problem to getting output for VDJ assignment

[saramoein372]

Hello,
I have a fasta file with below format, and like to have VDJ assignment based the reference (IGMT or IGBLAST) for each of the sequence. After running the abstar on my fasta file, no output generated.

Would you please guide me what command I should run to get the VDJ assignment based on each sequence?

This id some line of fasta file:

A00814:550:HYJTNDSX2:4:1301:32931:2159 -1 3613904 3898754 barcode:CATGACAGTTCGGCAC umi:1158
GTCCCAGGTCACCATCACCGGCTCCGGGAAGTAGCCCGTGGCCAGGCAGCCCAGAGTCACGGAGGTGGCATTGGAGGGAATG
A00814:550:HYJTNDSX2:4:2208:32949:8954 -1 3590858 3897376 barcode:AAATGCCTCCAAACAC umi:29477
GTCCCAGGTCACCATCACCGGCTCCGGGAAGTAGCCCGTGGCCAGGCAGCCCAGAGTCACGGAGGTGGCATTGGAGGGAATGTTTTT
A00814:550:HYJTNDSX2:4:1117:27362:15436 -1 2780052 3085745 barcode:ACGCAGCCATTATCTC umi:41999
GCGTTATCCACCTTCCACTGTACTTTGGCCTCTCTGGGATAGAAGTTATTCAGCAGGCACACAACAGAGGCAGTTCCAGATTTCAACTGC

[briney]

Hi Sara-

A couple things. First, your sequences don't appear to be in FASTA format, which is:

>sequence_id1
ATGC
>sequence_id2
CGTA

The sequence ID lines in your file appear to be lacking the leading > character. Improperly formatted FASTA files will likely fail when being read by abstar, which uses biopython's SeqIO.parse() function for reading input files.

Second, it doesn't appear that the sequences you provided are antibody recombinations. Abstar was unable to confidently identify any VDJ genes, and this was verified by testing the sequences using IMGT/V-QUEST, which was also unable to find any VDJ genes.

[saramoein372]

Hi Bryana, Thanks for your response. Do you know any tool that I can get the VDJJ assignment for my sequences in the shape you saw? Regards, Sara

…

On Thu, Nov 17, 2022 at 3:19 PM Bryan Briney ***@***.***> wrote: Hi Sara- A couple things. First, your sequences don't appear to be in FASTA format, which is: >sequence_id1 ATGC >sequence_id2 CGTA The seqeunce ID lines in your file appear to be lacking the leading > character. Improperly formatted FASTA files will likely fail when being read by abstar, which uses biopython's SeqIO.parse() function for reading input files. Second, it doesn't appear that the sequences you provided are antibody recombinations. Abstar was unable to confidently identify any VDJ genes, and this was verified by testing the sequences using IMGT/V-QUEST, which was also unable to find any VDJ genes. — Reply to this email directly, view it on GitHub <#112 (comment)>, or unsubscribe <https://github.com/notifications/unsubscribe-auth/AVVJONXRTUTRXT6DV6JFXSDWI2HOJANCNFSM6AAAAAASDXPGHI> . You are receiving this because you authored the thread.Message ID: ***@***.***>