Epidemiology of Legionella : Genome-bAsed Typing:
El_gato is a bioinformatics tool that utilizes either a genome assembly (.fasta) or Illumina paired-end reads (.fastq) to replicate Legionella pneumophila Sequence Based Typing (SBT). From the input, 7 loci (flaA, pilE, asd, mip, mompS, proA, neuA/neuAh) are identified and compared to a database of sequence types. The sequence type provided for each input sample is based on the unique combination of the allelic identities of the 7 target loci.
Codebase stage: development
Developers and maintainers, Testers: Alan Collins, Dev Mashruwala, Andrew Conley, Lavanya Rishishwar, Emily T. Norris, Anna Gaines, Will Overholt
# Create an environment named elgato and install el_gato.py plus all dependencies
conda create -n elgato -c bioconda -c conda-forge el_gato
# Activate the environment to use el_gato.py
conda activate elgato
Note Using this method requires you to install all dependencies manually.
# Download el_gato by cloning the git repository
git clone https://github.com/appliedbinf/el_gato.git
# Move into the el_gato directory and install with pip
cd el_gato/
python3 -m pip install .
Here is an example of a basic run using paired-end reads or assemblies as input. We recommend using reads whenever available as read-based sequence typing is more reliable.
# Paired-end:
el_gato.py --read1 read1.fastq.gz --read2 read2.fastq.gz --out output_folder/
# Assembly:
el_gato.py --assembly assembly_file.fna --out output_folder/
Usage information printed when running el_gato.py with -h or --help.
usage: el_gato.py [--read1 Read 1 file] [--read2 Read 2 file] [--assembly Assembly file] [--help]
[--threads THREADS] [--depth DEPTH] [--out OUT] [--sample SAMPLE] [--overwrite] [--sbt SBT]
[--suffix SUFFIX] [--profile PROFILE] [--verbose] [--header] [--length LENGTH] [--sequence SEQUENCE]
[--samfile SAMFILE]
Legionella in silico sequence-based typing (SBT) script.
Requires paired-end reads files or a genome assembly.
Notes on arguments:
(1) If only reads are provided, SBT is called using a mapping/alignment approach and BLAST.
(2) If only an assembly is provided, a BLAST and *in silico* PCR-based approach is adopted.
Input files:
Please specify either reads files and/or a genome assembly file
--read1 Read 1 file -1 Read 1 file
Input Read 1 (forward) file
--read2 Read 2 file -2 Read 2 file
Input Read 2 (reverse) file
--assembly Assembly file -a Assembly file
Input assembly fasta file
Optional arguments:
--help, -h
Show this help message and exit
--threads THREADS -t THREADS
Number of threads to run the programs (default: 1)
--depth DEPTH -d DEPTH
Variant read depth cutoff (default: 10)
--out OUT -o OUT
Output folder name (default: out)
--sample SAMPLE -n SAMPLE
Sample name (default: <Inferred from input file>)
--overwrite -w
Overwrite output directory(default: False)
--sbt SBT -s SBT
Database containing SBT allele and ST mapping files
(default: .../el_gato/el_gato/db)
--suffix SUFFIX -x SUFFIX
Suffix of SBT allele files (default: _alleles.tfa)
--profile PROFILE -p PROFILE
Name of allele profile to ST mapping file
(default: ../el_gato/el_gato/db/lpneumophila.txt)
--verbose -v
Print what the script is doing (default: False)
--header -e
Include column headers in the output table (default: False)
--length LENGTH -l LENGTH
Specify the BLAST hit length threshold for
identifying multiple loci in an assembly
(default: 0.3)
--sequence SEQUENCE -s SEQUENCE
Specify BLAST hit percent identity threshold for
identifying multiple loci in an assembly
(default: 95.0)
--samfile SAMFILE -m SAMFILE
Allows the user to include the reads_vs_all_ref_filt.sam
file to be included in the output directory
(default: False)
If available, we recommend using raw or trimmed reads instead of assemblies as the extra data contained in reads is valuable for the process used by el_gato to identify sample ST. When run with reads, el_gato is able to use read quality and coverage information to apply quality control rules. When run using assemblies, el_gato is unable to identify errors that have been incorporated into the assembly and may therefore report incorrect results. For example, while many isolates encode two copies of mompS, in some cases only one copy of the locus is assembled. If only the secondary mompS locus is included in the assembly then el_gato will report that allele.
