New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Reference sequence with newlines #18

Open

laurenfitch opened this issue Oct 14, 2019 · 0 comments

laurenfitch commented Oct 14, 2019

I have a reference sequence (FASTA) that looks like this:

>reference_sequence
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG
ACTGACTGACTGACTGACTGACTGACTG

PBSIM included the newlines in the simulated reads.

@S1_1
GAAAGCTAAAGATGTTCAGCCAACCATTATTATTAATAAAAATGGCCTTATCTCTTTGGAAGATATCTATGACATTG
CGATAAAACAAAAAAAAGTAGAAATATCAACGGAGATCACTGAACTTTTGACGCATGGTCGTGAAAAATTAGAGGAAAAA

I can take the newlines out of the reference but I was surprised by this behavior so I wanted to point it out.

The text was updated successfully, but these errors were encountered:

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment