal laparotomy and subsequent surgical correction of gastroesophageal reflux .\nonly infants requiring surgical correction of reflux within the first year of life , and therefore less than 12 months after neonatal laparotomy , were included in this study .\nthis 12-month time frame was selected because we specifically chose to evaluate infants , and it represented a more homogeneous subset of patients when comparing laparoscopic nissen fundoplication ( lnf ) and open nissen fundoplication ( onf ) groups .\nthe 6 excluded patients were all older than 12 months at the time of nissen fundoplication ( 3 in each group , age range 2 to 15 years old ) .\nthese 26 infants underwent laparotomy during the neonatal period for multiple different diagnoses including intestinal atresia ( duodenal , jejunal and ileal ) ; necrotizing enterocolitis ; meconium ileus ; gastroschisis ; omphalocele ; malrotation ; congenital diaphragmatic hernia and imperforate anus .\ntwelve infants underwent lnf and 14 infants underwent onf , thereby forming the 2 study groups .\ngastroesophageal reflux was identified clinically , radiographically , or with both methods , and the infants underwent surgical correction of the reflux at the discretion of the attending surgeon .\nall infants had either a barium esophagram or a nuclear gastric emptying scan , which documented gastroesophageal reflux before anti - reflux surgery .\na nissen fundoplication was performed in all cases either open or laparoscopically by dividing the short - gastric vessels and creating a 360-degree wrap of the fundus around the esophagus .\nten of 12 infants in the lnf group had concomitant feeding gastrostomy tubes placed laparoscopically .\ntwo infants in the lnf group already had gastrostomy tubes in place at the time of fundoplication , both of which were placed by the open method , one on the first day ( duodenal atresia ) and the other at one month of age ( jejunal atresia ) .\nin the first infant , the tube was taken down laparoscopically at the time of fundoplication and replaced in a new position on the gastric wall to accomplish the wrap . in the second infant ,\nthirteen of 14 infants in the onf group had a feeding gastrostomy tube placed at the time of fundoplication with 3 of these infants having relocation of an existing gastrostomy tube .\noutcome variables included age at initial laparotomy , number of previous laparotomies before surgical correction of the gastroesophageal reflux , age at the time of fundoplication , weight at the time of fundoplication , operative time for fundoplication , length of stay , and time to resumption of enteral feeds after fundoplication , recurrence of gastroesophageal re - flux , and mean follow - up duration . in general ,\ninfants with these neonatal diagnoses , with or without antireflux surgery , are followed for a minimum of 5 years by our group .\nof the 26 infants identified with a history of neonatal laparotomy and subsequent surgical correction of gastroesophageal reflux within 12 months of life , 12 infants underwent laparoscopic nissen fundoplication ( lnf ) , and 14 infants underwent open nissen fundoplication ( onf ) . in the lnf group , diagnoses included 4 neonates with gastroschisis , 3 neonates with intestinal atresia ( 1 duodenal , 1 ileal , 1 jejunal ) , 2 neonates with meconium ileus ( both underwent ileostomy and mucus fistula at day of life # 1 with re - anastomosis at 2 to 3 months of age ) , and 1 each with omphalocele , malrotation , and perforated necrotizing enterocolitis . in the onf group , diagnoses included 4 neonates with congenital diaphragmatic hernia ( all left - sided , repaired by laparotomy ) , 4 neonates with gastroschisis , 2 neonates with perforated necrotizing enterocolitis , 2 neonates with imperforate anus / tracheoesophageal fistula , 1 infant with omphalocele , and 1 infant with intestinal atresia . in the lnf group , 4 infants had intestinal stomas performed at initial operation with subsequent closure before fundoplication . in the onf group , 3 infants had stomas created at initial laparotomy and subsequent takedown before fundoplication .\nthere was no difference between the 2 groups relative to age at the time of initial laparotomy ( 1 day of life for lnf vs 14 days of life for onf , p=0.08 ) .\nwhat may appear as a large difference in days of life at initial operation may be accounted for by the fact that 2 patients in the onf group had initial laparotomies at ages 51 days ( ileostomy/ mucus fistula for perforated nec in ex-25 week gestation infant ) and 90 days ( duodenoduodenostomy for duodenal atresia in 1.5-kg infant born at 800 g ) .\nthere was no difference in age at the time of the fundoplication ( 5.5 months for lnf vs 6.6 months for onf , p=0.57 ) , nor was there any difference between the 2 groups with respect to infants ' weight at the time of the fundoplication ( 5.2 kg lnf vs 5.7 kg onf , p=0.51 ) .\nthe number of previous laparotomies prior to fundoplication was similar in each group ( 1.7 laparotomies for lnf vs 1.9 laparotomies for onf , p=0.36 ) .\nadditionally , operative time was comparable between the groups with an average operative time of 131 minutes in the lnf group ( range , 77 to 190 ) and 164 minutes in the onf group ( range , 100 to 287 ) ( p=0.10 ) .\ninfants undergoing lnf did resume enteral feeds earlier than those undergoing onf ( 3.0 days lnf vs 6.3 days onf , p=0.01 ) .\nthe length of stay after fundoplication was actually shorter in the lnf group ( 14 days lnf vs 26 days onf , p=0.13 ) , but this did not reach statistical significance .\nall infants in both groups progressed to tolerate full oral , gastrostomy , or both , feeds with appropriate weight gain during follow - up periods .\nsubjectively , no infants in either group developed recurrent gastroesophageal reflux or wrap failure during an average follow - up period of 22 months ( range , 1 to 54 ) .\nfollow - up length of time for the lnf group was not different from that in the onf group ( 1 to 28 months versus 1 to 54 months , respectively , p = ns ) .\nhowever , routine monitoring for recurrent reflux is not done at our institution unless an infant develops feeding intolerance after fundoplication .\nour results suggest that laparoscopic nissen fundoplication ( lnf ) is at least as safe and effective as open nissen fundoplication ( onf ) in the surgical treatment of gastroesophageal reflux in a population of infants with a history of a neonatal laparotomy .\nadditionally , lnf appears to have a distinct advantage by allowing an early resumption of full enteral feeds after nissen fundoplication .\nall of the infants in this study required an operation in the neonatal period for surgical diseases unrelated to gastroesophageal reflux .\nboth the onf and the lnf groups included infants with a variety of neonatal surgical diseases , many of which predispose to the subsequent development of gastroesophageal reflux .