nextflow.config

/*
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    nf-core/smrnaseq Nextflow config file
~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
    Default config options for all compute environments
----------------------------------------------------------------------------------------
*/

// Global default params, used in configs
params {

    // Input options
    input                       = null

    // References
    genome                      = null
    igenomes_base               = 's3://ngi-igenomes/igenomes'
    igenomes_ignore             = false
    mirna_gtf                   = null
    mature                      = "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/mature.fa"
    hairpin                     = "https://github.com/nf-core/test-datasets/raw/smrnaseq/miRBase/hairpin.fa"
    mirgenedb                   = false
    mirgenedb_mature            = null
    mirgenedb_hairpin           = null
    mirgenedb_gff               = null
    mirgenedb_species           = null
    bowtie_index                = null

    // General pipeline configuration
    save_intermediates          = false

    // UMI handling
    with_umi                      = false
    // skips umitools extract in FASTQ_FASTQC_UMITOOLS_FASTP subworkflow. Needs to be true for fastq mode in collapsing reads
    skip_umi_extract_before_dedup = true
    umitools_extract_method       = 'string'
    umitools_bc_pattern           = null
    umi_discard_read              = null
    umitools_method               = 'dir'
    save_umi_intermeds            = false

    // Trimming options
    clip_r1                     = null
    three_prime_clip_r1         = null
    three_prime_adapter         = 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA' //is set to the Illumina TruSeq single index adapter sequence to ensure that the auto-detect functionality of FASTP is disabled.
    trim_fastq                  = true
    fastp_min_length            = 17
    fastp_known_mirna_adapters  = "$projectDir/assets/known_adapters.fa"
    save_trimmed_fail           = false
    save_merged                 = false
    skip_fastqc                 = false
    skip_multiqc                = false
    skip_mirdeep                = false
    skip_fastp                  = false
    save_reference              = false
    fastp_max_length            = 100
    min_trimmed_reads           = 10

    // Contamination filtering
    filter_contamination        = false
    rrna                        = null
    trna                        = null
    cdna                        = null
    ncrna                       = null
    pirna                       = null
    other_contamination         = null

    //FASTQ handling defaults, for mirtrace
    phred_offset = 33

    // References
    genome                     = null
    igenomes_base              = 's3://ngi-igenomes/igenomes/'
    igenomes_ignore            = false
    // MultiQC options
    multiqc_config             = null
    multiqc_title              = null
    multiqc_logo               = null
    max_multiqc_email_size     = '25.MB'
    multiqc_methods_description = null

    // Boilerplate options
    outdir                       = null
    publish_dir_mode             = 'copy'
    email                        = null
    email_on_fail                = null
    plaintext_email              = false
    monochrome_logs              = false
    hook_url                     = null
    help                         = false
    help_full                    = false
    show_hidden                  = false
    version                      = false
    pipelines_testdata_base_path = 'https://raw.githubusercontent.com/nf-core/test-datasets/'
    // Config options
    config_profile_name        = null
    config_profile_description = null
    custom_config_version      = 'master'
    custom_config_base         = "https://raw.githubusercontent.com/nf-core/configs/${params.custom_config_version}"
    config_profile_contact     = null
    config_profile_url         = null

    // Schema validation default options
    validate_params            = true
}

// Load base.config by default for all pipelines
includeConfig 'conf/base.config'

profiles {
    debug {
        dumpHashes              = true
        process.beforeScript    = 'echo $HOSTNAME'
        nextflow.enable.configProcessNamesValidation = true
    }
    conda {
        conda.enabled           = true
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        conda.channels          = ['conda-forge', 'bioconda']
        apptainer.enabled       = false
    }
    mamba {
        conda.enabled           = true
        conda.useMamba          = true
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    docker {
        docker.enabled          = true
        conda.enabled           = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
        docker.runOptions       = '-u $(id -u):$(id -g)'
    }
    arm {
        docker.runOptions       = '-u $(id -u):$(id -g) --platform=linux/amd64'
    }
    singularity {
        singularity.enabled     = true
        singularity.autoMounts  = true
        conda.enabled           = false
        docker.enabled          = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    podman {
        podman.enabled          = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        shifter.enabled         = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    shifter {
        shifter.enabled         = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        charliecloud.enabled    = false
        apptainer.enabled       = false
    }
    charliecloud {
        charliecloud.enabled    = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        apptainer.enabled       = false
    }
    apptainer {
        apptainer.enabled       = true
        apptainer.autoMounts    = true
        conda.enabled           = false
        docker.enabled          = false
        singularity.enabled     = false
        podman.enabled          = false
        shifter.enabled         = false
        charliecloud.enabled    = false
    }
    wave {
        apptainer.ociAutoPull   = true
        singularity.ociAutoPull = true
        wave.enabled            = true
        wave.freeze             = true
        wave.strategy           = 'conda,container'
    }
    gitpod {

        executor.name           = 'local'
        executor.cpus           = 16
        executor.memory         = 60.GB

    }


    test                           { includeConfig 'conf/test.config' }
    test_umi                       { includeConfig 'conf/test_umi.config' }
    test_full                      { includeConfig 'conf/test_full.config' }
    test_full_filter_contamination { includeConfig 'conf/test_full_filter_contamination.config' }
    test_technical_repeats         { includeConfig 'conf/test_technical_repeats.config' }
    test_mirgenedb                 { includeConfig 'conf/test_mirgenedb.config' }
    test_contamination             { includeConfig 'conf/test_contamination.config' }
    test_contamination_tech_reps   { includeConfig 'conf/test_contamination_tech_reps.config' }
    test_skipfastp                 { includeConfig 'conf/test_skipfastp.config' }
    test_nextflex                  { includeConfig 'conf/test_nextflex.config' }
    ci                             { includeConfig 'conf/ci.config' }


