abdurakhmonov_10_duplication_800417.pdf.txt

<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Transitional//EN" "http://www.w3.org/TR/xhtml1/DTD/xhtml1-transitional.dtd"><html xmlns="http://www.w3.org/1999/xhtml">
<head>
<title>Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.)</title>
<meta name="Subject" content="BMC Plant Biology 2010, 10:119. doi: 10.1186/1471-2229-10-119"/>
<meta name="Author" content="Ibrokhim Y Abdurakhmonov, Zabardast T Buriev, Carla Logan-Young, Abdusattor Abdukarimov, Alan E Pepper"/>
<meta name="Creator" content="FrameMaker 8.0"/>
<meta name="Producer" content="Acrobat Distiller 7.0 (Windows)"/>
<meta name="CreationDate" content=""/>
</head>
<body>
<pre>
Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

RESEARCH ARTICLE

Open Access

Duplication, divergence and persistence in the
Phytochrome photoreceptor gene family of
cottons (Gossypium spp.)
Research article

Ibrokhim Y Abdurakhmonov1, Zabardast T Buriev1, Carla Jo Logan-Young2, Abdusattor Abdukarimov1 and
Alan E Pepper*2

Abstract
Background: Phytochromes are a family of red/far-red photoreceptors that regulate a number of important
developmental traits in cotton (Gossypium spp.), including plant architecture, fiber development, and photoperiodic
flowering. Little is known about the composition and evolution of the phytochrome gene family in diploid (G.
herbaceum, G. raimondii) or allotetraploid (G. hirsutum, G. barbadense) cotton species. The objective of this study was to
obtain a preliminary inventory and molecular-evolutionary characterization of the phytochrome gene family in cotton.
Results: We used comparative sequence resources to design low-degeneracy PCR primers that amplify genomic
sequence tags (GSTs) for members of the PHYA, PHYB/D, PHYC and PHYE gene sub-families from A- and D-genome
diploid and AD-genome allotetraploid Gossypium species. We identified two paralogous PHYA genes (designated
PHYA1 and PHYA2) in diploid cottons, the result of a Malvaceae-specific PHYA gene duplication that occurred
approximately 14 million years ago (MYA), before the divergence of the A- and D-genome ancestors. We identified a
single gene copy of PHYB, PHYC, and PHYE in diploid cottons. The allotetraploid genomes have largely retained the
complete gene complements inherited from both of the diploid genome ancestors, with at least four PHYA genes and
two genes encoding PHYB, PHYC and PHYE in the AD-genomes. We did not identify a PHYD gene in any cotton
genomes examined.
Conclusions: Detailed sequence analysis suggests that phytochrome genes retained after duplication by segmental
duplication and allopolyploidy appear to be evolving independently under a birth-and-death-process with strong
purifying selection. Our study provides a preliminary phytochrome gene inventory that is necessary and sufficient for
further characterization of the biological functions of each of the cotton phytochrome genes, and for the development
of 'candidate gene' markers that are potentially useful for cotton improvement via modern marker-assisted selection
strategies.
Background
Phytochromes are specialized photoreceptors that perceive and interpret light signals from the environment to
regulate virtually all aspects of plant development,
including seed germination, chloroplast development,
tropisms, shade avoidance responses, floral initiation, circadian rhythms, pigmentation, and senescence [1-3]. The
phytochromes have a primary role in sensing red (R) and
far-red (FR) light, and also play a role in the perception of
* Correspondence: apepper@bio.tamu.edu
2

Department of Biology, Texas A&M University, College Station, Texas 77843,
USA

blue (B) and ultraviolet (UV) light [4]. The active phytochrome molecule consists of a large (~110 kDa) apoprotein bound to a phycobilin chromophore [5,6]. The
phytochrome apoproteins are encoded by a small gene
family in all plant taxonomic divisions, including parasitic
plants, mosses, cryptogams, and green algae [7-13]. In
angiosperms, the phytochrome apoprotein genes have
been classified into four or five gene sub-families based
on sequence similarity to the five phytochrome genes of
Arabidopsis: PHYA, PHYB, PHYC, PHYD, and PHYE
[14,15]. All five Arabidopsis phytochromes share an
amino acid sequence similarity of 46-56%, with the

Full list of author information is available at the end of the article
© 2010 Abdurakhmonov et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

exception PHYB and PHYD--which are the result of
recent gene duplication and share ~80% amino acid identity [14,16]. Thus, the five Arabidopsis genes are often
assigned to four subfamilies: PHYA, PHYB/D, PHYC, and
PHYE [17]. The Arabidopsis PHYB/D subfamily is more
closely related to PHYE gene (~55% nt identity) than to
the PHYA and PHYC genes (~47% nt identity), which
together form a separate ancient evolutionary clade
[13,14].
Having presumably arisen by gene duplication and subsequent subfunctionalization and/or neofunctionalization, the phytochrome gene family in toto performs a
complex network of redundant, partially redundant, nonoverlapping, and in some cases antagonistic regulatory
functions throughout plant development [18-35]. For
example, all Arabidopsis phytochromes play diverse and
interacting roles in photoperiodic regulation of floral initiation. PHYA, PHYB, PHYD and PHYE act partially
redundantly in the light-dependent entrainment of the
circadian clock [35,36], which in turn regulates transcription of the floral inducer CONSTANS (CO) in a circadian
manner [37]. In Arabidopsis, PHYA, in conjunction with
blue-light dependent cryptochrome photoreceptors
CRY1 and CRY2, promotes flowering by inhibiting the
degradation of CO protein, while PHYB acts antagonistically to stimulate CO degradation [38]. In addition,
PHYB, PHYD and PHYE act partially redundantly as
repressors of flowering that are dependent on R/FR ratio
[19,28,30,39]. In this role, PHYB also acts downstream of
CO as a negative regulator of transcription of the 'florigen' molecule FT (the target of CO) in a tissue specific
manner [40]. Mutant analyses indicate that PHYC also
plays a role in photoperiodic flowering [31,41]. Further,
genetic variation at the PHYC locus underlies some of the
natural phenotypic variation in flowering time in Arabidopsis [42,43].
In angiosperms, the composition of phytochrome gene
family varies significantly among taxonomic lineages.
Although a single PHYA gene is present in most flowering plants, some plant families, such as carnation (Carryophyllaceae) and legumes (Fabaceae), have two distinct
PHYA genes [10]. Similarly, several plant lineages have
gained multiple PHYB-like genes through independent
gene duplications of PHYB [10,14,16,44-47]. For example,
tomato has two PHYB genes (designated PHYB1 and
PHYB2) that are not directly orthologous to Arabidopsis
PHYB and PHYD, respectively [44]. While most angiosperms have a single PHYC gene, species in some families
such as Fabaceae and Salicaceae appear to have lost
PHYC during evolution [10,47]. Although a single PHYElike gene is present in most flowering plants, PHYE is
completely absent in poplar (Salicaceae), in the Piperales,
and some monocots such as maize [10,47]. Finally, the

Page 2 of 18

novel PHYF subfamily, which groups with PHYA/C clade,
has been identified in tomato [44].
Little is known about the composition of the phytochrome gene family in cultivated cottons or their wild relatives (Gossypium spp.) in the Malvaceae family. This is
despite the fact that physiological experiments suggest
that phytochromes regulate economically important
aspects of cotton development, including drought resistance, seed germination, plant architecture, photoperiodic flowering, and fiber elongation [48-51]. For example,
R/FR photon ratio influences the length and diameter of
developing seed fiber; fibers exposed to a high R/FR photon ratio during development were longer than those that
received lower R/FR ratio, implicating the involvement of
a phytochrome [50,51].
While modern domesticated varieties of the major cultivated cottons G. hirsutum L. and G. barbadense L.
exhibit photoperiod independent flowering, wild and
'primitive' accessions of G. hirsutum and G. barbadense
flower under short-day photoperiodic control [52,53]. An
understanding of the molecular-genetic basis of differences in photoperiodic flowering in cottons will accelerate strategies for improvement of cultivated varieties
through the introgression of valuable genetic traits from
wild germplasm [52,53]. In this regard, it is important to
note that mutational changes in phytochrome function
have been implicated in the loss of photoperiod sensitivity in several major crops including sorghum, barley, rice,
and soy [54-57].
A thorough characterization of the phytochrome gene
family in cotton species is necessary for understanding
the molecular basis of photoperiodic flowering, the influences of light quality on cotton fiber elongation, and
other aspects of cotton development. Any inventory of
phytochrome genes of cottons is complicated by the fact
that the major cultivated species, G. hirsutum and G. barbadense are allotetraploids. Diploid species in the genus
Gossypium are categorized into eight genome groups
(designated A through G, and K) based on cytogenetic
and phylogenetic criteria [58-62]. The old-world A
genome group and the new world D genome group
diverged from each other on the order of 1-7 MYA [61],
then underwent hybridization and polyploidization creating an AD allopolyploid lineage ancestral to G. hirsutum (designated AD1) and G. barbadense (designated
AD2) on the order of 1 MYA [62,63].
In this study, we utilized a PCR-based approach with
low-degeneracy primers to obtain gene fragments, or
'genome sequence tags' (GSTs) that yield an initial
description of the composition and evolution of the phytochrome gene family in the New World allotetraploid
cottons Gossypium hirsutum and G. barbadense, and in
the Old-World diploids G herbaceum L. and G. raimondii

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Ulbr., which are considered to be extant relatives of the
A- and D-genome diploid ancestors (respectively) of the
allotetraploid lineage. This study provides a necessary
foundation for studies of the specific biological functions
of each of the phytochrome genes in cotton species, and
helps to illuminate the evolutionary patterns of duplicated genes in complex genomes, as well as the evolutionary history of the world's most important fiber crop
species.