\nspecifically , there is a well - documented increase in the incidence of gastroesophageal reflux in neonates with a history of gastroschisis , congenital diaphragmatic hernia , and omphalocele .\nthe risk for the development of gastroesophageal reflux in these infants is theorized to be secondary to defects of bowel motility , increased abdominal pressure , and gastroesophageal junction anatomical anomalies .\nat least half of the infants in both the onf and lnf groups had a variety of abdominal wall and diaphragmatic defects .\nthere have been few studies in infants and children that address the safety and efficacy of laparoscopic nissen fundoplication for the treatment of gastroesophageal re - flux in children with previous abdominal surgery .\nbest studied is the role of laparoscopic nissen fundoplication for recurrent gastroesophageal reflux after either an open or laparoscopic primary fundoplication .\nrothenbergs has one of the largest series of laparoscopic redo nissen fundoplications with 118 patients ages 6 months to 19 years . in this study , redo laparoscopic nissen fundoplication was safe and efficacious in these infants , children , and adolescents .\nother authors have also documented the safety and efficacy of laparoscopic redo nissen fundoplications in infants and children of a variety of ages .\nhowever , fewer studies have examined the role of laparoscopic nissen fundoplication after neonatal laparotomy for diseases unrelated to gastroesophageal reflux . in a study by liu et al\n, the authors concluded that laparoscopic nissen fundoplication was feasible and safe in a population of children with previous ventriculoperitoneal shunt placement , gastrostomy placement , or both .\nsimilarly , lintula et al15 concluded that a pre - existing gastrostomy tube did not preclude a safe and effective laparoscopic nissen fundoplication in children .\nvan der zee et al both documented the technical feasibility and safety of nissen fundoplication in children with a pre - existing gastrostomy tube .\nalthough these studies do examine redo laparoscopic surgery , none of these studies have examined the role of a laparotomy for primary neonatal surgical disease pre - existing the development of gastroesophageal reflux .\nthere are distinct nuances in achieving safe minimally invasive access in infants after neonatal laparotomy . for infants with abdominal wall defects\n( eg , gastroschisis and omphalocele ) , the umbilicus is avoided because the majority of these infants have dense adhesions in this area from prior repair . in our study , initial access for these patients was achieved through a left upper quadrant cut down approach with a 4-mm port . in patients with congenital diaphragmatic hernia and intestinal atresia , adhesions from a prior laparotomy\nthus , access via the umbilicus was attempted and successful for these patients . for some patients ,\nextended operative times were due to optimizing port placement and extensive adhesiolysis to complete a laparoscopic nissen fundoplication .\nunfortunately , the actual times for this aspect of the study operations were not recorded separately , and therefore , we are unable to determine the exact time for doing the fundoplication portion of the operation . beyond the technical feasibility of a laparoscopic nissen fundoplication at any time point after a neonatal laparotomy\n, our study also highlights the feasibility of a laparoscopic nissen fundoplication in a group of very small infants .\nspecifically , all of the infants in the lnf group underwent fundoplication at an average weight of 5.2 kg ( range , 2.7 to 8.8 ) .\nthese infants were , on average , smaller than the infants and children in the largest series of redo laparoscopic nissen fundoplication , in which the lowest documented weight was 6.4 kg .\nhowever , we are not aware of any studies that have examined weight as a selection criterion for redo laparoscopic nissen fundoplication .\nthe study dates include a period of transition in our institution with respect to surgical approaches to gastroesophageal reflux . in 2001 ,\nan experienced laparoscopic surgeon joined the surgical group , resulting in a gradual conversion over to advanced laparoscopic approaches to historically open surgical diseases .\nthe number as well as the approach for surgical anti - reflux operations at our institution increased and changed over the time period of this study from 41 in 2000 ( 37 onf ; 4 lnf ) to 122 in 2005 ( 118 lnf ; 4 onf ) .\nas advanced laparoscopic skills have developed in the group , the operative times for primary lnf have ranged from 45 minutes to 135 minutes , depending on staff and resident trainee experience .\nmore surgeons will now consider primary laparoscopic nissen fundoplication , even in the face of previous abdominal surgery .\nwe intend to review our experience for all anti - reflux operations in the neonatal age group or in infants under 7 kg to determine the outcomes and benefits of such an approach in this patient population .\ncurrently , a primary laparoscopic approach is our preferred approach to gastroesophageal reflux , regardless of the history of previous operations .\noutcomes following laparoscopic or open nissen fundoplication performed in infants after a neonatal laparotomy are similar .\nhowever , a laparoscopic fundoplication did allow for earlier return to enteral feeds compared with the open approach and tends toward shorter hospital length of stay .\ntherefore , we conclude that laparoscopic nissen fundoplication is technically feasible , safe , and effective in the treatment of gastroesophageal reflux in infants with a previous neonatal laparotomy .", "human": " background : nissen fundoplication is an effective treatment of gastroesophageal reflux in infants . \n laparoscopic procedures after previous laparotomy are technically more challenging . \n the role of laparoscopic nissen fundoplication after neonatal laparotomy for diseases unrelated to reflux is poorly described.methods:this was a retrospective review of open vs laparoscopic nissen fundoplication in infants after neonatal laparotomy . of 32 infants who underwent neonatal laparotomy , \n 26 required a surgical antireflux operation within the first year of life . \n twelve infants underwent laparoscopic nissen fundoplication versus 14 infants who underwent open nissen fundoplication . \n parameters like age , weight , operative time , number of previous operations , length of stay following fundoplication , time to feedings , and complications were compared between the 2 groups.results:no statistically significant differences existed between most of the parameters compared following laparoscopic vs open nissen fundoplication . \n no conversions to open procedures were necessary in infants undergoing laparoscopic fundoplication , and these infants resumed enteral feeds earlier than those who underwent the open procedure.conclusion:laparoscopic compared with open nissen fundoplication performed in infants after a neonatal laparotomy were comparable procedures across most data points studied . \n however , a laparoscopic fundoplication did allow for earlier return to enteral feeds compared with the open approach . \n laparoscopic nissen fundoplication is technically feasible , safe , and effective in the treatment of gastroesophageal reflux in infants with a previous neonatal laparotomy . ", "section_names": "INTRODUCTION\nMETHODS\nRESULTS\nDISCUSSION\nCONCLUSION", "bigbird_pegasus": "<s> background and objectives : this study examines our experience with open and laparoscopic nissen fundoplication in infants after previous neonatal laparotomy for diseases unrelated to gastroesophageal reflux.methods:an institutional review board - approved retrospective review ( irb # 05091500 ) of our surgical procedure database was conducted to identify all infants with a history of neonatal laparotomy who subsequently required surgical therapy for gastroesophageal reflux.