freeze wiki

docs/v4.3.0/Citations.md

@@ -0,0 +1,30 @@
+# Citing Truvari
+
+English, A.C., Menon, V.K., Gibbs, R.A. et al. Truvari: refined structural variant comparison preserves allelic diversity. Genome Biol 23, 271 (2022). https://doi.org/10.1186/s13059-022-02840-6
+
+# Citations
+
+List of publications using Truvari. Most of these are just pulled from a [Google Scholar Search](https://scholar.google.com/scholar?q=truvari). Please post in the [show-and-tell](https://github.com/spiralgenetics/truvari/discussions/categories/show-and-tell) to have your publication added to the list.
+* [A robust benchmark for detection of germline large deletions and insertions](https://www.nature.com/articles/s41587-020-0538-8)
+* [Leveraging a WGS compression and indexing format with dynamic graph references to call structural variants](https://www.biorxiv.org/content/10.1101/2020.04.24.060202v1.abstract)
+* [Duphold: scalable, depth-based annotation and curation of high-confidence structural variant calls](https://academic.oup.com/gigascience/article/8/4/giz040/5477467?login=true)
+* [Parliament2: Accurate structural variant calling at scale](https://academic.oup.com/gigascience/article/9/12/giaa145/6042728)
+* [Learning What a Good Structural Variant Looks Like](https://www.biorxiv.org/content/10.1101/2020.05.22.111260v1.full)
+* [Long-read trio sequencing of individuals with unsolved intellectual disability](https://www.nature.com/articles/s41431-020-00770-0)
+* [lra: A long read aligner for sequences and contigs](https://journals.plos.org/ploscompbiol/article?id=10.1371/journal.pcbi.1009078)
+* [Samplot: a platform for structural variant visual validation and automated filtering](https://genomebiology.biomedcentral.com/articles/10.1186/s13059-021-02380-5)
+* [AsmMix: A pipeline for high quality diploid de novo assembly](https://www.biorxiv.org/content/10.1101/2021.01.15.426893v1.abstract)
+* [Accurate chromosome-scale haplotype-resolved assembly of human genomes](https://www.nature.com/articles/s41587-020-0711-0)
+* [Accurate circular consensus long-read sequencing improves variant detection and assembly of a human genome](https://www.nature.com/articles/s41587-019-0217-9)
+* [NPSV: A simulation-driven approach to genotyping structural variants in whole-genome sequencing data](https://academic.oup.com/bioinformatics/article-abstract/37/11/1497/5466452)
+* [SVIM-asm: structural variant detection from haploid and diploid genome assemblies](https://academic.oup.com/bioinformatics/article/36/22-23/5519/6042701?login=true)
+* [Readfish enables targeted nanopore sequencing of gigabase-sized genomes](https://www.nature.com/articles/s41587-020-00746-x)
+* [stLFRsv: A Germline Structural Variant Analysis Pipeline Using Co-barcoded Reads](https://internal-journal.frontiersin.org/articles/10.3389/fgene.2021.636239/full)
+* [Long-read-based human genomic structural variation detection with cuteSV](https://genomebiology.biomedcentral.com/articles/10.1186/s13059-020-02107-y)
+* [An international virtual hackathon to build tools for the analysis of structural variants within species ranging from coronaviruses to vertebrates](https://f1000research.com/articles/10-246)
+* [Paragraph: a graph-based structural variant genotyper for short-read sequence data](https://link.springer.com/article/10.1186/s13059-019-1909-7)
+* [Genome-wide investigation identifies a rare copy-number variant burden associated with human spina bifida](https://www.nature.com/articles/s41436-021-01126-9)
+* [TT-Mars: Structural Variants Assessment Based on Haplotype-resolved Assemblies](https://www.biorxiv.org/content/10.1101/2021.09.27.462044v1.abstract)
+* [An ensemble deep learning framework to refine large deletions in linked-reads](https://www.biorxiv.org/content/10.1101/2021.09.27.462057v1.abstract)
+* [MAMnet: detecting and genotyping deletions and insertions based on long reads and a deep learning approach](https://academic.oup.com/bib/advance-article-abstract/doi/10.1093/bib/bbac195/6587170)](https://academic.oup.com/bib/advance-article-abstract/doi/10.1093/bib/bbac195/6587170)
+* [Automated filtering of genome-wide large deletions through an ensemble deep learning framework](https://www.sciencedirect.com/science/article/pii/S1046202322001712#b0110)

docs/v4.3.0/Development.md

@@ -0,0 +1,90 @@
+# Truvari API
+Many of the helper methods/objects are documented such that developers can reuse truvari in their own code. To see developer documentation, visit [readthedocs](https://truvari.readthedocs.io/en/latest/).
+
+Documentation can also be seen using
+```python
+import truvari
+help(truvari)
+```
+
+# docker
+
+A Dockerfile exists to build an image of Truvari. To make a Docker image, clone the repository and run
+```bash
+docker build -t truvari .
+```
+
+You can then run Truvari through docker using
+```bash
+docker run -v `pwd`:/data -it truvari
+```
+Where `pwd` can be whatever directory you'd like to mount in the docker to the path `/data/`, which is the working directory for the Truvari run. You can provide parameters directly to the entry point.
+```bash
+docker run -v `pwd`:/data -it truvari anno svinfo -i example.vcf.gz
+```
+
+If you'd like to interact within the docker container for things like running the CI/CD scripts
+```bash
+docker run -v `pwd`:/data --entrypoint /bin/bash -it truvari
+```
+You'll now be inside the container and can run FuncTests or run Truvari directly
+```bash
+bash repo_utils/truvari_ssshtests.sh
+truvari anno svinfo -i example.vcf.gz
+```
+
+# CI/CD
+
+Scripts that help ensure the tool's quality. Extra dependencies need to be installed in order to run Truvari's CI/CD scripts. 
+
+```bash
+pip install pylint anybadge coverage
+```
+
+Check code formatting with 
+```bash
+python repo_utils/pylint_maker.py
+```
+We use [autopep8](https://pypi.org/project/autopep8/) (via [vim-autopep8](https://github.com/tell-k/vim-autopep8)) for formatting.
+
+Test the code and generate a coverage report with 
+```bash
+bash repo_utils/truvari_ssshtests.sh
+```
+
+Truvari leverages github actions to perform these checks when new code is pushed to the repository. We've noticed that the actions sometimes hangs through no fault of the code. If this happens, cancel and resubmit the job. Once FuncTests are successful, it uploads an artifact of the `coverage html` report which you can download to see a line-by-line accounting of test coverage.
+
+# git flow
+
+To organize the commits for the repository, we use [git-flow](https://danielkummer.github.io/git-flow-cheatsheet/). Therefore, `develop` is the default branch, the latest tagged release is on `master`, and new, in-development features are within `feature/<name>`
+
+When contributing to the code, be sure you're working off of develop and have run `git flow init`.
+
+# versioning
+
+Truvari uses [Semantic Versioning](https://semver.org/) and tries to stay compliant to [PEP440](https://peps.python.org/pep-0440/). As of v3.0.0, a single version is kept in the code under `truvari/__init__.__version__`. We try to keep the suffix `-dev` on the version in the develop branch. When cutting a new release, we may replace the suffix with `-rc` if we've built a release candidate that may need more testing/development. Once we've committed to a full release that will be pushed to PyPi, no suffix is placed on the version. If you install Truvari from the develop branch, the git repo hash is appended to the installed version as well as '.uc' if there are un-staged commits in the repo.
+
+# docs
+
+The github wiki serves the documentation most relevant to the `develop/` branch. When cutting a new release, we freeze and version the wiki's documentation with the helper utility `docs/freeze_wiki.sh`.
+
+# Creating a release
+Follow these steps to create a release
+
+0) Bump release version
+1) Run tests locally
+2) Update API Docs
+3) Change Updates Wiki
+4) Freeze the Wiki
+5) Ensure all code is checked in
+6) Do a [git-flow release](https://danielkummer.github.io/git-flow-cheatsheet/)
+7) Use github action to make a testpypi release
+8) Check test release
+```bash
+python3 -m venv test_truvari
+python3 -m pip install --index-url https://test.pypi.org/simple --extra-index-url https://pypi.org/simple/ truvari
+```
+9) Use GitHub action to make a pypi release
+10) Download release-tarball.zip from step #9’s action
+11) Create release (include #9) from the tag
+12) Checkout develop and Bump to dev version and README ‘commits since’ badge

docs/v4.3.0/Home.md

@@ -0,0 +1,35 @@
+The wiki holds documentation most relevant for develop. For information on a specific version of Truvari, see [`docs/`](https://github.com/spiralgenetics/truvari/tree/develop/docs)
+
+Citation:  
+English, A.C., Menon, V.K., Gibbs, R.A. et al. Truvari: refined structural variant comparison preserves allelic diversity. Genome Biol 23, 271 (2022). https://doi.org/10.1186/s13059-022-02840-6
+
+# Before you start
+VCFs aren't always created with a strong adherence to the format's specification. 
+
+Truvari expects input VCFs to be valid so that it will only output valid VCFs. 
+
+We've developed a separate tool that runs multiple validation programs and standard VCF parsing libraries in order to validate a VCF. 
+
+Run [this program](https://github.com/acenglish/usable_vcf) over any VCFs that are giving Truvari trouble. 
+
+Furthermore, Truvari expects 'resolved' SVs (e.g. DEL/INS) and will not interpret BND signals across SVTYPEs (e.g. combining two BND lines to match a DEL call). A brief description of Truvari bench methodology is linked below.
+
+Finally, Truvari does not handle multi-allelic VCF entries and as of v4.0 will throw an error if multi-allelics are encountered. Please use `bcftools norm` to split multi-allelic entries. 
+
+# Index
+
+- [[Updates|Updates]]
+- [[Installation|Installation]]
+- Truvari Commands:
+  - [[anno|anno]]
+  - [[bench|bench]]
+  - [[collapse|collapse]]
+  - [[consistency|consistency]]
+  - [[divide|divide]]
+  - [[phab|phab]]
+  - [[refine|refine]]
+  - [[segment|segment]]
+  - [[stratify|stratify]]
+  - [[vcf2df|vcf2df]]
+- [[Development|Development]]
+- [[Citations|Citations]]

docs/v4.3.0/Installation.md

@@ -0,0 +1,72 @@
+Recommended
+===========
+For stable versions of Truvari, use pip
+```
+python3 -m pip install truvari
+```
+Specific versions can be installed via
+```
+python3 -m pip install truvari==3.2.0
+```
+See [pypi](https://pypi.org/project/Truvari/#history) for a history of all distributed releases.
+
+Manual Installation
+===================
+To build Truvari directly, clone the repository and switch to a specific tag.
+```
+git clone https://github.com/ACEnglish/truvari.git
+git checkout tags/v3.0.0
+python3 -m pip install .
+```
+
+To see a list of all available tags, run:
+```
+git tag -l
+```
+
+If you have an older clone of the repository and don't see the version you're looking for in tags, make sure to pull the latest changes:
+```
+git pull
+git fetch --all --tags
+```
+
+Mamba / Conda
+=============
+NOTE!! There is a very old version of Truvari on bioconda that - for unknown reasons - supersedes the newer, supported versions. Users may need to specify to conda which release to build. See [this ticket](https://github.com/ACEnglish/truvari/issues/130#issuecomment-1196607866) for details.
+
+Truvari releases are automatically deployed to bioconda. 
+Users can follow instructions here (https://mamba.readthedocs.io/en/latest/installation.html) to install mamba. (A faster alternative conda compatible package manager.)
+
+Creating an environment with Truvari and its dependencies.
+```
+mamba create -c conda-forge -c bioconda -n truvari truvari
+```
+
+Alternatively, see the [conda page](https://anaconda.org/bioconda/truvari) for details
+```
+conda install -c bioconda truvari
+```
+
+Building from develop
+=====================
+The default branch is `develop`, which holds in-development changes. This is for developers or those wishing to try experimental features and is not recommended for production. Development is versioned higher than the most recent stable release with an added suffix (e.g. Current stable release is `3.0.0`, develop holds `3.1.0-dev`). If you'd like to install develop, repeat the steps above but without `git checkout tags/v3.0.0`. See [wiki](https://github.com/spiralgenetics/truvari/wiki/Development#git-flow) for details on how branching is handled.
+
+Docker
+======
+See [Development](https://github.com/spiralgenetics/truvari/wiki/Development#docker) for details on building a docker container.
+
+edlib error
+===========
+Some environments have a hard time installing edlib due to a possible cython bug ([source](https://bugs.launchpad.net/ubuntu/+source/cython/+bug/2006404)). If you seen an error such as the following:
+```
+edlib.bycython.cpp:198:12: fatal error: longintrepr.h: No such file or directory
+     198 |  #include "longintrepr.h"
+```
+
+One method to prevent the error message is to run the following commands ([source](https://github.com/Martinsos/edlib/issues/212))
+```bash
+python3 -m venv my_env
+source my_env/bin/activate
+python3 -m pip install --no-cache-dir cython setuptools wheel
+EDLIB_USE_CYTHON=1 python3 -m pip install truvari --no-cache
+```