When running on a directory of reads, files are associated as pairs using the pattern R{1,2}.fastq. i.e., filenames should be identical except for containing either "R1" or "R2" and can be .fastq or .fastq.gz format. Any files for which a pair can not be identified using this pattern will not be processed.
When running on a directory of assemblies, all files in the target directory will be processed, and there is no filename restrictions.
After a run, el_gato will print the identified ST of your sample to your terminal (stdout) and write several files to the specified output directory (default: out/). A subdirectory is created for each sample processed, and each subdirectory is named with its sample name and contains output files specific to that sample (see below).
ST profile is written as a tab-delimited table without the headings. Headings are included if el_gato.py is run with -e flag and are displayed like so:
Sample ST flaA pilE asd mip mompS proA neuA_neuAH
The sample column contains the user-provided or inferred sample name. The ST column contains the overall sequence type of the sample.
The ST column can contain two kinds of values. If the identified ST corresponds to a profile found in the database, the corresponding number is given. If no matching ST profile is found or el_gato was unable to make a confident call, then this will be reflected in the value displayed in the ST column.
The corresponding allele number is reported for each gene if an exact allele match is found in the database. Alternatively, el_gato may also note the following symbols:
| Symbol | Meaning |
|---|---|
| Novel ST | Novel Sequence Type: All 7 target genes were found, but not present in the profile - most likely a novel sequence type. |
| Novel ST* | Novel Sequence Type due to novel allele: One or multiple target genes have a novel allele found. |
| MD- | Missing Data: ST is unidentifiable as a result of or more of the target genes that are unidentifiable. |
| MA? | Multiple Alleles: ST is ambiguous due to multiple alleles that could not be resolved. |
| NAT | Novel Allele Type: BLAST cannot find an exact allele match - most likely a new allele. |
| - | Missing Data: Both percent and length identities are too low to return a match or N's in sequence. |
| ? | Multiple Alleles: More than one allele was found and could not be resolved. |
If symbols are present in the ST profile, the other output files produced by el_gato will provide additional information to understand what is being communicated.
This file would contain all possible ST profiles if el_gato identified multiple possible alleles for any ST loci. In addition, if multiple mompS alleles were found, the information used to determine the primary allele is reported in two columns: "mompS_reads_support" and "mompS_reads_against." mompS_reads_support indicates the number of reads associated with each allele that contains the reverse sequencing primer in the expected orientation, which suggests that this is the primary allele. mompS_reads_against indicates the number of reads containing the reverse sequencing primer in the wrong orientation and thus demonstrates that this is the secondary allele. These values are used to infer which allele is the primary mompS allele, and their values can be considered to represent the confidence of this characterization. See Approach subsection for more details.
el_gato calls other programs to perform intermediate analyses. The outputs of those programs are provided in this file. In addition, to help with troubleshooting issues, important log messages are also written in this file. The following information may be contained in this file, depending on if the input is reads or assembly:
- Reads-only - Samtools coverage command output. See samtools coverage documentation for more information about headers or below.
- Reads-only - Information about the orientation of mompS sequencing primer in reads mapping to biallelic sites. See Approach subsection for more details.
- BLAST output indicating the best match for identified alleles. See BLAST output documentation for more information about headers or below.
Headers are included in outputs for the samtools coverage command and blast results. Header definitions are as follows:
| Column header | Meaning |
|---|---|
| rname | Locus name |
| numreads | Number reads aligned to the region (after filtering) |
| covbases | Number of covered bases with depth >= 10 |
| coverage | Percentage of covered bases [0..100] |
| meandepth | Mean depth of coverage |
| meanbaseq | Mean baseQ in covered region |
| meanmapq | Mean mapQ of selected reads |
| Column header | Meaning |
|---|---|
| qseqid | Query sequence id |
| sseqid | Subject (matched allele) id |
| pident | Percentage of identical matches |
| length | Alignment length (sequence overlap) |
| mismatch | Number of mismatches |
| gapopen | Mumber of gap openings |
| qstart | Start of alignment in query |
| qend | End of alignment in query |
| sstart | Start of alignment in subject |
| send | End of alignment in subject |
| evalue | Expect value |
| bitscore | Bit score |
| qlen | Query sequence length |
| slen | Subject sequence length |
The nucleotide sequence of all identified alleles is written in this file. If more than one allele is determined for the same locus, they are numbered arbitrarily. Fasta headers of sequences in this file correspond to the query IDs in the BLAST output reported in the intermediate_outputs.txt file.