Results
Because our results were derived from PCR, our inventory of the phytochrome gene family in Gossypium spp. is
provisional. All sequences have been submitted to GenBank (accession numbers HM143735-HM143763).
Phytochrome hinge amplification using 'universal' primers

Between N-terminal 'photoperception domain' and Cterminal 'signaling domain' of the phytochrome apoprotein is a short 'hinge region' (Figure 1) that shows relatively high sequence variation, and has proven useful for
characterization of the phytochrome gene complement in
a variety of plant species, and for robust phylogenetic
analyses [10]. To amplify the hinge region of all cotton
phytochromes, we used an alignment of eudicot phytochrome sequences to design a 768-fold degenerate PCR
primer (designated PHYdeg-F) based on the conserved
HYPATDIP peptide in the N-terminal domain, and a
16,384-fold degenerate PCR primer (designated PHYdegR), based on the conserved PFPLRYAC peptide in the Cterminal domain (Table 1).
Amplification across the hinge region using Taq DNA
polymerase yielded PCR products from all taxa. We
cloned the amplification products from each taxon into
an E. coli vector, then sequenced ~40 clones for each
taxon. For all taxa, a majority (>60%) of clones showed
the highest similarity in BLAST searches to Arabidopsis
PHYE (E value ~ 1e-40). For each taxon, only a minority
of clones showed high-scoring similarity to Arabidopsis
PHYA or PHYB. This apparently skewed distribution of
amplification products -- observed across all taxa -- suggested an amplification bias in favor of PHYE amplicons.
No clones were obtained from any taxon that had highscoring similarity to Arabidopsis PHYC or PHYD. No
new phytochrome sub-families were observed.
Amplification of the PHYA gene sub-family

Because of possible biased amplification, we designed
new less-degenerate hinge-region primer sets for the
PHYA, PHYB/D, and PHYC sub-families (Table 1) using
available phytochrome sequences from species in the
rosid clade, which includes both cotton and Arabidopsis
[64,65].
The hinge regions of PHYA genes were amplified using
PHYABnondeg-F and PHYAdeg-R (Table 1), yielding a

Page 3 of 18

~360 bp amplification product from all accessions. In
BLAST database searches, all clones had a high-scoring
pair relationship with Arabidopsis PHYA (E value ~ 2e63). Sequences from a total of more than 200 clones across
all taxa yielded two distinct consensus contigs from each
of the diploids G. herbaceum and G. raimondii, and four
distinct contigs from the allotetraploids G. barbadense
and G. hirsutum. When aligned across all taxa, these contigs yielded a 315 bp consensus alignment that had an
average pairwise sequence similarity of 94.6%, with 282
sites (89.5%) identical across all taxa, and no stop codons
or indels in any taxa. Distance analysis (Figure 2) showed
two well-separated gene sub-clades (100% bootstrap support). These sub-clades were designated PHYA1 and
PHYA2. The level of hinge-region differentiation between
these two sub-clades was far greater than that seen in
other cotton phytochrome gene sub-families (discussed
below), with an uncorrected "p" distance of 0.086, corresponding to 28 nt changes (9%) based on parsimony.
These data indicated that a single PHYA gene underwent duplication after the divergence of the cotton and
Arabidopsis lineages, but prior to the divergence of Agenome and D-genome lineages, leaving each of the modern diploids in our study (and presumably the ancestors
to the AD allotetraploids) with a complement of two
PHYA paralogs (PHYA-1 and PHYA-2). Indeed, four distinct contigs were observed in both the inbred G. hirsutum cultivar TM-1 and in the doubled-haploid line G.
barbadense 3-79. For each allotetraploid taxon, two contigs fell into each of the PHYA-1 and PHYA-2 clades (Figure 2). A conservative inventory of available EST
sequences indicated that at least two distinct PHYA loci
are expressed in G. hirsutum (Additional file 1).
Within each of the PHYA1 and PHYA2 clades, the level
of nucleotide diversity was very low, with at most four
parsimonious nucleotide changes separating each contig.
However, within the PHYA1 clade, the contigs resolved
into two subclades (74% bootstrap support) that each
contained a single contig from one of the diploid taxa and
one contig from each of the allotetraploids. For example,
G. raimondii (D-genome) PHYA1 grouped in a single
contig from each of G. hirsutum and G. barbadense.
Based on this grouping, the latter contigs were assigned
the provisional designation of PHYA1.D. Similarly, G.
herbaceum (A-genome) grouped with G. hirsutum
PHYA1.A and G. barbadense PHYA1.A. Based on similar
criteria, the PHYA2 clade was also divided into PHYA2.A
and PHYA2.D subclades (90% bootstrap support). The
phylogenetic resolution of A- and D-genome subclades
supported the hypothesis that each of the A- and Dgenome diploids contributed both PHYA1 and PHYA2 to
the allotetraploid lineage. Thus, although hinge-region
nucleotide diversity within each of the PHYA1 and
PHYA2 clades was low, it was sufficient to resolve a tentative PHYA gene complement for each taxon, as well as the

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 4 of 18

Table 1: Primers used to amplify cotton phytochrome gene family.
Primer name

Sequence 5' to 3'

Fold-degeneracy

PHYdeg-F

CAYTAYYCIGCIACIGAYATHCC

PHYdeg-R

CRCAIGCRTAICKARIGGRWAIGG

PHYABnondeg-F

GCATTATCCTGCTACTACTGATATT

0

PHYAdeg-R

CAWGCATACCTWAGMGGRAAI

64

PHYBdeg-R

AACAACIAIICCCCAIAGCCTCAT

64

1010-F

GTTYTTGTTTAAGCARAACCG

4

1910-R

GAGTCWCKCAGAATAAGC

4

1910-F

AGCTTATTCTGMGWGACTC

4

2848-R

TAACCCKCTTRTTTGCAGTCA

2

PHYC-1R-DFCI

GGTCCGCCTGATTGAGACTGC

0

768
16,384

I corresponds to inosine. R, Y, M, K, S, W correspond to the IUPAC-IUB ambiguity set.

pattern of gene inheritance through the allopolyploidization event.
Amplification of the PHYB/D gene sub-family

A ~320 bp fragment from the PHYB/D hinge region was
obtained by amplification using primers PHYABnondegF and PHYBdeg-R (Table 1). Sequences from a total of 80
clones yielded a single consensus contig from each of the
diploid cottons G. herbaceum and G. raimondii, and from
the allotetraploid G. hirsutum. Two distinct contigs were
assembled from clones derived from the allotetraploid G.
barbadense. These clone sequences shared ~85% nucleotide identity with the Arabidopsis PHYB gene and ~78%
nt identity with Arabidopsis PHYD. All clones had a highscoring pair relationship with the Arabidopsis PHYB gene
(E value ~ 1e-71) as well as significant similarity to the
Arabidopsis PHYD gene (E value ~ 3e-55). Consensus
sequences were aligned across all taxa, yielding a 319 bp
alignment with an average pairwise sequence similarity of
99.8%, with 317 sites (99.4%) identical across all taxa, no
stop codons and no indels. Although these data indicated
the presence of at least one PHYB gene in each of the Aand D-genome diploid plants and in G. hirsutum, and at
least two genes PHYB genes in the G. barbadense, the low
level of nucleotide differentiation observed within the
hinge region yielded insufficient phylogenetic information to characterize the PHYB gene complement in any of
the study taxa.

To obtain better resolution of the PHYB gene complement, additional low degeneracy primers 1010-F, 1910-F,
1910-R, and 2848-R (Table 1) were used along with
primer PHYABnondeg-F to create a 2.1 kb long series of
overlapping amplicons corresponding to approximately
1.8 kb of the Arabidopsis PHYB gene and extending from
the hinge, through the first intron and into the second
exon (Figure 1). After amplification, cloning and sequencing, the amplicons were assembled for each taxon. In all
Gossypium taxa examined, the first intron was ~300 bp
longer than the first intron of PHYB from Arabidopsis.
Unlike the other phytochrome amplicons, we detected
a high frequency of putative PCR-mediated recombination events [66] within the PHYB2.1 kb fragment from
amplifications using G. barbadense as template. The
recombination detection algorithm RDP3 [67] identified
a number of clones resulting from apparent recombination between the A-genome and D-genome derived
homeologous sequences, with predicted breakpoints (P =
0) between nucleotides 1000 and 1700 of the alignment.
After omission of these recombinant clones, composite
amplicon sequences from each taxon were aligned, creating a consensus alignment of 2,061 bp with 98.8% average
pairwise similarity and 2,007 identical sites (97.4%).
Overall, the cotton PHYB genes shared 65% nucleotide
identity with the Arabidopsis PHYB ortholog. No stop
codons or indels were detected in exon sequences. A 2 bp
putative deletion was observed in one contig (designated

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 5 of 18

PHYA
Hinge

PHYB
Hinge
PHYB 2.1 Kb

PHYC

Exon
Coding I Non-coding

(Hinge)
PHYC 1.0 Kb

Amplicon
PHYE
1 kb

Hinge

Figure 1 Gene diagrams and PCR amplicons used in this study. Model gene structures are derived from Arabidopsis thaliana annotations
(At1g09570, At2g18790. At5g35840, At4g18130). The PHYB 2.1 kb sequenced fragment represents a composite of several overlapping amplicons.