<n> study dates were january 1, 2000 through september 1, 2005.<n> only infants requiring surgical correction of reflux within the first year of life, and therefore less than 12 months after neonatal laparotomy, were included in this study.<n> this 12-month time frame was selected because we specifically chose to evaluate infants, and it represented a more homogeneous subset of patients when comparing laparoscopic nissen fundoplication ( lnf ) and open nissen fundoplication ( onf ) groups.results:twenty-six infants were identified.<n> these 26 infants underwent lnf and 14 underwent onf, thereby forming the 2 study groups.<n> no patients were lost to follow - up.<n> of the 26 infants with a history of previous laparotomy, 13 of 14 infants in the onf group had a feeding gastrostomy tube placed at the time of fundoplication, age at the time of fundoplication.<n> the number of previous laparotomies before surgical correction of gastroesophageal reflux.<n> the number of a number of gastroesophageal re - gastroesophageal reflux. gastroesophageal reflux.<n> the number of gastroesophageal reflux.<n> the number of gastroesophageal reflux..<n><n>.<n> the number of a.<n><n>.<n>.<n>.<n> gastroesophageal reflux.....<n>.<n><n>.<n><n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>.<n>..<n><n><n><n><n><n><n><n><n>.<n> patients of the patients of the patients of the patients of the patients of the patients of the patients of the patients of the patients of the patients of the patients of the patients", "longt5": "<pad> objectivethe aim of this study is to examine our experience with open and laparoscopic nissen fundoplication in a population of infants with a history of previous neonatal laparotomy for diseases unrelated to gastroesophageal reflux.methodsa institutional review board - approved retrospective review of our surgical procedure database at the children's hospital of pittsburgh was conducted to identify all infants with a history of neonatal laparotomy who subsequently required surgical therapy for gastroesophageal reflux. study dates were january 1, 2000 through september 1, 2005. during the period reviewed, 32 infants were identified with a history of neonatal laparotomy and subsequent surgical correction of gastroesophageal reflux. twelve infants underwent laparoscopic nissen fundoplication ( lnf ) and 14 infants underwent open nissen fundoplication ( onf ). outcome variables included age at initial laparotomy, number of previous laparotomies before surgical correction of gastroesophageal reflux, age at the time of fundoplication, weight at the time of fundoplication, operative time for fundoplication, length of stay, and time to resumption of enteral feeds after fundoplication, recurrence of gastroesophageal re - flux, and mean follow - up duration.resultsof the 26 infants identified with a history of neonatal laparotomy and subsequent surgical correction of gastroesophageal reflux within 12 months of life, 12 infants underwent laparoscopic nissen fundoplication ( lnf ), and 14 infants underwent open nissen fundoplication ( onf ). there was no difference in age at the time of fundoplication ( 1 day of life for lnf vs 14 days of life for onf, p=0.57 ), nor was there any difference between the 2 groups respect to infants'weight at the time of fundoplication ( 5.2 kg lnf vs 5.7 kg onf, p=0.51"}
{"article": "cutaneous amyloidosis were classified into primary cutaneous amyloidosis ( pca ) , secondary cutaneous amyloidosis , and systemic cutaneous amyloidosis .\npca is a rare , chronic progressive skin disease , defined as deposition of amyloid in previously apparent normal skin without systemic involvement .\nits prevalence were rarely reported . until now , there are fewer than 40 published cases worldwide .\netiological factors associated with pca is still unknown , but its striking familial occurence suggests the role of genetic .\nwe report a case with peculiar mottled pigmentation originally referred for vitiligo , but later proved as acd by histopathological examination .\nthe disorder was thought to be familial as his siblings were affected with the similar condition .\na 12-year - old boy presented with asymptomatic , generalized mottled hypo- and hyper - pigmented lesions of 6-year duration .\nthe hypopigmented macules were first noticed on his lower extremities and had been slowly progressing to involve almost the entire body ( figure 1a ) .\nhe did not have any history of systemic or cutaneous disease before the onset of the lesions .\nhistory of trauma , rubbing of the skin with any material , and extensive sun exposure was denied .\nhis 11-year - old sister and 6-year - old brother experienced similar yet milder symptoms .\nphysical examination revealed an extensive , discrete , pigmented macules distributed nearly all over the body in symmetrical pattern .\nhe was referred to our hospital for skin biopsy with the initial differential diagnoses of vitiligo and pityriasis alba .\nhistopathological examination ( figure 2 ) showed uneven distribution of melanin in the epidermis and deposits of pale pink amorphous material in the papillary dermis .\nbased on clinical presentation and the histopathology examination , we made the diagnosis of primary cutaneous amyloidosis , presented as amyloid cutis dyschromica .\nthe patient was treated with oral acitretin 25 mg per day . by the third month\n, some improvement was observed as the pigmented macules were slightly lightened ( figure 1b ) .\nthe patient could tolerate the treatment , as there was no significant increase of transaminases and the lipid profile .\nthe diagnosis of acd in our patient was not readily recognized as it mimicked , to some degree , other relatively common disorders with pigmentation feature .\nthat , combined with its low prevalence , had eluded previous attempts at the correct diagnosis and treatment .