A detailed log of the steps taken during el_gato's running includes the outputs of any programs called by el_gato and any errors encountered. Some command outputs include headers (e.g., samtools coverage and BLAST).
el_gato maps the provided reads to a set of reference sequences in the el_gato db directory. The mapped reads are then used to extract the sequences present in the sample for identifying the alleles and, ultimately, the ST. reads_vs_all_ref_filt_sorted.bam and its associated file reads_vs_all_ref_filt_sorted.bai contains the mapping information that was used by el_gato. The BAM file can be viewed using software such as IGV to understand better the data used by el_gato to make allele calls. Additionally, this file is a good starting point for investigating the cause of incorrectly resolved loci.
Note: A SAM file is also present, which has the same information as in the BAM file.
Each sample outputs a json file that contains relevant information about the run that will be included in the report PDF.
Summary page metadata: Complete MLST profile of the sample and the abbreviation key for the symbols.
Run-specific data:
Paired-end reads: Locus coverage information and mompS primer information.
Assembly: BLAST hit length and sequence identity thresholds and locus location information.
At its core, el_gato uses BLAST to identify the closest match to each allele in your input data. For the loci flaA, pilE, asd, mip, and proA, this process is straight forward. Whereas loci mompS and neuA/neuAh require more involved processing, with neuA/neuAh being an issue only when processing reads—the specifics of these loci are discussed in the corresponding sections below.
First for the simple loci (flaA, pilE, asd, mip, and proA), the following processes are used:
When processing reads, identification of both mompS and neuA/neuAh requires additional analyses (described below). The other five loci are processed by mapping the provided reads to reference loci from L. pneumophila strain Paris and identifying the consensus sequence. Then, all alleles are determined using BLAST against the SBT allele database.
A couple of quality control steps are applied when processing the reads:
- Base quality: Any bases with quality scores below 20 are not included when calculating coverage at each position or identifying alternate base calls. The lowest number of bases with quality over 20 that map to a single position is reported in the log for each locus [add exact name of the identifier].
- Coverage: After excluding low-quality bases, if there is not at least one read covering 100% of the locus (<99% for neuA/neuAh - see below), then no attempt to identify the allele is made, and a "-" will be reported. A minimum depth of 10 is applied as a cutoff.
The sequence of neuA/neuAh loci can differ dramatically. The differences in sequence between neuA/neuAh alleles are sufficient that reads from some alleles will not map to others. Accordingly, we map reads to [X number of] reference sequences that cover the sequence variation currently represented in the SBT database. The [X number of] reference alleles used are the neuA allele from strain Paris (neuA_1), the neuAh allele from strain Dallas-1E (neuA_201), and [description of other reference sequences]. The reference sequence with the best mapping [what defines best? Is it the number of reads?] is identified using samtools coverage with the caveat that >99% of the neuA/neuAh locus must have coverage of at least one read (some alleles contain small indels, so 100% is too strict); otherwise a "-" will be reported. Once the reference sequence is selected, the processing using BLAST is the same as described above.
As described in the assembly section, mompS is sometimes present in multiple copies in the genome of L. pneumophila isolates though it is typically two copies. Duplicate gene copies pose an obvious challenge for a read-mapping approach: if two similar sequence copies are present in a genome, reads from both copies may map to the same reference sequence.
el_gato resolves this issue by taking advantage of the proximity of the genome's two copies of mompS (a schematic of the organization of the two mompS copies can be found in Fig. 1 in this paper).. The sequence context of the two mompS copies is such that the correct copy is immediately upstream of the incorrect copy. Only the right copy is flanked on either side by sequences corresponding to primers (mompS-450F and mompS-1116R) used for conventional SBT. In contrast, while mompS-450F sequences are present upstream of the incorrect copy, the corresponding mompS-1116R sequences are not found downstream. For this reason, only the correct copy is amplified in conventional SBT (See below schematic.)
The sequence of the two copies of mompS and the identity of the correct allele is then resolved through the following process:
-
Reads from both mompS copies are mapped to a single mompS reference sequence flanked by the mompS-450F and mompS-1116R primer sequences.
