Assertion Error

[akashbahai]

Hi,
I am trying to predict a few RNA structures. This tool is running fine for some targets, but it's running into some kind of error for other targets. The error is as follows:

Traceback (most recent call last):
File "/home/project/12003580/RoseTTAFold2NA/network/predict.py", line 374, in
pred.predict(inputs=args.inputs, out_prefix=args.prefix, ffdb=ffdb)
File "/home/project/12003580/RoseTTAFold2NA/network/predict.py", line 160, in predict
msa_i, ins_i = parse_fasta(a3m_i, rna_alphabet=is_rna, dna_alphabet=is_dna)
File "/data/projects/12003580/RoseTTAFold2NA/network/parsers.py", line 119, in parse_fasta
assert (np.all(msa<=31))
AssertionError

The RNA sequence:

8D9L_3|Chain C|Lys-tRNA|Homo sapiens (9606)
GCCCGGAUAGCUCAGUCGGUAGAGCAUCAGACUUUUAAUCUGAGGGUCCAGGGUUCAAGUCCCUGUUCGGGCG

Can you please provide me with some pointers on how to resolve this assertion error?

Best,
Akash

[akashbahai]

I checked the code for the previous version and it seems that previous parsers.py didn't have this assert condition.
The new version (paersers.py, line 119) will cause an assertion error if the length of the MSA is <=31. Is that intentional?

[bifxcore]

@akashbahai Have you checked the sequences in your MSA? I got that error because my MSA contained RNA sequences with non-standard bases, see #27

[akashbahai]

@bifxcore Thanks for your comment. You were right about the presence of non-standard bases. Removing them from the alignment does seem to fix the issue.
Interestingly, the previous version used to run just fine for the same targets.

[akashbahai]

If someone is still facing the same issue, they can look at this pull request pull request. I have added a script to cleanup the MSA, if it contains non-standard bases.