    //Protocol specific profiles
    cats           { includeConfig 'conf/protocol_cats.config' }
    illumina       { includeConfig 'conf/protocol_illumina.config' }
    qiaseq         { includeConfig 'conf/protocol_qiaseq.config' }
    nextflex       { includeConfig 'conf/protocol_nextflex.config' }
}

// Load nf-core custom profiles from different Institutions
includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/nfcore_custom.config" : "/dev/null"

// Load nf-core/smrnaseq custom profiles from different institutions.
includeConfig !System.getenv('NXF_OFFLINE') && params.custom_config_base ? "${params.custom_config_base}/pipeline/smrnaseq.config" : "/dev/null"
// Set default registry for Apptainer, Docker, Podman, Charliecloud and Singularity independent of -profile
// Will not be used unless Apptainer / Docker / Podman / Charliecloud / Singularity are enabled
// Set to your registry if you have a mirror of containers
apptainer.registry    = 'quay.io'
docker.registry       = 'quay.io'
podman.registry       = 'quay.io'
singularity.registry  = 'quay.io'
charliecloud.registry = 'quay.io'

// Load igenomes.config if required
includeConfig !params.igenomes_ignore ? 'conf/igenomes.config' : 'conf/igenomes_ignored.config'
// Export these variables to prevent local Python/R libraries from conflicting with those in the container
// The JULIA depot path has been adjusted to a fixed path `/usr/local/share/julia` that needs to be used for packages in the container.
// See https://apeltzer.github.io/post/03-julia-lang-nextflow/ for details on that. Once we have a common agreement on where to keep Julia packages, this is adjustable.

env {
    PYTHONNOUSERSITE = 1
    R_PROFILE_USER   = "/.Rprofile"
    R_ENVIRON_USER   = "/.Renviron"
    JULIA_DEPOT_PATH = "/usr/local/share/julia"
}

// Set bash options
process.shell = """\
bash

set -e # Exit if a tool returns a non-zero status/exit code
set -u # Treat unset variables and parameters as an error
set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute
set -C # No clobber - prevent output redirection from overwriting files.
"""
// Set bash options
process.shell = """\
bash

set -e # Exit if a tool returns a non-zero status/exit code
set -u # Treat unset variables and parameters as an error
set -o pipefail # Returns the status of the last command to exit with a non-zero status or zero if all successfully execute
set -C # No clobber - prevent output redirection from overwriting files.
"""

// Disable process selector warnings by default. Use debug profile to enable warnings.
nextflow.enable.configProcessNamesValidation = false

def trace_timestamp = new java.util.Date().format( 'yyyy-MM-dd_HH-mm-ss')
timeline {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_timeline_${trace_timestamp}.html"
}
report {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_report_${trace_timestamp}.html"
}
trace {
    enabled = true
    file    = "${params.outdir}/pipeline_info/execution_trace_${trace_timestamp}.txt"
}
dag {
    enabled = true
    file    = "${params.outdir}/pipeline_info/pipeline_dag_${trace_timestamp}.html"
}

manifest {
    name            = 'nf-core/smrnaseq'
    author          = """P. Ewels, C. Wang, R. Hammarén, L. Pantano, A. Peltzer"""
    homePage        = 'https://github.com/nf-core/smrnaseq'
    description     = """Small RNA-Seq Best Practice Analysis Pipeline."""
    mainScript      = 'main.nf'
    nextflowVersion = '!>=24.04.2'
    version         = '2.4.0'
    doi             = '10.5281/zenodo.3456879'
}

// Nextflow plugins
plugins {
    id 'nf-schema@2.1.1' // Validation of pipeline parameters and creation of an input channel from a sample sheet
}

validation {
    defaultIgnoreParams = ["genomes","igenomes_base"]
    help {
        enabled = true
        command = "nextflow run $manifest.name -profile <docker/singularity/.../institute> --input samplesheet.csv --outdir <OUTDIR>"
        fullParameter = "help_full"
        showHiddenParameter = "show_hidden"
        beforeText = """
-\033[2m----------------------------------------------------\033[0m-
                                        \033[0;32m,--.\033[0;30m/\033[0;32m,-.\033[0m
\033[0;34m        ___     __   __   __   ___     \033[0;32m/,-._.--~\'\033[0m
\033[0;34m  |\\ | |__  __ /  ` /  \\ |__) |__         \033[0;33m}  {\033[0m
\033[0;34m  | \\| |       \\__, \\__/ |  \\ |___     \033[0;32m\\`-._,-`-,\033[0m
                                        \033[0;32m`._,._,\'\033[0m
\033[0;35m  ${manifest.name} ${manifest.version}\033[0m
-\033[2m----------------------------------------------------\033[0m-
"""
        afterText = """${manifest.doi ? "* The pipeline\n" : ""}${manifest.doi.tokenize(",").collect { "  https://doi.org/${it.trim().replace('https://doi.org/','')}"}.join("\n")}${manifest.doi ? "\n" : ""}
* The nf-core framework
    https://doi.org/10.1038/s41587-020-0439-x

* Software dependencies
    https://github.com/${manifest.name}/blob/master/CITATIONS.md
"""
    }
    summary {
        beforeText = validation.help.beforeText
        afterText = validation.help.afterText
    }
}

// Load modules.config for DSL2 module specific options
includeConfig 'conf/modules.config'