PHYB.D) from G. hirsutum. In addition, a 1 bp indel was
polymorphic between the PHYB.A and PHYB.D clades.
Finally, PHYB of G. raimondii had an additional 1 bp
insertion. All indel polymorphisms were located within
first introns.
Detailed phylogenetic analyses of the 2,061 bp contigs
from A-, D-, and AD-genome cottons (Figure 3) indicated
the presence of least one PHYB locus in the two diploid
cottons, G. herbaceum and G. raimondii, and at least two
PHYB loci in both allotetraploid cottons. The G. hirsutum
and G. barbadense sequence contigs each grouped into
two sub-clades (tentatively designated PHYB.A and
PHYB.D). The single PHYB contig from G. herbaceum
was used to define the PHYB.A cluster (99% bootstrap
support), while the single PHYB contig from G. raimondii
anchored the PHYB.D cluster. From these results, we
concluded that PHYB.A and PHYB.D, which shared ~98%
nucleotide sequence identity, arose as orthologs at the
time of divergence of the A- and D-genome diploid lineages. We surmised that PHYB.A was contributed to the
allotetraploids via the A-genome ancestor and PHYB.D
was contributed via the D-genome ancestor. Available
EST sequences indicated that at least one PHYB locus is
expressed in G. hirsutum (Additional file 1).
Amplification from the PHYC gene sub-family

Several sets of degenerate primer pairs that were
designed on the basis of the conserved HYPATDIP and

PFPLRYAC regions -- including several designed from
rosid PHYC nucleotide sequences -- failed to produce
detectable PCR amplification products from the Gossypium species tested (data not shown). However, the identification of a small EST clone (GenBank CO121409) with
similarity to Arabidopsis PHYC (E value = 7e-119) in a
library from G. raimondii floral tissue [68], allowed us to
design the primer PHYC_1R_DFCI within the C-terminal
domain (Table 1). When used in combination with PHYdeg-F, this primer amplified a ~1 kb fragment composed
entirely of coding sequence from the first exon of PHYC,
including the hinge (Figure 1). All clones obtained using
this primer pair had a high-scoring similarity to Arabidopsis PHYC (E value ~ 1e-172). From these clones, we
assembled a single consensus contig from each of the diploid species G. herbaceum and G. raimondii, and two distinct consensus contigs from each of the allotetraploids
G. hirsutum and G. barbadense. Consensus sequences for
each of the putative PHYC contigs were aligned across all
taxa, yielding a 1,022 bp alignment with an average pairwise sequence similarity of 99.1%, 1,002 sites (98.0%)
identical across all taxa, with no indels or stop codons in
any taxa.
In phylogenetic analyses (Figure 4), the PHYC consensus sequences grouped into two major clades (100% bootstrap support). One of these clades contained the G.
herbaceum contig and one contig from each of G. hirsutum and G. barbadense. This clade was designated

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

PHYA2

Page 6 of 18

G.raimondii PHYA2
0.005 / 2

G.barbadense PHYA2.A
G.hirsutum PHYA2.A
G.herbaceum PHYA2

G.hirsutum PHYA2.D
G.barbadensePHYA2.D

0.006 / 2
90

0.005 substitutions/site

100

0.086 / 28

PHYA1
G.herbaceum PHYA1
G.hirsutum PHYA1.A

0.002 / 1

G.barbadense PHYA1.A

74 0.003 / 1
0.003 / 1

G.hirsutum PHYA1.D 80
G.barbadense PHYA1.D

0.004 / 1

G.raimondii PHYA1

Figure 2 Unrooted NJ tree of Gossypium spp. PHYA-related genes based on a ~315 bp consensus alignment of amplification products from
the hinge region. Distances (uncorrected "p") and most parsimonious number of nt changes are indicated for each branch (to the left and to the
right of the/, respectively). Branch lengths of less than 0.001 substitutions per site are not shown. Bootstrap support (500 replicates) is indicated where
>50%.

PHYC.A. The other clade, designated PHYC.D, included
the G. raimondii contig along with the other of the two
contigs from each of G. hirsutum and G. barbadense.
These data indicated that both the A- and D-genome

ancestors had one PHYC gene, and that upon hybridization and polyploidization, this gene was contributed from
each diploid to the allotetraploid ancestor of G. hirsutum
and G. barbadense.

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 7 of 18

G. barbadense PHYB.A

0.002 / 5

G. hirsutum PHYB.A

1

2

G.herbaceum PHYB

0.001 substitutions/site

100 0.012 / 24

0.003 / 6
99

0.004 / 9
G. raimondii PHYB

2
G. barbadense PHYB.D

2
G. hirsutum PHYB.D

Figure 3 Unrooted NJ tree of Gossypium spp. PHYB-related genes based on the consensus alignment of the ~2.1 kb merged amplicons. Distances (uncorrected "p") and most parsimonious number of nucleotide changes are indicated for each branch (to the left and to the right of the/,
respectively). Branch lengths of less than 0.001 substitutions per site are not shown. Bootstrap support (500 replicates) is indicated where >50%.

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 8 of 18

G. hirsutum PHYC.A

0.004 / 4

G. barbadense PHYC.A

0.002 / 1
0.001 / 1
58

0.001 / 1 G. herbaceum PHYC

0.005 substitutions/site

100

0.001 / 1

G. raimondii PHYC
G. barbadense PHYC.D

91

0.008 / 8

0.001 / 1

G. hirsutum PHYC.D

Figure 4 Unrooted NJ tree of Gossypium spp. PHYC-related genes based on a 1022 bp consensus alignment of amplification products from
primers PHYdeg-F and PHYC_1R_DFCI. Distances (uncorrected "p") and most parsimonious number of nucleotide changes are indicated for each
branch (to the left and to the right of the/, respectively). Bootstrap support (500 replicates) is indicated where >50%.

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

For comparison with the other phytochromes, we also
analyzed a portion of the PHYC alignment corresponding
to the hinge region only. This alignment was 296 nucleotide pairs in length, with pairwise sequence similarity of
99.0%, 290 sites (98.0%) identical across all taxa, with no
indels. Although it encompassed fewer variable nucleotides, NJ analysis of the hinge region alone could be used
to differentiate the PHYC.A and PHYC.D clades (100%
bootstrap support) and to infer the composition and evolutionary inheritance of the PHYC gene family in cottons
(data not shown).
Our failure to obtain PHYC hinge amplification with
several sets of both universal (e.g. PHYdeg-F/PHYdeg-R)
and rosid specific primers was entirely due to substantial
nucleotide differentiation in PHYC, particularly within
the hinge region. For example, the 24 nt long PHYdeg-R
primer had six nucleotide mismatches with the cotton
PHYC genes, including three transitions and three transversions. Five of the six mismatches occurred at what are
considered to be invariant (e.g. non-degenerate) nucleotide positions. It should be noted that these divergent
nucleotides in the conserved primer-binding site did not
alter the amino acid sequence (PFPLRYAC).
The PHYE gene sub-family

PHYE hinge region consensus contigs from our study
taxa formed a 270 bp alignment with an average pairwise
similarity of 98.9%, with 264 (97.8%) invariant sites, no
indels, and no stop codons in any taxa. The consensus of
the aligned PHYE sequences had 80% nucleotide similarity to the corresponding fragment of the Arabidopsis
PHYE gene. Based on maximum parsimony, nucleotide
diversity in the cotton PHYE hinge sequences could be
explained by a minimum of six nucleotide changes, all of
which were synonymous. NJ analysis of the cotton PHYE
hinge region showed two distinct clades (97% bootstrap
support) corresponding to the A- and D-genome derived
orthologs (designated PHYE.A and PHYE.D), a finding
consistent with a hypothesis in which each diploid ancestor contributed a single PHYE ortholog to the allotetraploid lineage (Figure 5). Interestingly, while two distinct
PHYE contigs were obtained from G. hirsutum, only a
single contig, which grouped with the D-genome clade,
was obtained from G. barbadense. Available EST
sequences indicated that at least one PHYE locus is
expressed in G. hirsutum (Additional file 1).
A global hinge-based alignment of Arabidopsis and cotton
phytochromes

PHYA, PHYB, PHYC and PHYE hinge regions from Arabidopsis and Gossypium spp. were aligned to create a
global phytochrome alignment 358 nucleotides in length,
with an average pairwise similarity of 69.4% and 123 identical sites (34.4%). The gene phylogeny generated from

Page 9 of 18

this alignment (Figure 6) reflected divergence of PHYA,
PHYB, PHYC and PHYE as a result of speciation (nodes
1A, 1B, 1C and 1E, respectively) and gene duplication
(nodes 2 and 3). The level of nucleotide divergence of
each of the gene sub-families after nodes 1A, 1B, 1C and
1E (Kimura 2-parameter distances) was similar, with a
mean of 0.297 ± 0.21 nucleotide substitutions per site.
However, the synonymous (KS) and non-synonymous
(KA) substitution rates were both significantly more variable among the various gene sub-families defined by
nodes 1A, 1B, 1C and 1D than were simple nucleotide
distances (Table 2). Despite this variation, all sub-families
showed a KA/KS ratio <0.1, implying that each remains
under purifying selection for function. Further, excessively long branch-lengths, which are often found in
pseudogenes, were not observed. In the PHYB, PHYC and
PHYE clades, the branch lengths leading to the Arabidopsis orthologs, which have known biological functions,
were longer than the branches leading to their respective
cotton orthologs. Considered together, these lines of evidence indicate that each of the phytochrome sub-families
retains some biological function in Gossypium, as they do
in Arabidopsis [14-16,18-31]. Further, our topology supports the conclusion that PHYD is the result of a relatively
recent gene duplication that may be exclusive to the Brassicaceae family [16].

Discussion
Resolution of the phytochrome gene family

In three out of four cases, we were able to successfully
resolve the inventory and evolutionary relationships of
the phytochrome genes in diploid and allotetraploid cottons using the hinge region only. This finding supports
the general utility of employing the hinge region for identifying GSTs for phytochromes. In only one case (PHYB)
was additional gene sequence required for sufficient phylogenetic resolution. In another case (PHYC), nucleotide
divergence at a commonly used primer-binding site prevented the characterization of the hinge region by the
typical strategy of using primers based on conserved
flanking peptides HYPATDIP and PFPLRYAC. However,
nucleotide diversity within the PHYC hinge region itself
was sufficiently informative to resolve the pattern of evolutionary inheritance through allotetraploidization event.
The sequencing of phytochrome gene fragments from
A- and D-genome diploids, as well as from AD allotetraploid taxa, provides an essential foundation for all subsequent analysis of phytochrome function and evolution in
Gossypium. The sequenced fragments provide sufficient
information (at least two diagnostic nucleotide characters) to unequivocally identify or 'tag' various orthologs,
homeologs and paralogs, as well as monitor their patterns
of nucleotide divergence, and trace their evolutionary

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 10 of 18

G.raimondii PHYE
0.004 / 1

G.barbadense PHYE.D
0.004 / 1

G.hirsutum PHYE.D

0.011 / 3

97

0.005 substitutions/site

G.hirsutum PHYE.A

0.004 / 1

G. herbaceum PHYE
Figure 5 Unrooted NJ tree of Gossypium spp. PHYE-related genes based on a 270 bp consensus alignment of amplification products from
the hinge region. Distances (uncorrected "p") and most parsimonious number of nucleotide changes are indicated for each branch. Branch lengths
of less than 0.001 substitutions per site are not indicated. Bootstrap support (500 replicates) is indicated where >50%.

inheritance through the allopolyploidization event. This
information will serve as a foundation for further
sequence assembly and annotation, and will be used to
design locus-specific primer sets for quantitative RT-PCR
assays that will measure transcript levels for each gene
family member. In some cases (e.g. PHYA1 vs. PHYA2)
levels of sequence divergence are high enough to support

studies of gene function using RNAi or amiRNA
approaches to create gene-specific knockouts [69]. The
use of well characterized 'candidate genes' of agronomic
interest is becoming an integral component of markerassisted selection efforts in plants [70]. Several SNPbased molecular markers [71,72] are now being developed using the diagnostic nucleotide characters identi-

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 11 of 18

Table 2: Nucleotide divergence in phytochrome genes in comparisons of Arabidopsis and cotton
K-2P

S Dif

Ks

NS Dif

KA

Ka/Ks

Node 1A

0.291

46.5

1.82

27.4

0.123

0.068

Node 1B

0.296

36.5

1.00

17.5

0.086

0.090

Node 1C

0.274

41.0

1.55

30.3

0.147

0.095

Node 1E

0.326

49.0

>2.0

23.0

0.122

<0.061

Node 3

0.094

17.0

0.309

11.8

0.050

0.163

Nodes refer to the NJ tree in Figure 6. K-2P indicates the mean Kimura 2-parameter distances between Arabidopsis and cotton gene
sequences.

fied in this study, and are being mapped in experimental
cotton populations that show segregation of phytochrome-controlled traits such as fiber length and flowering time.
The ancestral phytochrome gene complement of the
Malvales and Brassicales

Our study indicated that the diploid ancestors to the
world's major fiber crops (G. hirsutum and G. barbadense) had a complement of phytochrome apoprotein
genes that was very similar to that of the model plant
Arabidopsis thaliana. This was not entirely unexpected
given the relatively close phylogenetic relationship of the
two lineages [64,65]. The most-simple evolutionary scenario is that the last common ancestor of Arabidopsis and
cotton, possibly an arborescent species in the late Cretaceous period [65], had a phytochrome gene complement
consisting of one functional gene in each of the PHYA,
PHYB/D, PHYC and PHYE subfamilies.
PHYA duplication in Gossypium

After the divergence of the Malvales and Brassicales, the
ancestral PHYA gene underwent duplication resulting in
the observed PHYA-1 and PHYA-2 paralogs of modern
Gossypium spp. As the A- and D-genome diploids have
both paralogs, the duplication event occurred prior to the
divergence of the A- and D-genome lineages. Using 85
MYA (range 68 MYA to 96 MYA) as a rough estimate of
the time of divergence of the Malvales and Brassicales
[64,73], along with our observed Ks of 1.82 in the PHYA
hinge region in this time interval, we can derive a crude
estimate of 0.011 substitutions/synonymous-site/million
years, and an estimate of the time of PHYA duplication of
~14 MYA. This estimate places the duplication well
within the crown group of Malvales and the Malvaceae
family [65]. Given our time estimate, the PHYA duplication may be exclusive to the genus Gossypium, but would

have occurred prior to the estimated time of divergence
of the A and D genome groups [62]. As neither we nor
others [58,62,74] have observed evidence of additional
nuclear gene duplications or chromosomal duplications
in this time period, the PHYA event was likely a tandem
or segmental duplication, rather than whole genome
duplication.
After a gene duplication event, one of the two newly
duplicated genes is theoretically unconstrained by selection for function, and is thus free to accumulate mutations leading to a pseudogene fate, subfunctionalization,
or neofunctionalization [75-80]. Although we did not
obtain definitive evidence of pseudogenic sequences in
any of the phytochromes or taxa studied (e.g. no stop
codons or frameshift mutations), we did observe significant variation in KA/Ks ratios in pairwise interspecific
comparisons (discussed below), leaving open the possibility of pseudogene outcomes. Alternatively, one of the
duplicated genes may undergo positive selection to gain a
novel function (neofunctionalization). Further, duplicated gene-pairs may subdivide the function of ancestral
gene (subfunctionalization). Perhaps the most intriguing
fate, which has been observed empirically, but not yet
explained in theory, is the situation in which both gene
copies may be retained for a lengthy period under what
appears to be purifying or negative selection [79,80]. One
approach to understanding the evolutionary fates of
duplicated genes is through an analysis of the signature of
natural selection on amino acid encoding sequences.
Although the hinge regions of phytochromes display
relatively high levels of nucleotide diversity [81], they do
not evolve under neutrality. The hinge region participates
in inter-domain communication in phytochrome molecules [82]. For example, phosphorylation of a serine residue in the PHYA hinge plays a likely role in regulating
protein-protein interactions between phytochrome and
downstream signal-transducing molecules [83]. Com-

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 12 of 18

Gossypium PHYA1

Gossypium PHYA2

0.052

0.042

3

AtPHYA
0.143

0.096

AtPHYC

1A
0.153
0.135
0.120

AtPHYD

1C
0.121

0.122
0.074

2

0.087

AtPHYB

0.062

Gossypium PHYC
0.054

1B

0.039

1E
0.118

0.112

Gossypium PHYB

0.1 substitutions/site

Gossypium PHYE
0.208

AtPHYE

Figure 6 Unrooted NJ tree of phytochrome genes of A. thaliana and cottons (Gossypium spp.) based on a 358 bp consensus alignment of
amplification products from the hinge regions. Kimura two-parameter distances are shown for each branch. All internal branches had 100% bootstrap support (500 replicates). 1A, 1B, 1C and 1E denote gene divergence events likely resulting from speciation. 2 and 3 denote gene divergence
events likely resulting from gene duplication. All Gossypium phytochrome genes are included within clusters (indicated by ovals).

pared to wild-type, a mutation in the hinge region of Arabidopsis PHYB is deficient in localization into distinct
nuclear bodies [84]. Further, a single nucleotide polymorphism (SNP) in the hinge of one of two PHYB genes in
Aspen (Populus tremula, Salicaceae) was associated with
natural geographic variation in the timing of bud-set [85].
In comparisons between cotton and Arabidopsis (Table
2), the KA/Ks ratio for the PHYA hinge region was 0.068 -a value that is typical for genes under purifying selection
[86]. In contrast, the KA/Ks ratio for PHYA after gene
duplication (node 3) was 0.163, or ~2.4-fold higher. This
value is also ~2.1-fold greater than the mean KA/Ks ratio
of all phytochrome hinge regions (corresponding to
nodes 1A, 1B, 1C, and 1D in figure 6) of approximately

0.079 ± 0.014. This significantly elevated KA/Ks ratio after
the PHYA duplication could be attributed to a relaxation
of stabilizing selection and/or subfunctionalization of the
nascent PHYA paralogs (these two alternative possibilities are remarkably difficult to distinguish on the basis of
sequence information alone).
The possible functional divergence of PHYA1 and
PHYA2 may be more pronounced after the separation of
the A- and D-genome lineages (Table 3). A comparison of
PHYA2 in the two diploids yields a KA/Ks ratio of ~8.2,
primarily due to amino acid substitutions in PHYA2.D,
while PHYA1 has a KA/Ks ratio of 0.000 in the same taxonomic comparisons. Although this difference is suggestive of possible differential rates of functional evolution in

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

Page 13 of 18

the paralogs, it is not statistically significant in Fisher's
exact test (P = 0.2485). It will be of interest to determine
whether the cotton PHYA paralogs have distinct functions. Experiments are underway to determine the
respective biological functions of each PHYA-1 and
PHYA-2 in G. hirsutum and G. barbadense using paralogspecific RT-PCR, RNAi gene knockout, and tests for
genetic associations between phytochrome-controlled
phenotypic traits and PHYA-1 and PHYA-2 specific
molecular markers. A 'candidate gene' approach has
recently been used in soy (Glycine max) to uncover a
genetic linkage between the photoperiod insensitivity
locus E4 and one of the two the PHYA genes, designated
GmphyA1 and GmphyA2 [57]. Loss of photoperiodic

the major deleterious phenotypic effects that would have
been caused by complete deficiency of PHYA gene function.
Persistence and loss of phytochrome paralogs after
allopolyploidization

All phytochromes underwent gene duplication by polyploidization at the time of formation of the AD allotetraploids, on the order of 0.5-2.0 MYA [59,61,63,87]. For
example, in G. hirsutum, we detected a minimum set of
ten distinct phytochrome genes, including four PHYA
genes. In order to assess the evolutionary trajectory of
these recently duplicated genes, we examined the synonymous and non-synonymous divergence rates of A- and D-

Table 3: Nucleotide divergence in phytochrome genes in comparisons of A- and D-genome derived homeologs in diploid
and allotetraploid cottons.
Sequence

Comparison

PHYA1 Hinge

Ks

2.25

67.17

0.102

0.0

2.5

67

0.038

0.0

D-D

1.0

66.42

0.015

3.0

1.0

66.38

0.015

2.0

1.0

66.33

0.015

D-D

8.0

377.33

0.022

D-T

9.0

377.34

0.024

8.0

T-T

10

377.42

0.027

9.0

D-D

3.0

60.83

0.051

1.0

D-T

3.25

60.67

0.055

1.25

T-T

3.5

60.5

0.06

D-D

7.0

224.67

0.032

D-T

8.0

224.84

0.037

4.5

T-T

9.0

225

0.041

6.0

D-D

4.0

60.42

0.069

1.0

D-T

3.75

60.46

0.065

0.5

T-T

PHYE Hinge

67.33

T-T

PHYC 1.0 kb

2.0

D-T

PHYC Hinge

D-D

T-T

PHYB 2.1 kb

S pos

D-T

PHYA2 Hinge

S dif

3.5

60.5

0.06

0.0

0.303

NS dif

NS pos

0.0

241.67

KA

KA/Ks

P

0.000

0.000

0.049

241.84

0.000

0.000

0.039

242.00

0.000

0.000

0.030

242.58

0.125

8.224

0.622

242.63

0.065

4.247

0.504

1.0

242.67

0.004

0.270

0.386

7.0

1293.67

0.005

0.251

0.010

1293.63

0.006

0.256

0.006

1293.58

0.007

0.300

0.004

230.17

0.004

0.086

0.032

230.09

0.005

0.103

0.035

1.5

230.00

0.007

0.119

0.038

3.0

795.33

0.004

0.120

0.002

795.17

0.006

0.156

0.003

795.00

0.008

0.184

0.002

206.58

0.005

0.071

0.012

206.54

0.003

0.042

0.015

206.50

0.000

0.000

0.008

D-D indicates means of comparisons within extant diploids, D-T indicates means of comparisons of extant diploids with tetraploids, T-T
indicates means of comparisons within tetraploids. S dif, synonymous differences; S pos, synonymous positions; NS dif, non-synonymous
differences; NS pos, non-synonymous positions. P indicates significance as determined by Fisher's exact test.

flowering is associated with a Ty1/copia-like retrotransposon insertion into exon 1 of GmphyA2. The authors
argue that gene duplication and partial redundancy of the
PHYA genes may have facilitated the loss of photoperiod
sensitivity by allowing the GmphyA2 (E4) mutant to avoid

genome phytochrome orthologs and homeologs (Table 3)
in pairwise comparisons of 1) diploids with diploids (DD), 2) diploids with tetraploids (D-T), and 3) tetraploids
with tetraploids (T-T). Given that the allotetraploid cottons had both A- and D-genome derived copies of each

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

gene on the order of hundreds of thousands of years, we
hypothesized that there may be a relaxation of selection
in the allotetraploids, as one of the two copies should no
longer be evolutionarily constrained.
However, in comparisons of A- vs. D-genome derived
orthologs or homeologs for six GSTs (Table 3), we did not
observe dramatic differences in KA/Ks between diploid
and allotetraploids in any GST except the hinge region of
PHYA2 (in this case, the observed KA/Ks ratio was actually ~30-fold higher in the extant diploids than in the allotetraploids). Because of low levels of nucleotide
divergence, we employed Fisher's exact test [88] and
found no significant differences in the patterns of nucleotide evolution in allotetraploids vs. diploids. Thus, there
was no broad evidence of relaxation of natural selection
on gene function after gene duplication by allotetraploidization. Further, the generally low KA/Ks ratios
across all genes and taxa support a model in which that
the phytochrome homeologs are largely evolving independently by a birth-and-death model rather than concerted evolution [89].
The coding sequences of the PHYB 2.1 kb fragment also
appeared be evolving under stabilizing selection in both
the diploids (KA/Ks = 0.251) and allotetraploids (KA/Ks =
0.300) reflecting continued selective constraint on coding
sequence evolution after polyploidization. However,
there was a significant excess of non-synonymous substitutions in both diploids and allotetraploids (P = 0.01 and
P = 0.004, respectively, in Fisher's exact test) indicating a
partial relaxation of negative selection and/or functional
divergence of the PHYB homeologs.
In the allotetraploid cottons, both PHYC.A and
PHYC.D are also evolving in a pattern consistent with
purifying selection (KA/Ks = 0.184 over 340 codons).
However, it should be noted that the PHYC.D clade
appears to be evolving at distinctly faster rate (8 parsimonious substitutions, including 6 non-synonymous) than
the PHYC.A clade (2 parsimonious substitutions, both
synonymous). This suggests either a relaxation of purifying selection in, or functional divergence of PHYC.D. In a
similar study of phytochromes in cultivated sorghum
(Sorghum bicolor) and its wild congeneric relatives [90],
PHYC was undergoing faster amino acid evolution than
PHYA or PHYB. In the both the PHYB and PHYC gene
subfamilies of cotton, the sequences of the C-terminal
signaling domain had higher KA/Ks ratios than the corresponding hinge region alone. This may reflect the co-evolution of protein-protein interactions with downstream
signaling partners, which are mediated by the C-terminal
'signal transduction' domain [1-6].
While PHYE-related contigs had low KA/Ks values
(0.000 to 0.071), indicating purifying selection, no contig
corresponding to an expected G. barbadense PHYE.A

Page 14 of 18

ortholog was observed. This may have been due to undersampling of G. barbadense clones for sequencing, or due
to nucleotide divergence in primer sites (as observed in
PHYC). Of the 16 PHYE-like clone sequences obtained
from G. barbadense, all were in the D-genome derived
clade, which would be an unlikely result (P < 0.005, chisquare test) assuming equal amplification efficiencies for
PHYE.A and PHYE.D. Alternatively, the apparent lack of
a PHYE.A ortholog in G. barbadense could be explained
by concerted evolution, gene conversion, or by PCRmediated recombination [66,87]. Overall, the PHYE
genes, like the other cotton phytochromes, had more synonymous than non-synonymous nucleotide substitutions, favoring a birth-and-death model of gene
evolution.

Conclusions
Our preliminary efforts to obtain an inventory of the cotton phytochrome gene family (based largely on 'hinge'
region) indicated that diploid A- and D-genome diploid
cottons have two paralogous PHYA genes (designated
PHYA1 and PHYA2), and one each of PHYB, PHYC, and
PHYE gene sub-families. Coding sequence evolution in
PHYA2 was significantly elevated, suggesting loss of
selection for function, or incipient subfunctionalization.
Other than this duplication and the lack of a separate
PHYD gene, the phytochrome complement of diploid
cottons was very similar to that observed in the closely
related model plant Arabidopsis thaliana, which greatly
facilitates cross-species comparisons.
Whole genome duplication via allopolyploidization
(~0.5-2.0 MYA) resulted in additive amalgamation of
phytochrome genes within a single nucleus in the allotetraploid, retaining complete gene complements of at least
four PHYA genes, two genes of each PHYB, PHYC and
PHYE in AD-genome G. hirsutum. G. barbadense may
lack the PHYE gene contributed by the A-genome ancestor. Strong purifying selection on nearly all of the phytochrome genes suggests some level of conservation of
function of each of the genes after polyploidization. With
the possible exception of one of the PHYE.A homeologs
in G. barbadense, we did not see evidence of gene loss.
We did not observe any convincing evidence of concerted
evolution by gene conversion. Rather, the genes duplicated by allopolyploidy appear to be largely retained, and
evolving independently as observed in 48 other nuclear
genes in allotetraploid cottons [86].
These results further our understanding of the evolutionary fates of duplicate genes following allopolyploidization. Information on key evolutionary events
(such as duplications), as well as rates and patterns of
evolutionary change, are an important component of the
functional annotation of genes and genomes [91]. These
data provide the foundation for more comprehensive

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

studies of the biological functions of each of the cotton
paralogs and homeologs. The development of phytochrome 'candidate gene' markers based on the GSTs identified here may prove useful in the mobilization of
valuable genes from photoperiodic wild and primitive
cottons into elite cotton varieties, in order to improve
stress tolerance, disease resistance, fiber quality, and
other traits.

Methods
Plant Materials

To simplify the assignment of sequences to orthologous
or paralogous phytochrome loci (as opposed to alternative alleles at a single locus) we employed diploid and
allotetraploid strains that were highly homozygous. Diploid cotton species G. raimondii Ulbr. and G. herbaceum
L. were obtained from the cotton germplasm collection at
the Institute of Genetics and Plant Experimental Biology,
Tashkent, Uzbekistan. These lines had been maintained
by selfing for multiple generations. Genetic standard genotypes G. hirsutum L. cv. TM-1 and G. barbadense L. cv.
3-79 were obtained from the USDA-ARS Cotton Germplasm Unit, at College Station, Texas, USA. G. hirsutum
cv. TM-1 [92] is a highly inbred line (>40 generations of
selfing). G. barbadense cv. 3-79 is a doubled-haploid line
[93].
Genomic DNA isolation and PCR Amplification

Genomic DNAs were isolated from fresh leaf tissue of
individual plants from each taxon using the method
described by Dellaporta et al. [94]. The primers used in
this study (Table 1) were designed using sequences from
phytochromes of dicotyledonous plants obtained from
the GenBank database http://www.ncbi.nlm.nih.gov and
aligned using CLUSTALX software [95]. These included
the degenerate primer pair PHYdeg-F/PHYdeg-R, which
was designed to amplify the hinge region of the entire
phytochrome gene family, and primer pairs PHYABnondeg-F/PHYAdeg-R and PHYABnondeg-F/PHYBdeg-R,
designed to amplify the hinge regions of the PHYA and
PHYB/D subfamilies, respectively. In order to amplify
additional regions of several the cotton phytochrome
genes, degenerate primers that amplify amplicons downstream of the hinge region (in the C-terminal domain)
were also designed using this approach. Conserved
regions that had approximately 40-55% G+C content
were used for primer design. The primer design criteria
have been described [96].
PCR reactions were performed in a Robocycler thermocycler (Agilent, USA) with an initial denaturation
cycle at 94°C for 3 min., followed by 45 cycles of 94°C for
1 min., 55°C for 1 min. (annealing) and 72°C for 2 min.
(extension), followed by a single 5 min. extension at 72°C.
A manual 'hot start' cycling protocol was performed

Page 15 of 18

through the addition of Thermus aquaticus (Taq) DNA
polymerase in the annealing step of first cycle.
DNA Sequence analyses

PCR products were cloned into the vector pCR4-TOPO
and transformed into E. coli TOP10 cells according to
manufacturer's instructions (Invitrogen, USA). Cloning
was necessary to resolve sequences of duplicated genes.
Recombinant plasmids were purified by miniprep (Qiagen, USA) and sequenced using Big-Dye DNA version 1
cycle sequencing chemistry (Applied Biosystems, USA)
along with vector-specific forward and reverse primers.
As native Taq polymerase has an appreciable nucleotide
substitution error rate [97], at least 10 clones were
sequenced for each amplicon from each diploid taxon,
and 20 clones were sequenced from each allotetraploid
taxon. Unincorporated dye-labeled terminators were
removed from the extension products by Bio-gel P-30
spin column purification (Bio-Rad, USA). Extension
products were sequenced using the ABI 310 and ABI3130
Genetic Analyzers (Applied Biosystems, USA).
Data analyses

Double-stranded, finished sequences for each clone were
assembled with Sequencher 4.8 software (Gene Codes,
USA). After trimming of vector and amplification primers, sequences were searched against GenBank databases
using BLASTN [98]. Searches of the non-redundant
nucleotide database (nr) and the Arabidopsis thaliana
database (Taxid: 3702) were performed using the "discontinuous megablast" method as implemented by the NCBI
database [99]. Alignments of clones obtained from each
amplicon/taxon combination were performed using
ClustalX. Within each taxon, clone sequences were
grouped into contigs on the basis of (in all cases) at least
two shared diagnostic SNPs and (if present) shared indel
polymorphisms. When a single clone differed from other
clones in the same consensus contig at a single nucleotide
position, these sporadic differences were assumed to be
products of Taq polymerase substitution error [97].
Consensus sequences were then aligned across all taxa
and used for phylogenetic analyses. Distance-based phylogenetic trees were generated using neighbor-joining
[100], using a minimum evolution objective, with gaps
(indels) ignored, and either uncorrected "p" distances or
Kimura two-parameter distances [101], as noted in the
figure legends. Parsimony analysis was performed by an
exhaustive search implemented by the PAUP software
package version 4.0b10 [102]. The robustness of each
phylogenetic tree was evaluated by bootstrap replication
[103]. Estimates of synonymous substitution rate KS and
non-synonymous substitution rate KA were based the
Jukes-Cantor correction [104] and calculated by the
method of Nei and Gojobori [105] as implemented by the

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

DnaSP ver. 5 software package [106]. The significance of
differences in KA and KS were determined by Fisher's
exact test [88]. Sequence alignments were scanned for
possible recombination using the software package
RDP3, employs a suite of recombination detection and
analysis methods [67]. Phytochrome ESTs from Gossypium spp. were identified in GenBank by searching nonhuman, non-mouse ESTs (est_others) and Gossypium
(Taxid: 3633) using the "discontinuous megablast"
method as implemented by the NCBI database [99].

Page 16 of 18

5.
6.
7.

8.

9.

10.

Additional material
Additional file 1 A summary of phytochrome ESTs from Gossypium. A
summary of non-redundant, high-quality ESTs from the GenBank database,
accessed on November 15, 2009. HSP: high scoring pair relationship with
the corresponding Arabidopsis thaliana ortholog; Min loci: estimate of the
minimum number of genomic loci identified by the ESTs (based on
sequence differences).

11.
12.

13.
14.

Abbreviations
amiRNA: artificial micro-RNA; bp: base pair(s); FR: far-red light; indel: insertion/
deletion polymorphism; KA: non-synonymous nucleotide substitution rate; kb:
kilobase(s); kDa: kiloDalton; KS: synonymous nucleotide substitution rate; MYA:
million years ago; NJ: neighbor joining; nt: nucleotide; PCR: polymerase chain
reaction; R: red light; RNAi: RNA interference; SNP: single nucleotide polymorphism.

15.

16.

Authors' contributions
IYA and AEP designed the experiment. IYA designed most of the PCR primers
and cloned the PHYA, PHYB and PHYE gene families. ZTB performed DNA
sequencing of phytochrome genes. CJLY isolated, cloned and sequenced the
PHYC gene family and participated in the sequencing of PHYA, PHYB and PHYE
genes. IYA, AA, CJLY, and AEP performed data interpretation and drafted the
manuscript. All authors read and approved the final manuscript.

17.

Acknowledgements
The UMID Presidential Fund of the Government of Uzbekistan provided support for the I.Y.A. to conduct research at Texas A&M University. The USDA-ARS
International Research Programs provided research grant support for this study
under the project P-121. We acknowledge the help of the Science and Technology Center of Ukraine with the P-121 project coordination. CJLY was supported by a Texas A&M University Regent's Fellowship and a Cotton
Incorporated Fellowship (Project 08-380). We wish to thank Kostantin V. Krutovsky for helpful advice, Millie Burrell for critical reading of the manuscript,
and Kamal M. El-Zik for his valued mentoring.

20.

Author Details
1Center of Genomic Technologies, Academy of Sciences of Uzbekistan. Yuqori
Yuz, Qibray region Tashkent, 111226 Uzbekistan and 2Department of Biology,
Texas A&M University, College Station, Texas 77843, USA
Received: 5 August 2009 Accepted: 20 June 2010
Published: 20 June 2010
© 2010 Abdurakhmonov et http://www.biomedcentral.com/1471-2229/10/119
This is an Open Access from:al;distributed under Central Ltd. the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
BMC articleBiology 2010, 10:119
Plant is available article licensee BioMed the terms of

References
1. Kendrick RE, Kronenberg GHM: Photomorphogenesis in plants 2nd edition.
Kluwer Academic Publishers, Dordrecht, the Netherlands; 1994.
2. Quail PH: Photosensory perception and signal transduction in plants.
Curr Opin Gen Dev 1994, 4:652-661.
3. Smith H: Physiological and Ecological Function within the
Phytochrome Family. Annu Rev Plant Phys 1995, 46:289-315.
4. Chun L, Kawakami A, Christopher DA: Phytochrome A Mediates Blue
Light and UV-A-Dependent Chloroplast Gene Transcription in Green
Leaves. Plant Physiol 2001, 125:1957-1966.

18.

19.

21.

22.
23.
24.

25.

26.
27.

28.

29.
30.

Quail P: Phytochrome: a light-activated molecular switch that regulates
plant gene expression. Annu Rev Genet 1991, 25:389-409.
Rockwell NC, Su YS, Lagarias JC: Phytochrome Structure And Signaling
Mechanisms. Annu Rev Plant Phys 2006, 57:837-858.
Sharrock RA, Quail PH: Novel phytochrome sequences in Arabidopsis
thaliana: structure, evolution, and differential expression of a plant
regulatory photoreceptor family. Genes Dev 1989, 3:1745-1757.
Schneider-Poetsch HAW, Marx S, Kolukisaoglu HU, Hanelt S, Braun B:
Phytochrome evolution: phytochrome genes in ferns and mosses.
Physiol Plantarum 1994, 91:241-250.
Kolukisaoglu HU, Marx S, Wiegmann C, Hanelt S, Schneider-Poetsch HAW:
Divergence of the phytochrome gene family predates angiosperm
evolution and suggests that Selaginella and Equisetum arose prior to
Psilotum. J Mol Evol 1995, 41:329-337.
Mathews S, Lavin M, Sharrock RA: Evolution of the phytochrome gene
family and its utility for phylogenetic analyses of angiosperms. Ann Mo
Bot Gard 1995, 82:296-321.
Wada M, Kanegae T, Nozue K, Fukuda S: Cryptogam phytochromes.
Plant Cell Environ 1997, 20:685-690.
Wu SH, J Lagarias JC: The phytochrome photoreceptor in the green alga
Mesotaenium caldariorum: implication for a conserved mechanism of
phytochrome action. Plant Cell Environ 1997, 20:691-699.
Mathews S: Phytochrome Evolution in Green and Nongreen Plants. J
Hered 2005, 96:197-204.
Clack T, Mathews S, Sharrock RA: The phytochrome family in Arabidopsis
is encoded by five genes: the sequence and expression of PHYD and
PHYE. Plant Mol Biol 1994, 25:413-27.
Cowl JS, Hartley N, Xie DX, Whitelam GC, Murphy GP, Harberd NP: The
PHYC gene of Arabidopsis: absence of the third intron found in PHYA
and PHYB. Plant Physiol 1994, 106:813-814.
Mathews S, McBreen K: Phylogenetic relationships of B-related
phytochromes in the Brassicaceae: Redundancy and the persistence of
phytochrome D. Mol Phylogenet Evol 2008, 49:411-23.
Pratt LH: Phytochromes: differential properties, expression patterns
and molecular evolution. Photochem Photobiol 1995, 61:10-21.
Devlin PF, Patel SR, Whitelam GC: Phytochrome E influences internode
elongation and flowering time in Arabidopsis. Plant Cell 1998,
10:1479-1487.
Reed JW, Nagatani A, Elich TD, M Fagan M, Chory J: Phytochrome A and
phytochrome B have overlapping but distinct functions in Arabidopsis
development. Plant Physiol 1994, 104:1139-1149.
Shinomura T, Nagatani A, Chory J, Furuya M: The induction of seed
germination in Arabidopsis thaliana is regulated principally by
phytochrome B and secondarily by phytochrome A. Plant Physiol 1994,
104:363-371.
Botto F, Sanchez RA, Whitelam GC, Casal JJ: Phytochrome A Mediates the
Promotion of Seed Germination by Very Low Fluences of Light and
Canopy Shade Light in Arabidopsis. Plant Physiol 1996, 110:439-444.
Furuya M, Schafer E: Photoperception and signaling of induction
reactions by different phytochromes. Trends Plant Sci 1996, 1:301-307.
Casal JJ, Sanchez RA, Yanovsky MJ: The function of phytochrome A.
Plant Cell Environ 1997, 20:813-819.
Smith H, Xy Y, Quail PH: Antagonistic but Complementary Actions of
Phytochromes A and B Allow Optimum Seedling De-Etiolation. Plant
Physiol 1997, 114:637-641.
Qin M, Kuhn R, Moran S, Quail PH: Overexpressed phytochrome C has
similar photosensory specificity to phytochrome B but a distinctive
capacity to enhance primary leaf expansion. Plant J 1997,
12:1163-1172.
Whitelam GC, Devlin PF: Roles of different phytochromes in Arabidopsis
photomorphogenesis. Plant Cell Environ 1997, 20:752-758.
Neff MM, Chory J: Genetic Interactions between Phytochrome A,
Phytochrome B, and Cryptochrome 1 during Arabidopsis
Development. Plant Physiol 1998, 118:27-35.
Devlin PF, Robson PRH, Patel SR, Samita R, Goosey L, Sharrock RA,
Whitelam CG: Phytochrome D acts in the shade-avoidance syndrome in
Arabidopsis by controlling elongation growth and flowering time.
Plant Physiol 1999, 119:909-915.
Smith HB: Photoreceptors in Signal Transduction: Pathways of
Enlightenment. Plant Cell 2000, 12:1-4.
Franklin KA, Praekelt U, Stoddart WM, Billingham OE, Halliday KJ, Whitelam
GC: Phytochromes B, D, and E Act Redundantly to Control Multiple

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

31.

32.
33.
34.

35.

36.

37.

38.

39.

40.

41.

42.

43.

44.

45.

46.

47.

48.
49.
50.

51.
52.

53.

Physiological Responses in Arabidopsis. Plant Physiol 2003,
131:1340-1346.
Franklin KA, Davis SJ, Stoddart WM, Vierstra RD, Whitelam GC: Mutant
Analyses Define Multiple Roles for Phytochrome C in Arabidopsis
Photomorphogenesis. Plant Cell 2003, 15:1981-1989.
Franklin KA, Whitelam GC: Light signals, phytochromes and cross-talk
with other environmental cues. J Exp Bot 2004, 55:271-276.
Josse EM, Foreman J, Halliday KJ: Paths through the phytochrome
network. Plant Cell Environ 2008, 31:667 -677.
Heschel MS, Butler CM, Barua D, Chiang GCK, Wheeler A, Sharrock RA,
Whitelam GC, Donohue K: New Roles of Phytochromes during Seed
Germination. Int J Plant Sci 2008, 169:531-540.
Somers DE, Devlin PF, Kay SA: Phytochromes and cryptochromes in the
entrainment of the Arabidopsis circadian clock. Science 1998,
282:1488-1490.
Devlin PF, Kay SA: Cryptochromes are required for phytochrome
signaling to the circadian clock but not for rhythmicity. The Plant Cell
2000, 12:2499-2509.
Suárez-López P, Wheatley K, Robson F, Onouchi H, Valverde F, Coupland
G: CONSTANS mediates between the circadian clock and the control of
flowering in Arabidopsis. Nature 2001, 410:1116-1120.
Valverde F, Mouradov A, Soppe W, Ravenscroft D, Samach A, Coupland G:
Photoreceptor regulation of CONSTANS protein in photoperiodic
flowering. Science 2004, 303:1003-1006.
Halliday KJ, Salter MG, Thingnaes E, Whitelam GC: Phytochrome control
of flowering is temperature sensitive and correlates with expression of
the floral integrator FT. Plant J 2003, 33:875-885.
Endo M, Nakamura S, Araki T, Mochizuki N, Nagatani A: Phytochrome B in
the mesophyll delays flowering by suppressing FLOWERING LOCUS T
expression in Arabidopsis vascular bundles. Plant Cell 2005,
17:1941-1952.
Monte E, Alonso JM, Ecker JR, Zhang Y, Li X, Young J, Austin-Phillips S,
Quail PH: Isolation and characterization of phyC mutants in Arabidopsis
reveals complex crosstalk between phytochrome signaling pathways.
Plant Cell 2003, 15:1962-1980.
Balasubramanian S, Sureshkumar S, Agrawal M, Michael TP, Wessinger C,
Maloof JN, Clark R, Warthmann N, Chory J, Weigel D: The PHYTOCHROME
C photoreceptor gene mediates natural variation in flowering and
growth responses of Arabidopsis thaliana. Nat Genet 2006, 38:711-715.
Samis KE, Heath KD, Stinchcombe JR: Discordant longitudinal clines in
flowering time and phytochrome C in Arabidopsis thaliana. Evolution
2008, 62:2971-2983.
Hauser BA, Cordonnier-Pratt MM, Daniel-Vedele F, Pratt LH: The
phytochrome gene family in tomato includes a novel subfamily. Plant
Mol Biol 1995, 29:1143-1155.
Pratt LH, Cordonnier-Pratt MM, Hauser BA, Caboche M: Tomato contains
two differentially expressed genes encoding B-type phytochromes
neither of which can be considered an ortholog of Arabidopsis
phytochrome B. Planta 1995, 197:203-206.
Pratt LH, Cordonnier-Pratt MM, Kelmenson PM, Lazarova GI, Kubota T, Alba
RM: The phytochrome gene family in tomato (Solanum lycopersicum L.).
Plant Cell Environ 1997, 20:672-677.
Howe GT, Bucciaglia PA, Hackett WP, Furnier GR, Cordonnier-Pratt MM,
Gardner G: Evidence that the phytochrome gene family in black
cottonwood has one PHYA locus and two PHYB loci but lacks members
of the PHYC/F and PHYE subfamilies. Mol Biol Evol 1998, 15:160-175.
Ouedraogo M, Hubac C: Effect of Far Red Light on Drought Resistance
of Cotton. Plant Cell Physiol 1982, 23:1297-1303.
Singh G, Garg OP: Effect of red, far-red radiations on germination of
cotton seed. Plant Cell Physiol 1971, 12:411-415.
Kasperbauer MJ: Cotton plant size and fiber developmental responses
to FR/R ratio reflected from the soil surface. Physiol Plantarum 1994,
91:317-321.
Kasperbauer MJ: Cotton Fiber Length Is Affected by Far-Red Light
Impinging on Developing Bolls. Crop Sci 2000, 40:1673-1678.
McCarty JC, Jenkins JN, Wu J: Primitive Accession Derived Germplasm
by Cultivar Crosses as Sources for Cotton Improvement II. Genetic
Effects and Genotypic Values. Crop Sci 2004, 44:1231-1235.
McCarty JC, Wu J, Jenkins JN: Genetic diversity for agronomic and fiber
traits in day-neutral accessions derived from primitive cotton
germplasm. Euphytica 2006, 148:283-293.

Page 17 of 18

54. Childs KL, Miller FR, Cordonnier-Pratt MM, Pratt LH, Morgan PW, Mullet JE:
The Sorghum photoperiod sensitivity gene Ma3, encodes a
phytochrome B. Plant Physiol 1997, 97:714-719.
55. Hanumappa M, Pratt LH, Cordonnier-Pratt MM, Deitzer GF: A
Photoperiod-Insensitive Barley Line Contains a Light-Labile
Phytochrome B1. Plant Physiol 1999, 119:1033-1040.
56. Izawa T, Oikawa T, Tokutomi S, Okuno K, Shimamoto K: Phytochromes
confer the photoperiodic control of flowering in rice (a short-day
plant). Plant J 2000, 22:391-399.
57. Liu Kanazawa A, Matsumura H, Takahashi R, Harada J, Abe J: Genetic
Redundancy in Soybean Photoresponses Associated With Duplication
of the Phytochrome A Gene. Genetics 2008, 180:995-1007.
58. Endrizzi JE, Turcotte EL, Kohel RJ: Genetics, cytology and evolution of
Gossypium. Adv Genet 1985, 23:271-375.
59. Wendel JF: New World tetraploid cottons contain Old World cytoplasm.
P Natl Acad Sci USA 1989, 86:4132-4136.
60. Wendel JF, Albert VA: Phylogenetics of the cotton genus (Gossypium):
character-state weighted parsimony analysis of Chloroplast-DNA
Restriction Site Data and Its Systematic and Biogeographic
Implications. Syst Bot 1992, 17:115-143.
61. Wendel JF, Brubaker CL, Percival AE: Genetic diversity in Gossypium
hirsutum and the origin of upland cotton. Am J Bot 1992, 79:1291-1310.
62. Cronn RC, Small RL, Haselkorn , Wendel JF: Rapid Diversification of the
Cotton Genus (Gossypium: Malvaceae) Revealed by Analysis of Sixteen
Nuclear and Chloroplast Genes. Am J Bot 2002, 89:707-725.
63. Senchina DS, Alvarez , Cronn RC, Liu B, Rong J, Noyes RD, Paterson AH,
Wing RA, Wilkins TA, Wendel JF: Rate Variation Among Nuclear Genes
and the Age of Polyploidy in Gossypium. Mol Biol Evol 2003, 20:633-643.
64. Soltis PS, Soltis DE, Chase MW: Angiosperm phylogeny inferred from
multiple genes as a tool for comparative biology. Nature 1999,
402:402-404.
65. Wang H, Moore MJ, Soltis PS, Charles D, Bell CD, Brockington SF, Alexander
R, Davis CC, Latvis MM, Manchester SR, Soltis DE: Rosid radiation and the
rapid rise of angiosperm-dominated forests. P Natl Acad Sci USA 2009,
10:3853-3858.
66. Cronn R, Cedroni M, Haselkorn T, Grover C, Wendel JF: PCR-mediated
recombination in amplification products derived from polyploid
cotton. Theor Appl Genet 2002, 104:482-489.
67. Martin DP, Williamson C, Posada D: RDP2: recombination detection and
analysis from sequence alignments. Bioinformatics 2005, 21:260-262.
68. Udall JA, Swanson JM, Haller K, Rapp RA, (36 authors): A global assembly
of cotton ESTs. Genome Res 2006, 16:441-450.
69. Ossowski S, Schwab R, Weigel D: Gene silencing in plants using artificial
microRNAs and other small RNAs. Plant J 2008, 53:674-690.
70. Moose SP, Mumm RH: Molecular Plant Breeding as the Foundation for
21st Century Crop Improvement. Plant Physiol 2008, 147:969-977.
71. Konieczny A, Ausubel FM: A Procedure for mapping Arabidopsis
mutations using co-dominant ecotype specific PCR-markers. Plant J
1993, 4:403-410.
72. Neff MM, Neff JD, Chory J, Pepper AE: dCAPS, a simple technique for the
genetic analysis of single nucleotide polymorphisms: experimental
applications in Arabidopsis thaliana genetics. Plant J 1998, 14:387-392.
73. Wikström N, Savolainen V, Chase MW: Evolution of the angiosperms:
Calibrating the family tree. P Roy Soc London B 2001, 268:2211-2220.
74. Seelanan T, Schnabel A, Wendel JF: Congruence and consensus in the
cotton tribe (Malvaceae). Syst Bot 1997, 22:259-290.
75. Ohno S: Evolution by gene duplication Springer-Verlag, New York, USA;
1970.
76. Force A, Lynch M, Pickett FB, Amores A, Yan Y, Postlethwait J: Preservation
of duplicate genes by complementary, degenerative mutations.
Genetics 1999, 151:1531-1545.
77. Lynch M, Force A: The probability of duplicate gene preservation by
subfunctionalization. Genetics 2000, 154:459-473.
78. Wagner A: Birth and death of duplicated genes in completely
sequenced eukaryotes. Trends Genet 2001, 17:237-239.
79. Lynch M, Conery JS: The Evolutionary Fate and Consequences of
Duplicate Genes. Science 2000, 290:1151-1155.
80. Moore RC, Purugganan MD: The evolutionary dynamics of plant
duplicate genes. Curr Op Plant Biol 2005, 8:122-128.
81. Alba R, Kelmenson PM, Cordonnier-Pratt MM, Pratt LH: The Phytochrome
Gene Family in Tomato and the Rapid Differential Evolution of this
Family in Angiosperms. Mol Biol Evol 2000, 17:362-373.

Abdurakhmonov et al. BMC Plant Biology 2010, 10:119
http://www.biomedcentral.com/1471-2229/10/119

82. Park CM, Bhoo SH, Song PS: Inter-domain crosstalk in the phytochrome
molecules. Semin Cell Dev Biol 2000, 11:449-456.
83. Kim JI, Shen Y, Han YJ, Park JE, Kirchenbauer D, Soh MS, Nagy F, Schäfer E,
Song PS: Phytochrome phosphorylation modulates light signaling by
influencing the protein-protein interaction. Plant Cell 2004,
16:2629-2640.
84. Chen M, Schwab R, Chory J: Characterization of the requirements for
localization of phytochrome B to nuclear bodies. P Natl Acad Sci USA
2003, 100:14493-14498.
85. Ingvarsson PK, Garcia MV, Luquez V, Hall D, Jansson S: Nucleotide
polymorphism and phenotypic associations within and around the
phytochrome B2 locus in European aspen (Populus tremula,
Salicaceae). Genetics 2008, 178:2217-2226.
86. Nekrutenko A, Makova KD, Li WH: The K(A)/K(S) ratio test for assessing
the protein-coding potential of genomic regions: an empirical and
simulation study. Genome Res 2002, 12:198-202.
87. Cronn RC, Small RL, Wendel JF: Duplicated genes evolve independently
after polyploidy formation in cotton. P Natl Acad Sci USA 1999,
96:14406-14411.
88. Fisher RA: On the interpretation of χ2 from contingency tables, and the
calculation of P. J Roy Stat Soc 1922, 85:87-94.
89. Nei M, Rogozin IB, Piontkivska H: Purifying selection and birth-anddeath evolution in the ubiquitin gene family. Proc Natl Acad Sci USA
2000, 97:10866-10871.
90. White GM, Hamblin MT, Kresovich S: Molecular Evolution of the
Phytochrome Gene Family in Sorghum: Changing Rates of
Synonymous and Replacement Evolution. Mol Biol Evol 2004,
21:716-723.
91. Borevitz JO, Ecker JR: Plant Genomics: The Third Wave. Annu Rev Genom
Hum G 2004, 5:443-477.
92. Kohel RJ, Richmond TR, Lewis CF: Texas Marker-1. A description of a
genetic standard for Gossypium hirsutum L. Crop Sci 1970, 10:670-671.
93. Kohel RJ, Yu J, Park Y, Lazo GR: Molecular mapping and characterization
of traits controlling fiber quality in cotton. Euphytica 2001, 121:163-172.
94. Dellaporta SL, Wood J, Hicks JP: A plant DNA minipreparation: Version II.
Plant Mol Biol Rep 1983, 1:19-21.
95. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG: The
ClustalX windows interface: flexible strategies for multiple sequence
alignment aided by quality analysis tools. Nucleic Acids Res 1997,
24:4876-4882.
96. Reddy OUK, Pepper AE, Abdurakhmonov I, Saha S, Jenkins JN, Brooks T,
Bolek Y, El-Zik K: New Dinucleotide and Trinucleotide Microsatellite
Marker Resources for Cotton Genome Research. J Cotton Sci 2001,
5:103-113.
97. Eckert KA, Kunkel TA: High fidelity DNA synthesis by the Thermus
aquaticus DNA polymerase. Nucleic Acids Res 1990, 18:3739-3744.
98. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W, Lipman
DJ: Gapped BLAST and PSI-BLAST: a new generation of protein
database search programs. Nucl Acids Res 1997, 25:3389-3402.
99. Ma B, Tromp J, Li M: PatternHunter: faster and more sensitive homology
search. Bioinformatics 2002, 18:440-445.
100. Saitou N, Nei M: The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol Biol Evol 1987, 4:406-425.
101. Kimura M: A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences. J
Mol Evol 1980, 16:111-120.
102. Swofford D: PAUP*: Phylogenetic Analysis Using Parsimony (and Other
Methods). Version 4.0 Sinauer Associates, Sunderland, MA, USA; 2002.
103. Felsenstein J: Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 1985, 39:783-791.
104. Jukes TH, Cantor CR: Evolution of protein molecules. In Mammalian
protein metabolism Edited by: Munro HN. Academic Press, New York, USA;
1969:21-123.
105. Nei M, Gojobori T: Simple methods for estimating the numbers of
synonymous and nonsynonymous nucleotide substitutions. Mol Biol
Evol 1986, 3:418-426.
106. Librado P, Rozas J: DnaSP v5: A software for comprehensive analysis of
DNA polymorphism data. Bioinformatics 2009, 25:1451-1452.

Page 18 of 18

doi: 10.1186/1471-2229-10-119
Cite this article as: Abdurakhmonov et al., Duplication, divergence and persistence in the Phytochrome photoreceptor gene family of cottons (Gossypium spp.) BMC Plant Biology 2010, 10:119

</pre>
</body>
</html>