-
The nucleotide sequence of reads is recorded for each position within the mompS sequence. If the base at a particular position is heterogeneous in more than 30% of reads mapped to that position, the position is considered biallelic, and both bases are recorded. If the sequence contains only one copy of mompS or no sequence variation between the duplicate copies, then no biallelic sites will be found. Then, the sequence will be extracted, and an allele can be identified using BLAST.
-
If multiple biallelic positions are identified, all sequences are recorded, and individual read pairs are identified that map to each of the biallelic position(s).
-
Once the two alleles have been resolved, the correct allele for SBT is identified by analyzing the reads associated with each allele. Reads from each allele are searched for the mompS-1116R sequence. The orientation of the reads that contain the primer sequence is assessed. If the primer maps 3'-5' relative to the reference sequence (i.e., in the reverse direction), this is consistent with the read pair originating from the correct copy of mompS. However, if the read containing the primer maps 5'-3' (i.e., in the forward direction) relative to mompS, this is consistent with the read pair originating from the wrong copy of mompS.
-
The number of reads associated with each allele that contains the primer in the correct orientation relative to mompS is counted and compared. The correct allele is then chosen using the following criteria:
a. Only one allele has associated reads with primer mompS-1116R correctly oriented.
b. One allele has more than three times as many reads with correctly oriented primer as the other.
c. One allele has no associated reads with the primer mompS-1116R in either orientation, but the other allele has associated reads with the primer in only the wrong orientation. In this case, the allele with no associated reads with the primer in either orientation is considered the primary locus by the process of elimination.
-
The allele number of all alleles is then determined using BLAST and the ST is generated using the correct allele.
Note that as the above process depends upon read pairs mapping to biallelic sites and the primer region, sequence data characteristics such as read length and insert size can impact the ability of el_gato to determine mompS alleles.
If the above process cannot identify the correct sequence, a ? will be returned as the mompS allele, and el_gato will report information about the steps in this process in the output files.
Six of the seven loci (flaA, pilE, asd, mip,proA, and neuA/neuAh) are identified using BLAST. For each, the best BLAST result is returned as the allele. The closest match is returned with an * if loci have no exact match. [add in updated code changes if necessary] When processing an assembly, only mompS requires extra processing.
mompS is sometimes present in multiple copies in Legionella pneumophila, though typically two copies. When typing L. pneumophila using Sanger sequencing, primers amplify only the correct mompS locus. We, therefore, use in silico PCR to extract the correct mompS locus sequence from the assembly. The primers used for in silico PCR are mompS-450F (TTGACCATGAGTGGGATTGG) and mompS-1116R (TGGATAAATTATCCAGCCGGACTTC) as described in this protocol. The mompS allele is then identified using BLAST.
We provide a singularity container that can be run using the nextflow workflow for el_gato on a directory of either reads or assemblies. In both cases the target directory must contain only paired reads files (in .fastq or .fastq.gz format) or assembly files (in fasta format).
# Reads
nextflow run_el_gato.nf --reads_dir <path/to/reads/directory> --threads <threads> --out <path/to/output/directory> -profile singularity -c nextflow.config
# Assemblies
nextflow run_el_gato.nf --assembly_dir <path/to/assemblies/directory> --threads <threads> --out <path/to/output/directory> -profile singularity -c nextflow.config
Note: To run nextflow without the singularity container, uncomment conda environment installation on line 10 and line 47 of the run_el_gato.nf file and use the following commands:
# Reads
nextflow run_el_gato.nf --reads_dir <path/to/reads/directory> --threads <threads> --out <path/to/output/directory>
# Assemblies
nextflow run_el_gato.nf --assembly_dir <path/to/assemblies/directory> --threads <threads> --out <path/to/output/directory>
At the completion of a run, the specified output directory (default: el_gato_out/) will contain a file named "all_mlst.txt" (the MLST profile of each sample) and one directory for each sample processed. Each sub-directory is named with a sample name and contains output files specific to that sample. These files include the el_gato log file and files providing more details about the sequences identified in the sample.
Additionally, the specified output directory will contain a combined json file (report.json) that contains all of the data from the individual sample-level json files and the report PDF (report.pdf).
We provide a script that generates a PDF report of each el_gato run using the report.json file generated in the output folder for each sample.
This report generated by Nextflow by default, but must be run manually if running el_gato for individual samples.
A report can be generated for one or more samples and may include both assembly and read report jsons.
elgato_report.py -i <path/to/report1.json> [<path/to/report2.json> ...] -o <path/to/output/report.pdf>