Skip to content

FebRNA: an automated fragment-ensemble-based model for building RNA 3D structures.

License

Notifications You must be signed in to change notification settings

Tan-group/FebRNA

Repository files navigation

Readme for FebRNA package by Tan-group at Wuhan University

FebRNA is a package for building RNA 3D structures with input their secondary structures based on coarse-grained fragment ensembles [1]. The program of FebRNA is run in Python, and numpy and scipy modules are required.

Please run FebRNA as follows:

# Compilation and usage under linux
gcc cgRNASP-Feb.c -lm -o cgRNASP-Feb
gcc reconstruction.c -lm -o reconstruction 

# Run in the example dir 
python ./FebRNA.py (or python3 ./FebRNA.py)
(in the file directory depending on the installed Python version) .

According to corresponding instructions from FebRNA, please input :

  • (a) sequence information,
  • (b) secondary structure in dot-bracket form,
  • (c) number of structures required (n), and
  • (d) whether all-atom construction is required accordingly.

Wait for a while (usually within several minutes) to obtain the results.

  • (a) The results are placed in the './RESULT';
  • (b) './RESULT/CG_Result' contains all the predicted coarse-grained conformations;
  • (c) './RESULT/Select_Result' contains a selection of TOP-n coarse-grained conformations;
  • (d) './RESULT/AA_Result' contains the rebuilt all-atom structures of selected coarse-grained structures.

An example is:

python FebRNA.py 
Sequence:GCGGCACCGUCCGCUCAAACAAACGG
Secondary Structure:((((..[[[.)))).........]]]
Seleted Num(0=all):5
All-atom rebuilding?(y/n):y
Finish in folder ./RESULT
Running time :37.020s

Further refinement is required for the rebuilt all-atom structures.

To remove possible steric clashes and chain breaks of the rebuilt all-atom structures, a structure refinement can be performed for the rebuilt all-atom structures by FebRNA through the method of QRNAS (https://github.com/sunandan-mukherjee/QRNAS.git) [2].

If you have any questions about FebRNA, please contact us by the email: zjtan@whu.edu.cn .

References:
[1] Zhou L, Wang X, Yu S, Tan YL, & Tan ZJ. 2022. FebRNA: an automated fragment-ensemble-based model for building RNA 3D structures. Biophys J. 121(18): 3381-3392.
[2] Stasiewicz J, Mukherjee S, Nithin C, & Bujnicki, JM. 2019. QRNAS: software tool for refinement of nucleic acid structures. Bmc Struct Biology. 19: 5.

About

FebRNA: an automated fragment-ensemble-based model for building RNA 3D structures.

Resources

License

Stars

Watchers

Forks

Releases

No releases published

Packages

No packages published