\nthe peculiar asymptomatic mottled pigmentation is much likely seen in poikiloderma , but as our case showed , without the corresponding signs such as telangiectasia or atrophy . furthermore , our patient was otherwise healthy , showing no signs that might indicate systemic disorders or photosensitivity , e.g. dermatomyositis , lupus erythematosus , or xeroderma pigmentosum .\nas defined by morishima , acd characterized by diffuse speckled hyperpigmentation with hypopigmented spots without papulation , atrophy , and telagiectasia , mild or no itching , onset before puberty , and focal amyloid deposition in the papillary dermis .\nduh begins in infancy or childhood , and unlike acropigmentation of dohi , might encompass the whole skin surface with exception of face . for definite diagnosis , histopathologic examination should be shought .\nthe most common epidermal findings of pca were hyperkeratosis , irregular acanthosis with thinning of rete ridges , and expansion of dermal papillae by amyloid deposition .\nthe finding of amyloid bodies in the papillary dermis was crucial in establishing the diagnosis of acd in our patient and disproved duh , in which such deposition was absent .\nits visualization under polarized light , showing apple - green birefrigence , confirmed the presence of amyloid .\nspecial histochemical stains were helpful for confirming the existence of amyloid . in our case ,\nwe tried to obtain histopathological examination of the siblings , but the parents denied the request to perform biopsy on the grounds that their clinical appearances were quite similar that the histopathological findings would likely be the same .\nmultiple factors such as race , genetic , and enviromental may play collective roles , making variable degrees of cutaneous amyloidosis .\nalthough most cases of acd were sporadic , many have also reported positive family history of pca , suggesting that the important role of genetic factors in its pathogenesis .\nour patient s siblings experienced similar yet milder symptoms that the disorder was thought to be familial .\n, familial relationship was found in 5 of 10 patients , and consanguinity was denied in all .\namyloidosis cutis dyschromica is assumed to be a congenital disorder and exposure to sunlight is thought to be the major causal factor .\nthe lesions in our patient were more pronounced on exposed parts of body , that we thought sun exposure might be an important cause .\nacitretin was given and seems to be effective because it may act by minimizing keratinization defect that causes keratin degeneration to amyloid as proposed by some to be the pathogenesis of this disorder .\nqiao et al . in his series has convincingly shown 100% positivity to immunohistochemical staining for keratin , ck34 e12 and ck5/6 , that the amyloid is thought to be of epidermal origin .\nthat points at a disturbance of keratinocyte repairs after irradiation with ultraviolet . at the third month\nhis serum transaminase and lipid profile were only slightly increased , that we think the drug was safe to be continued .\nhowever , it is interesting to note that some authors consider certain populations of asia , e.g. chinese , japanese and thai , particularly susceptible .\ntherefore , it is possible that several cases of this elusive disorders exist , but are often misdiagnosed . on the other hand , the treatment of acd still remains a challenge .", "human": " amyloidosis cutis dyschromica ( acd ) is an extremely rare type of primary cutaneous amyloidosis . to date \n there are fewer than 40 published cases worldwide ; some were reported affecting several family members . \n its resemblance to other common pigmentation disorders makes it rarely recognized at first sight . \n our patient , the 12-year - old firstborn son of non - consanguineous parents presented with generalized mottled pigmentation starting from lower extremities . \n his siblings suffered from similar condition . \n the clue for diagnosis is the amyloid deposition in the papillary dermis . \n the etiology of acd is still unknown , but genetic factors and ultraviolet radiation are implicated . \n it is proposed that disturbance of keratinocyte repair following ultraviolet radiation results in amyloid deposition . \n the treatment remains a challenge . \n oral acitretin treatment , thought to repair keratinization defect , gave a slight improvement in our case . \n our is the first case of acd reported in indonesia . ", "section_names": "Introduction\nCase Report\nDiscussion\nConclusions", "bigbird_pegasus": "<s> primary cutaneous amyloidosis ( amyloid cutis dyschromica ) is a rare disease with unknown etiology.<n> we report a 12-year - old boy who presented with asymptomatic, generalized mottled hypo- and hyper - pigmented lesions of 6-year duration.<n> he did not have any history of systemic or cutaneous disease before the onset of the lesions.<n> his 11-year - old sister and 6-year - old brother experienced similar yet milder symptoms.<n> physical examination revealed an extensive, discrete, pigmented macules distributed nearly all over the body in symmetrical pattern.<n> he was referred to our hospital for skin biopsy with the initial differential diagnoses of vitiligo and pityriasis alba.<n> histopathological examination showed uneven distribution of melanin in the epidermis and deposits of pale pink amorphous material in the papillary dermis. based on clinical presentation and the histopathology examination, we made the diagnosis of amyloid cutis dyschromica.<n> the patient was treated with oral acitretin 25 mg per day. by the third month, some improvement was observed.<n> the diagnosis of amyloid cutis dyschromica in our patient was not readily recognized as it mimicked, to some degree, other relatively common disorders with pigmentation feature.<n> the peculiar asymptomatic mottled pigmentation is much likely seen in poikiloderma, but as our case showed, without the corresponding signs such signs such as telangiectasia or atrophy or atrophy or atrophy....<n> the, the. amyloid was the. amyloid was the.. amyloid was the. amyloid was the. amyloid was the.<n>..... amyloid was the.......<n>. amyloid was the......................................<n>.<n>............<n>.<n>.<n>..<n>.<n>.<n>", "longt5": "<pad> primary cutaneous amyloidosis ( pca ) is a rare, chronic progressive skin disease, defined as deposition of amyloid in previously apparent normal skin without systemic involvement. its prevalence was rarely reported. until now, there are fewer than 40 published cases worldwide. etiological factors associated with pca are still unknown, but its striking familial occurence suggests the role of genetic. we report a case with peculiar mottled pigmentation originally referred for vitiligo, but later proved as acd by histopathological examination. the disorder was thought to be familial as his siblings were affected with the similar condition.</s>"}
