Restore CDSCheck

GMOD · Sep 19, 2024 · ebc8cfc · ebc8cfc
1 parent c186ea4
commit ebc8cfc
Show file tree

Hide file tree

Showing 2 changed files with 205 additions and 254 deletions.
diff --git a/packages/apollo-cli/test_data/tiny.fasta.gff3 b/packages/apollo-cli/test_data/tiny.fasta.gff3
@@ -10,10 +10,12 @@ ctgA	example	mRNA	100	200	.	+	.	ID=EDEN.1;Parent=EDEN;Name=EDEN.1;Note=Eden spli
 ctgB	someExample	contig	1	50	.	.	.	Name=SomeContig
 ctgC	example	gene	100	200	.	+	.	ID=MyGene
 ctgC	example	mRNA	100	200	.	+	.	ID=MyGene.1;Parent=MyGene
-ctgC	example	CDS	100	170	.	+	.	ID=MyExon.1;Parent=MyGene.1
+ctgC	example	CDS	100	170	.	+	.	ID=myCDS.1;Parent=MyGene.1
+ctgC	example	exon	100	170	.	+	.	ID=MyExon.1;Parent=MyGene.1
 ctgC	example	gene	150	250	.	+	.	ID=AnotherGene
 ctgC	example	mRNA	150	250	.	+	.	ID=mRNA.1;Parent=AnotherGene
 ctgC	example	CDS	150	201	.	+	.	ID=CDS.1;Parent=mRNA.1
+ctgC	example	exon	150	201	.	+	.	ID=exon.1;Parent=mRNA.1
 ##FASTA
 >ctgA
 cattgttgcggagttgaacaACGGCATTAGGAACACTTCCGTCTCtcacttttatacgat
@@ -37,4 +39,3 @@ ctgcccataaatcaaagggttagtgcggccaaaacgttggacaacggtattagaagacca
 acctgaccaccaaaccgtcaattaaccggtatcttctcggaaacggcggttctctcctag
 atagcgatctgtggtctcaccatgcaatttaaacaggtgagtaaagattgctacaaatac
 gagactagctgtcaccagatgctgttcatctgttggctccttggtcgctccgttgtaccc
-