docs/v4.3.0/MatchIds.md

@@ -0,0 +1,74 @@
+MatchIds are used to tie base/comparison calls together in post-processing for debugging or other exploring. MatchIds have a structure of `{chunkid}.{callid}`. The chunkid is unique id per-chunk of calls. All calls sharing chunkid were within `--chunksize` distance and were compared. The callid is unique to a call in a chunk for each VCF. Because `bench` processes two VCFs (the base and comparison VCFs), the `MatchId` has two values: the first is the base variant's MatchId and the second the comparison variant's MatchId. 
+
+For `--pick single`, the two MatchIds will be identical in the e.g. tp-base.vcf.gz and tp-comp.vcf.gz. However, for `--pick ac|multi`, it's possible to have cases such as one base variant matching to multiple comparison variants. That would give us MatchIds like:
+
+```
+# tp-base.vcf
+MatchId=4.0,4.1
+
+# tp-comp.vcf
+MatchId=4.0,4.1
+MatchId=4.0,4.2
+```
+
+This example tells us that the tp-comp variants are both pointing to `4.0` in tp-base. The tp-base variant has a higher match to the tp-comp `4.1` variant. 
+
+One easy way to combine matched variants is to use `truvari vcf2df` to convert a benchmarking result to a pandas DataFrame and leverage pandas' merge operation. First, we convert the `truvari bench` result.
+
+```bash
+truvari vcf2df --info --bench-dir bench_result/ data.jl
+```
+
+Next, we combine rows of matched variants:
+```python
+import joblib
+import pandas as pd
+
+# Load the data
+data = joblib.load("data.jl")
+
+# Separate out the variants from the base VCF and add new columns of the base/comp ids
+base = data[data['state'].isin(['tpbase', 'fn'])].copy()
+base['base_id'] = base['MatchId'].apply(lambda x: x[0])
+base['comp_id'] = base['MatchId'].apply(lambda x: x[1])
+
+# Separate out the variants from the comparison VCF and add new columns of the base/comp ids
+comp = data[data['state'].isin(['tp', 'fp'])].copy()
+comp['base_id'] = comp['MatchId'].apply(lambda x: x[0])
+comp['comp_id'] = comp['MatchId'].apply(lambda x: x[1])
+
+# Merge the base/comparison variants
+combined = pd.merge(base, comp, left_on='base_id', right_on='comp_id', suffixes=('_base', '_comp'))
+
+# How many comp variants matched to multiple base variants?
+counts1 = combined['base_id_comp'].value_counts()
+print('multi-matched comp count', (counts1 != 1).sum())
+
+# How many base variants matched to multiple comp variants?
+counts2 = combined['comp_id_base'].value_counts()
+print('multi-matched base count', (counts2 != 1).sum())
+```
+
+The `MatchId` is also used by `truvari collapse`. However there are two differences. First, in the main `collapse` output, the relevant INFO field is named `CollapsedId`. Second, because collapse only has a single input VCF, it is much easier to merge DataFrames. To merge collapse results kept variants with those that were removed, we again need to convert the VCFs to DataFrames:
+
+```bash
+truvari vcf2df -i kept.vcf.gz kept.jl
+truvari vcf2df -i removed.vcf.gz remov.jl
+```
+
+Then we combine them:
+```python
+import joblib
+import pandas as pd
+
+# Load the kept variants and set the index.
+kept = joblib.load("kept.jl").set_index('CollapseId')
+
+# Load the removed variants and set the index.
+remov = joblib.load("remov.jl")
+remov['CollapseId'] = remov['MatchId'].apply(lambda x: x[0])
+remov.set_index('CollapseId', inplace=True)
+
+# Join the two sets of variants
+result_df = kept.join(remov, how='right', rsuffix='_removed')
+```

docs/v4.3.0/Multi-allelic-VCFs.md

@@ -0,0 +1,11 @@
+Truvari only compares the first alternate allele in VCFs. If a VCF contains multi-allelic sites such as:
+
+```
+chr2     1948201     .     T     TACAACACGTACGATCAGTAGAC,TCAACACACAACACGTACGATCAGTAGAC     ....
+```
+
+Then pre-process the VCFs with bcftools:
+
+```bash
+bcftools norm -m-any base_calls.vcf.gz | bgzip > base_calls_split.vcf.gz
+```