{"article": "participants were recruited in the dominiek savio institute , a service center for people with physical disabilities in belgium .\nthe dominiek savio institute offers ambulatory , semi - residential , and residential services to children and adults who need support in the domains of living , education , and work .\nparticipants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability ( e.g. , cerebral palsy , spina bifida , and traumatic brain injury ) . in order to achieve a homogenous sample ,\nindividuals with a medical condition that was progressive by nature ( e.g. , huntington s disease , neuromuscular diseases ) were excluded from participation . this resulted in a sample of 65 adults ( 31 male ; 34 female ) , representing the most common physical disabilities .\nmost participants were diagnosed with cerebral palsy ( 80% ) followed by traumatic brain injury ( 15% ) and spina bifida ( 5% ) .\na total of 48% of the sample was diagnosed with an intellectual disability ( iq - score lower than 70 ) .\ntable  1demographic and background variables of the participants ( n  =  65)percentage ( % ) age  21 - 3012  31 - 4029  41 - 5040  51 - 6019primary disability  cerebral palsy80  spina bifida5  traumatic brain injury15secondary disability  intellectual disability48  deafness / hearing impairment6  blindness / visual impairment8  speech / language impairment46  psychiatric impairment19  cognitive impairments ( e.g. , apraxia , ataxia , amnesia)12intelligence level  > 7152  567025  465511  36459  21353 demographic and background variables of the participants ( n  =  65 ) the supports intensity scale ( sis ) and the barthel index ( bi ) were administered according to the guidelines . both scales were scored by caregivers who were familiar with the person for at least 3  months . for the sis ,\nindividuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of \nthe bi was rated by the personal assistant ( pa ) of each participant . for the bi\n, raters were assisted by the first author ( e.g. , instruction ofunclear items , verifying that all items were scored ) .\nparticipants were recruited in the dominiek savio institute , a service center for people with physical disabilities in belgium .\nthe dominiek savio institute offers ambulatory , semi - residential , and residential services to children and adults who need support in the domains of living , education , and work .\nparticipants of this study were included if they were diagnosed with a neurological condition resulting in a major physical disability ( e.g. , cerebral palsy , spina bifida , and traumatic brain injury ) . in order to achieve a homogenous sample ,\nindividuals with a medical condition that was progressive by nature ( e.g. , huntington s disease , neuromuscular diseases ) were excluded from participation . this resulted in a sample of 65 adults ( 31 male ; 34 female ) , representing the most common physical disabilities .\nmost participants were diagnosed with cerebral palsy ( 80% ) followed by traumatic brain injury ( 15% ) and spina bifida ( 5% ) .\na total of 48% of the sample was diagnosed with an intellectual disability ( iq - score lower than 70 ) .\ntable  1demographic and background variables of the participants ( n  =  65)percentage ( % ) age  21 - 3012  31 - 4029  41 - 5040  51 - 6019primary disability  cerebral palsy80  spina bifida5  traumatic brain injury15secondary disability  intellectual disability48  deafness / hearing impairment6  blindness / visual impairment8  speech / language impairment46  psychiatric impairment19  cognitive impairments ( e.g. , apraxia , ataxia , amnesia)12intelligence level  > 7152  567025  465511  36459  21353 demographic and background variables of the participants ( n  =  65 )\nthe supports intensity scale ( sis ) and the barthel index ( bi ) were administered according to the guidelines .\nboth scales were scored by caregivers who were familiar with the person for at least 3  months . for the sis ,\nindividuals were rated by staff workers who held an academic degree and had sufficient knowledge of the concept of  support which is also recommended by the sis manual ( aaidd 2004 ) .\nthe bi was rated by the personal assistant ( pa ) of each participant . for the bi\n, raters were assisted by the first author ( e.g. , instruction ofunclear items , verifying that all items were scored ) .\nevidence for the good psychometric properties of the instrument has been provided in both dutch and belgium samples ( buntinx 2006 ; claes et al .\nthe sis is composed of three separate areas in which support may be needed : life activities ( 57 items ) , medical conditions ( 16 items ) and behavioral conditions ( 13 items ) .\nthe domain of life activities is composed by 7 subscales : home living , community living , life - long learning , employment , health and safety , social activities , and protection and advocacy .\nfor these subscales , ratings are made on a 5-points scale with regard to the frequency of support ( ranging from none to hourly ) , the daily support time needed ( ranging from none to 4  h or more ) and the type of support ( ranging from none to full physical assistance ) .\nadditionally , ratings in the areas of medical and behavioral conditions are assessed on a 3-points scale , ranging from no support , some support and extensive support needed . by summing up all scores on the subscales , a total raw score is derived .\na dutch validated version of bi was used in order to measure the practical skills of the individuals included in our sample .\nthe bi is a widely used and accepted instrument in clinical and scientific research to assess a range of functional abilities in activities of daily living ( adl ) .\nthe bi has been considered as the gold standard to measure adl - abilities ( dijkstra et al .\na total of ten domains of adl are rated by a primary caregiver on a scale ranging from ( 0 ) fully dependent to ( 3 ) fully independent .\nthese domains of adl include : bowel control , bladder control , personal hygiene , toilet use , feeding , transfer , mobility , dressing , stair climbing , and bathing .\nthe total score ( ranging from 0 to 20 ) gives an indication of the care dependency of the person .\nthe lower the scores , the more dependent the person is on care , and vice versa .\nthe bi has been considered as a reliable and valid instrument to measure activities of daily living ( adl ) in people with neuromuscular and muscoskelatal disorders .\n2006 ) internal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . a cronbach s alpha higher than .70\nconstruct validity the measurement of construct validity  is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined \n( cronbach and meehl 1955 , p. 281).there are multiple validation procedures to determine the construct validity of a scale ( arvey 1992 ) .\nif correlations between subscales are in the moderate to high range ( .4  .9 ) , it is evidenced that the subscales measure the same overall construct ( thompson et al .\n2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index ( bi ) .\nmoreover , one would expect a significant correlation between the sis and bi because they measure two related but different constructs , namely support needs and adaptive skills respectively ( thompson et al .