--quantification_window_coordinates (qwc): Bug - Cannot define multiple quant windows for multiple amplicons

[enc-wmatern]

Describe the bug
The first issue is minor - The quantification window coordinates parameter is 0-indexed as stated in the docs (not 1-indexed). However, the documentation example says:
"A value of 0 disables this filter. (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 5th-10th bp in the first reference and the 5th-10th and 20th-30th bp in the second reference)"
This could instead say:
"A value of -1 disables this filter. (can be comma-separated list of values, corresponding to amplicon sequences given in --amplicon_seq e.g. 5-10,5-10_20-30 would specify the 6th-11th bp in the first reference and the 6th-11th and 21st-31st bp in the second reference)"

The major issue is that when specifying multiple amplicons, the quantification window coordinates of the first window only are applied to ALL the amplicons. For example: qwc=5-10,20-30 gives the exact same output as qwc=5-10,5-10 (ie the second window is ignored).

Expected behavior
The qwc parameter should specify the exact coordinates used for quantification in each respective amplicon. Which amplicon is first/second shouldn't matter.

To reproduce
I've introduced a deletion into the second amplicon near the cutsite just to get some reads mapping there. Viewing the visuals it is clear that the quantification window is always defined as the first quantification window - the second set of qwc values is disregarded.

CRISPResso -r1 FANC.Cas9.fastq -a CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAATCCCTTCTGCAGCACCTGGATCGCTTTTCCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG,CGGATGTTCCAATCAGTACGCAGAGAGTCGCCGTCTCCAAGGTGAAAGCGGAAGTAGGGCCTTCGCGCACCTCATGGAACCGAGCTTCTGGCGGTCTCAAGCACTACCTACGTCAGCACCTGGGACCCCGCCACCGTGCGCCGGGCCTTGCAGTGGGCGCGCTACCTGCGCCACATCCATCGGCGCTTTGGTCGG -g GGAATCCCTTCTGCAGCACC -qwc 90-110,20-30 --debug

Debug output
~~~CRISPResso 2~~~
-Analysis of genome editing outcomes from deep sequencing data-

                                    _                                       
                                   '  )                                     
                                   .-'                                      
                                  (____                                     
                               C)|     \                                    
                                 \     /                                    
                                  \___/                                     

                      [CRISPResso version 2.2.14]                           

[Note that starting in version 2.3.0 FLASh and Trimmomatic will be replaced by fastp for read merging and trimming. Accordingly, the --flash_command and --trimmomatic_command parameters will be replaced with --fastp_command. Also, --trimmomatic_options_string will be replaced with --fastp_options_string.

Also in version 2.3.0, when running CRISPRessoPooled in mixed-mode (amplicon file and genome are provided) the default behavior will be as if the --demultiplex_only_at_amplicons parameter is provided. This change means that reads and amplicons do not need to align to the exact locations.]
[For support contact k.clement@utah.edu or support@edilytics.com]

WARNING @ Sat, 27 Jan 2024 15:10:59:
Folder CRISPResso_on_FANC.Cas9 already exists.

INFO @ Sat, 27 Jan 2024 15:10:59:
Computing quantification windows

INFO @ Sat, 27 Jan 2024 15:10:59:
Using cut points from Reference as template for other references

INFO @ Sat, 27 Jan 2024 15:10:59:
Reference 'Amplicon1' has NO cut points or sgRNA intervals idxs defined. Inferring from 'Reference'.

INFO @ Sat, 27 Jan 2024 15:10:59:
Aligning sequences...

INFO @ Sat, 27 Jan 2024 15:10:59:
Processing reads; N_TOT_READS: 0 N_COMPUTED_ALN: 0 N_CACHED_ALN: 0 N_COMPUTED_NOTALN: 0 N_CACHED_NOTALN: 0

INFO @ Sat, 27 Jan 2024 15:10:59:
Finished reads; N_TOT_READS: 250 N_COMPUTED_ALN: 200 N_CACHED_ALN: 37 N_COMPUTED_NOTALN: 13 N_CACHED_NOTALN: 0

INFO @ Sat, 27 Jan 2024 15:10:59:
Done!

INFO @ Sat, 27 Jan 2024 15:10:59:
Quantifying indels/substitutions...

INFO @ Sat, 27 Jan 2024 15:10:59:
Done!

INFO @ Sat, 27 Jan 2024 15:10:59:
Calculating allele frequencies...

INFO @ Sat, 27 Jan 2024 15:10:59:
Done!

INFO @ Sat, 27 Jan 2024 15:10:59:
Saving processed data...

INFO @ Sat, 27 Jan 2024 15:10:59:
Making Plots...

DEBUG @ Sat, 27 Jan 2024 15:10:59:
Plotting read bar plot

DEBUG @ Sat, 27 Jan 2024 15:10:59:
Plotting read class pie chart and bar plot

INFO @ Sat, 27 Jan 2024 15:11:00:
Begin processing plots for amplicon Reference

DEBUG @ Sat, 27 Jan 2024 15:11:00:
Plotting nucleotide quilt across amplicon

DEBUG @ Sat, 27 Jan 2024 15:11:01:
Plotting nucleotide distribuition around sgRNA GGAATCCCTTCTGCAGCACC for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:01:
Plotting indel size distribution for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:01:
Plotting frequency deletions/insertions for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:02:
Plotting amplication modifications for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:02:
Plotting modification frequency for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:03:
Plotting quantification window locations for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:03:
Plotting position dependent indel for Reference

DEBUG @ Sat, 27 Jan 2024 15:11:03:
Plotting allele distribution around cut for Reference

INFO @ Sat, 27 Jan 2024 15:11:05:
Done!

INFO @ Sat, 27 Jan 2024 15:11:05:
Begin processing plots for amplicon Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:05:
Plotting nucleotide quilt across amplicon

DEBUG @ Sat, 27 Jan 2024 15:11:06:
Plotting nucleotide distribuition around sgRNA GGAATCCCTTCTGCAGCACC for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:06:
Plotting indel size distribution for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:07:
Plotting frequency deletions/insertions for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:07:
Plotting amplication modifications for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:08:
Plotting modification frequency for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:08:
Plotting quantification window locations for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:08:
Plotting position dependent indel for Amplicon1

DEBUG @ Sat, 27 Jan 2024 15:11:09:
Plotting allele distribution around cut for Amplicon1

INFO @ Sat, 27 Jan 2024 15:11:10:
Done!

INFO @ Sat, 27 Jan 2024 15:11:10:
Done!

INFO @ Sat, 27 Jan 2024 15:11:10:
Removing Intermediate files...

INFO @ Sat, 27 Jan 2024 15:11:10:
Analysis Complete!

                                    _                                      
                                   '  )                                    
                                   .-'                                     
                                  (____                                    
                               C)|     \                                   
                                 \     /                                   
                                  \___/