-
Notifications
You must be signed in to change notification settings - Fork 240
Commit
This commit does not belong to any branch on this repository, and may belong to a fork outside of the repository.
Merge pull request #1943 from jmchilton/cwldeps2
Enhance cwltoil to support SoftwareRequirements & BioContainers.
- Loading branch information
Showing
8 changed files
with
130 additions
and
18 deletions.
There are no files selected for viewing
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,11 @@ | ||
>Sequence 561 BP; 135 A; 106 C; 98 G; 222 T; 0 other; | ||
gttcgatgcc taaaatacct tcttttgtcc ctacacagac cacagttttc ctaatggctt | ||
tacaccgact agaaattctt gtgcaagcac taattgaaag cggttggcct agagtgttac | ||
cggtttgtat agctgagcgc gtctcttgcc ctgatcaaag gttcattttc tctactttgg | ||
aagacgttgt ggaagaatac aacaagtacg agtctctccc ccctggtttg ctgattactg | ||
gatacagttg taataccctt cgcaacaccg cgtaactatc tatatgaatt attttccctt | ||
tattatatgt agtaggttcg tctttaatct tcctttagca agtcttttac tgttttcgac | ||
ctcaatgttc atgttcttag gttgttttgg ataatatgcg gtcagtttaa tcttcgttgt | ||
ttcttcttaa aatatttatt catggtttaa tttttggttt gtacttgttc aggggccagt | ||
tcattattta ctctgtttgt atacagcagt tcttttattt ttagtatgat tttaatttaa | ||
aacaattcta atggtcaaaa a |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,12 @@ | ||
@EAS54_6_R1_2_1_413_324 | ||
CCCTTCTTGTCTTCAGCGTTTCTCC | ||
+ | ||
;;3;;;;;;;;;;;;7;;;;;;;88 | ||
@EAS54_6_R1_2_1_540_792 | ||
TTGGCAGGCCAAGGCCGATGGATCA | ||
+ | ||
;;;;;;;;;;;7;;;;;-;;;3;83 | ||
@EAS54_6_R1_2_1_443_348 | ||
GTTGCTTCTGGCGTGGGTGGGGGGG | ||
+EAS54_6_R1_2_1_443_348 | ||
;;;;;;;;;;;9;7;;.7;393333 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,24 @@ | ||
cwlVersion: v1.0 | ||
class: CommandLineTool | ||
id: "seqtk_seq" | ||
doc: "Convert to FASTA (seqtk)" | ||
inputs: | ||
- id: input1 | ||
type: File | ||
inputBinding: | ||
position: 1 | ||
prefix: "-a" | ||
outputs: | ||
- id: output1 | ||
type: File | ||
outputBinding: | ||
glob: out | ||
baseCommand: ["seqtk", "seq"] | ||
arguments: [] | ||
stdout: out | ||
hints: | ||
SoftwareRequirement: | ||
packages: | ||
- package: seqtk | ||
version: | ||
- r93 |
This file contains bidirectional Unicode text that may be interpreted or compiled differently than what appears below. To review, open the file in an editor that reveals hidden Unicode characters.
Learn more about bidirectional Unicode characters
Original file line number | Diff line number | Diff line change |
---|---|---|
@@ -0,0 +1,6 @@ | ||
{ | ||
"input1": { | ||
"class": "File", | ||
"location": "2.fastq" | ||
} | ||
} |