\ntherefore , we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range ( .4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores .\none would expect that persons with more disabilities have higher sis scores ( indicating higher support needs ) than persons with less disabilities . therefore , three groups were composed according to the number of disabilities : a group with one disability ( n  =  20 ) , a group with two disabilities ( n  =  30 ) and a group with three or more disabilities ( n  =  14 ) .\nthe group with one disability exclusively had a motor disability , whereas the other two groups had additional disabilities , such as a hearing , visual , speech / language , psychiatric or cognitive disabilities .\na one - way analyses of variance ( anova ) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher .\ninternal consistency cronbach s alphas were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales . a cronbach s alpha higher than .70\nconstruct validity the measurement of construct validity  is involved whenever a test is to be interpreted as a measure of some attribute or quality which is not operationally defined \n( cronbach and meehl 1955 , p. 281).there are multiple validation procedures to determine the construct validity of a scale ( arvey 1992 ) .\nif correlations between subscales are in the moderate to high range ( .4  .9 ) , it is evidenced that the subscales measure the same overall construct ( thompson et al .\n2002).the second manner to examine construct validity is to correlate the sis subscale scores with the total score of the barthel index ( bi ) .\nmoreover , one would expect a significant correlation between the sis and bi because they measure two related but different constructs , namely support needs and adaptive skills respectively ( thompson et al .\ntherefore , we hypothesized that the correlation between the sis subscales and the bi would be in the moderate range ( .4 to .6).a third procedure to determine the construct validity of the sis is to test whether there are expected differences among groups with different number of disabilities on total sis - scores .\none would expect that persons with more disabilities have higher sis scores ( indicating higher support needs ) than persons with less disabilities .\ntherefore , three groups were composed according to the number of disabilities : a group with one disability ( n  =  20 ) , a group with two disabilities ( n  =  30 ) and a group with three or more disabilities ( n  =  14 ) .\nthe group with one disability exclusively had a motor disability , whereas the other two groups had additional disabilities , such as a hearing , visual , speech / language , psychiatric or cognitive disabilities .\na one - way analyses of variance ( anova ) was conducted to test our hypothesis that the sis total scores increased as the number of disabilities was higher .\ninternal consistency internal consistency coefficients were high and exceeded the criterion of .70 ( see table  2 ) : cronbach s alphas ranged from .71 for medical to .96 for life - long learning , and the cronbach alpha for the total sis was .98 .\nthus , internal consistency was evidenced for both the subscales and the total sis scale . \n\ntable  2intercorrelations between sis subscales ( n  =  65)sis subscalehlcllllemph&ssocmedbehhl.95cl.62**.95lll.47**.78**.96emp.46**.65**.71**.94h&s.59**.76**.82**.69**.94soc.44**.77**.72**.75**.76**.93med.74**.63**.52**.55**.58**.46**.71beh-.00-.02-.01-.01.16.05-.05.77**significant at p<.01;hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behaviorcoefficients on the diagonal are the cronbach s alphas intercorrelations between sis subscales ( n  =  65 ) * * significant at p<.01 ; hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behavior coefficients on the diagonal are the cronbach s alphas construct validity first , to test the construct validity , the intercorrelations between the sis subscales were calculated .\nas can be seen in table  2 , construct validity was present in 7 out of 8 subscales , as shown by the statistically significant intercorrelations .\nhowever , the subscale behavior did not significantly correlate with the other subscales ( range .00.16 ) .\nthat is , the highest significant correlation was found between life - long learning and health and safety ( .82 ) , whereas , home living and social activities revealed the lowest significant correlation ( .44 ) .\nthus , all sis subscales seemed to measure the same construct , namely support needs , with the exception of the behavior scale.second , sis subscale scores were correlated with the bi sum score ( table  3 ) .\nfour of the eight correlations between the sis subscales and the bi exceeded the criterion of .35 , namely home living ( -.78 ) , community living ( -.41 ) , health and safety ( -.41 ) and medical ( -.70 ) .\nthe other four sis subscales ( life - long learning , employment , social activities and behavior ) did not correlate higher than .35 with the bi . \n\ntable  3correlations between sis subscales and the sum score of the bi ( n  =  65)bihl-.78**cl-.41**lll-.26*emp-.29*h&s-.41**soc-.22med-.70**beh-.03 * significant at p < .05 ; * * significant at p < .01hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behaviorbi barthel indexfinally , we tested whether subgroups with different number of disabilities had different total scores on the sis .\nour analysis revealed significant differences between groups in total sis scores , f(2,62 )  =  4.98 , p  <  01 ,  \n=  .14 . post - hoc comparisons with lsd indicated that the group with 1 disability ( m  =  242.0 ; sd  =  72.8 ) required less support compared with the group with 2 ( m  =  291.1 ; sd  =  86.3 ) and 3 or more disabilities ( m  =  329.6 ; sd  =  87.5 ) . although the mean sis score was higher for participants in the group of 3 or more disabilities compared to the participants with 2 disabilities , the difference was not statistically significant .\nthese results indicate that the sis discriminates between subgroups with different number of disabilities , which could be regarded as an indicator for construct validity .\ncorrelations between sis subscales and the sum score of the bi ( n  =  65 ) * significant at p < .05 ; * * significant at p < .01 hl home living , cl community living , lll life - long learning , emp employment , h&s health & safety , soc social activities , med medical , beh behavior\nthe present study investigated the internal consistency and the construct validity of the sis in a sample of people with physical disabilities .\nthe cronbach s alphas were comparable to the coefficients reported in previous research of thompson and colleagues ( 2002 ) and buntinx et al .\n( 2008 ) including people with intellectual disabilities , albeit that the cronbach s alphas of sis medical and sis behavior were somewhat lower in the present study .\na lower internal coefficient of the behavior scale ( .77 ) was found in the present study compared to research by thompson et al .\n( 2008 ) ( .98 and .86 , respectively ) , both using samples of people with intellectual disabilities .\nin addition , the sis behavior subscale did not correlate significantly with other sis subscales .\nthat is , most items of the behavior subscale refer to support needs of behaviors that are externalizing by nature ( e.g. , aggression and automutulation ) .\nin contrast , only two items ( maintenance of mental health treatments and prevention of other serious behavior problems ) are included that may capture more internalizing problems , such as depression and anxiety .\nit is possible that these externalizing behaviors are less relevant for people with physical disabilities .\nit is known from research that , in comparison to people without disabilities , individuals who are physically disabled have a higher risk to develop mood and anxiety disorders ( mccoll and friedland 1993 ) .\ntherefore , if support needs in people with physical disabilities are assessed , instruments should encompass a broader range of behavioral issues , including behaviors that are more relevant for individuals with physical disabilities . in order to investigate the construct validity of the sis ,\npast research reveals that people with physical disabilities often have limitations in practical skills , such as toileting , bathing , and mobility ( e.g. , andrn and grimby 2000 ; balandin and morgan 1997 ) . as balandin and morgan ( 1997 )\nhave suggested , these limitations may be accompanied by higher support needs in , for example , people with cerebral palsy . in accordance with this expectation , a moderate correlation was found between total sis scores and the bi .\noverall , these results indicate that participants had more support needs as they had more limitations in practical skills .\nhowever , further analyses of the data revealed that the construct validity was evident in only four subscales of the sis .\nas was expected , a strong correlation was found between sis home living and bi , as the former typically requires such practical skills , as dressing and toileting .\nit was , however , hypothesized that limitations in practical skills would be also linked to support requirements in a range of life domains , as was suggested by some previous studies of support needs of people with physical disabilities ( andrn and grimby 2000 ; balandin and morgan 1997 ) .\nfor example , stronger correlations were expected between bi - scores and life - long learning , employment , and social activities .\nfor instance , it is reasonable that people with physical disabilities may also need assistance ( in for example toileting or walking ) , while performing activities such as participating in educational activities ( life - long learning ) or participating in recreational activities ( social activities ) .\nin addition , the correlations between the bi and community living and health and safety exceeded the minimum criterion .35 .\nhowever , these correlations were still lower than the correlations reported in a study with people intellectual disabilities of harries and colleagues ( 2005 ) , who found higher correlations between these sis subscales and several subscales of the adaptive behavior scale ( abs ) and the inventory client and agency planning ( icap ) measuring practical skills ( abs self - sufficiency , icap motor skills and icap personal living skills ) .\ntherefore , compared to previous research , this study reveals a weak relationship between limitations in practical skills and support needs in specific sis domains , and additionally , construct validity was evidenced in only four out of eight sis subscales .\nan explanation for the weak relationship between the bi and the sis subscales could be that the sis subscales might have underestimated the limitations of practical skills associated with physical disabilities . in the study of harries et al .\n( 2005 ) , in which scores of the abs , icap and sis section subscales were combined in an explorative factor - analysis , it was found that the sis support need scale and these adaptive behavior scales had the same underlying construct .\nalthough initial analyses showed a strong association between sis subscales and the subscales of the abs and the icap , a three - factor solution showed that no sis subscales were present in the third factor , representing the practical dimension .\nthe outcomes revealed that ,  considered in terms of the three adaptive behavior skill areas , the underlying construct related predominantly to the conceptual skills dimension \nthe authors suggest that the raters used  an individual s conceptual skills as a framework of reference when assessing support needs  ( p. 402 ) .\nalthough harries and colleagues ( 2005 ) do not further explain this suggestion , it may be that the frame of reference is a bias in the sis itself .\nit might be that support needs , as measured by the sis , are based more on the limitations in conceptual skills ( e.g. , cognition and language ) rather than limitations in practical skills ( e.g. , mobility , bladder and bowel control ) . all subscales ( except the behavior subscale ) were intercorrelated in the moderate to high range , comparable to the outcome of buntinx et al .\nmoreover , the sis was able to discriminate between groups who varied in the number of disabilities .\nspecifically , the group of people with a physical disability and 2 or 3 or more additional impairments were rated as having higher support needs than people with only a physical disability .\nthus , the analysis of the construct validity reveals that the sis measured the overall construct of support needs in the current sample .\nhowever , in contrast to the expectation that the sis subscales would be related to the bi , this construct is only slightly based on limitations in practical skills\nfirst most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi .\nsubgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses .\nfuture research is needed to investigate whether these groups differ in the nature of support needs .\nfor example , many people with spina bifida may need support related to bladder and bowel control and shunt - related problems ( oi et al . 1996 ) . in addition\n, people with tbi often need support in the behavioral domain ( soo et al .\ntherefore , future research of the sis should take into account other settings , such as ambulatory and semi - residential services .\nhowever , people with cerebral palsy often experience a decline in functional status and health status at a young age ( hemsley et al .\n( 2002 ) argue , support needs are proposed to be dynamic , which indicates that  they change across settings , across situations , and over time  ( p. 392 ) . for this reason ,\nequally important , in order to consider the changing nature of support needs in people with a physical disability , research should also focus on longitudinal assessments on individuals . in summary ,\nthe present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities .\nalthough there are some indications that the sis may be useful assessing support needs in people with physical disabilities , the sis might not take sufficiently into account the limitations in practical skills of these people .\nfor people with physical disabilities , future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis .\nfirst most of the participants in the sample were diagnosed with cerebral palsy and only a small proportion consisted of people with spina bifida and tbi .\nsubgroups consisting of people with spina bifida and tbi were too small to conduct separate analyses .\nfuture research is needed to investigate whether these groups differ in the nature of support needs .\nfor example , many people with spina bifida may need support related to bladder and bowel control and shunt - related problems ( oi et al .\nin addition , people with tbi often need support in the behavioral domain ( soo et al . 2007 ) , as they often exhibit externalizing behaviors ( ducharme 1999 ) .\ntherefore , future research of the sis should take into account other settings , such as ambulatory and semi - residential services .\nhowever , people with cerebral palsy often experience a decline in functional status and health status at a young age ( hemsley et al .\n( 2002 ) argue , support needs are proposed to be dynamic , which indicates that  they change across settings , across situations , and over time  ( p. 392 ) . for this reason ,\nequally important , in order to consider the changing nature of support needs in people with a physical disability , research should also focus on longitudinal assessments on individuals . in summary ,\nthe present research was the first attempt to measure the psychometric properties of the sis in people with physical disabilities .\nalthough there are some indications that the sis may be useful assessing support needs in people with physical disabilities , the sis might not take sufficiently into account the limitations in practical skills of these people . for people with physical disabilities , future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis", "human": " the objective of this study was to investigate the internal consistency and the construct validity of the dutch version of the supports intensity scale ( sis - nl1.0 ; buntinx 2006 ) in individuals with physical disabilities ( n  =  65 ) . to investigate the construct validity , \n the relationship between sis subscales and practical skills ( barthel index ; bi ) was calculated . \n support was provided for the internal consistency . \n the sis subscales ( except behavior ) had moderate to high intercorrelations and the sis was able to discriminate between groups with different number of disabilities . \n however , weak relationships were found between the bi and four out of eight sis subscales . \n for people with physical disabilities , future revisions of the sis should also take into consideration limitations in practical skills in other support domains . ", "section_names": "Method\nParticipants\nProcedure\nMaterials\nData-Analyses\nResults\nDiscussion\nLimitations and Future Research", "bigbird_pegasus": "<s> purpose : the purpose of this study was to examine the construct validity of the supports intensity scale ( sis ) and the barthel index ( bi ) in daily life of people with physical disabilities in belgium.<n> methods : participants were recruited in a dominiek savio institute, a service center for people with physical disabilities in belgium.<n> participants were recruited in the dominiek savio institute, a service center for people with physical disabilities in belgium.<n> participants were recruited in the dominiek savio institute, a service center for people with physical disabilities in belgium.<n> the supports intensity scale ( sis ) and the barthel index ( bi ) were administered according to the guidelines.<n> results : participants had an average iq - score of 60.4.<n> the results of internal consistency analyses of the sis ranged from.71 for medical and behavioral conditions to.98 for life - long learning, h&s health & safety, soc social activities, h&s health & safety, life - long learning, and medical activities of daily living ( adl - abilities ).<n> construct validity analyses of the sis ranged from.70 for medical and behavioral conditions to.96 for life - long learning, h&s health & safety, life - long learning, h&s health & safety, life - health, life - health.<n> the internal consistency of the total scores of the total scores of the total total of the total scores of the total total of the total total of the total a total of the total of the total of the total of the total of the total of the total of the total of the total of the total.<n><n> the.<n>.<n>.<n>.<n>.<n>.<n>.<n>.<n><n>.<n><n><n>.<n>.<n><n>.<n><n><n>.<n><n>.<n><n><n>.<n><n><n>.<n><n><n><n><n><n><n><n><n><n>.<n><n><n><n><n><n><n><n>.<n><n><n><n><n><n><n><n>.<n><n><n><n><n><n>.<n>.<n><n><n><n><n><n><n><n><n>.<n><n><n><n><n><n><n><n><n><n><n><n>.<n><n>.<n><n><n>", "longt5": "<pad> [ purpose ] this study investigated the internal consistency and the construct validity of the supports intensity scale ( sis ) in a sample of people with physical disabilities. [ subjects and methods ] the participants were 65 adults ( 31 male ; 34 female ), representing the most common physical disabilities. the sis is composed of three separate areas in which support may be needed : life activities ( 57 items ), medical conditions ( 16 items ) and behavioral conditions ( 13 items ). the barthel index ( bi ) is a widely used and accepted instrument in clinical and scientific research to measure activities of daily living ( adl ). the internal consistency coefficients were calculated for both the sis subscales and the total sis scale to determine the internal consistency of the scales. [ results ] the internal consistency coefficients were high and exceeded the criterion of.70. construct validity was present in 7 out of 8 sis subscales, and the sis scores were correlated with the bi. four of the eight correlations between the sis subscales and the bi exceeded the criterion of.35, namely home living ( -.78 ), community living ( -.41 ), health and safety ( -.41 ) and medical ( -.70 ). the other four sis subscales ( life - long learning, employment, social activities and behavior ) did not correlate higher than.35 with the bi. [ conclusion ] although there are some indications that the sis may be useful assessing support needs in people with physical disabilities, the sis might not take sufficiently into account the limitations in practical skills of these people. for people with physical disabilities, future revisions of the sis should take into consideration limitations in practical skills in a variety of support domains as measured by the sis.</s>"}