reannotator_microarray_probes pipeline

Pipeline for microarray probes sequence reannotation.

Summary

1. Environment preparation
2. Clone the reannotator GitHub repository
3. Prepare the human genome sequence and mapper index
4. Change the reference genome
5. Prepare GPL sequence file
6. To start all processes to reannotation of each probe
7. Docker installation
8. For Linux and MacOS

Workflow

Environment preparation

In your command line Terminal, download the Miniconda installer:

cd <specify a directory path>
wget -O Miniconda3.sh https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh

or you can use the curl command line

curl -sL \
  "https://repo.anaconda.com/miniconda/Miniconda3-latest-Linux-x86_64.sh" > \
  "Miniconda3.sh"

Install the Miniconda by the command line:

bash Miniconda3.sh

Miniconda3 installation process

Welcome to Miniconda3 py38_4.9.2

In order to continue the installation process, please review the license
agreement.
Please press ENTER to continue.
>>>

Do you accept the license terms? [yes|no]
[no] >>> yes

Miniconda3 will now be installed into this location:
/root/miniconda3

  - Press ENTER to confirm the location
  - Press CTRL-C to abort the installation
  - Or specify a different location below

[/root/miniconda3] >>> 
PREFIX=<Define your directory here! or enter to keep /root/miniconda3 directory>

Do you wish the installer to initialize Miniconda3
by running conda init? [yes|no]
[no] >>> yes

After Miniconda3 installation, delete the installer file:

rm Miniconda3.sh

Important!!! Close and reopen your terminal to activate the Conda base environment.

Update Conda using the command line:

conda update conda

Finally, install the programs wget and git using the Conda command:

conda install git
conda install wget

Clone the reannotator GitHub repository

git clone https://github.com/csbl-usp/reannotator-microarray-probes.git

Entry on the source directory it contains all scripts

cd reannotator-microarray-probes/src/

Change the file permission for "execution" mode

chmod 755 *

Build the conda environment for all required packages for the pipeline

conda env create --file ../parameters/reannotator_env.yml
conda activate reannotator

Important!!! Make sure the reannotator environment are actived or execute the command 'conda activate reannotator' for it.

Prepare the human genome sequence and mapper index

Build a human genome directory

./createReferenceDirectory

The reference genome used for this pipeline is release-103 from ENSEMBL database.

Change the reference genome

Open the create database folders

Edit the script file src/createReferenceDirectory, and modify these lines:

...
# You can change it to any string. Just avoid starting with numbers and the string containing spaces
alias=hsapiens

...

# Change all occurences of 'Homo_sapiens' for your reference genome.
touch $dbdir/genome/fa/Homo_sapiens_chrs.fa
for i in 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X Y MT
  do
	  wget -O $dbdir/genome/fa/Homo_sapiens_chr${i}.fa.gz http://ftp.ensembl.org/pub/release-103/fasta/homo_sapiens/dna/Homo_sapiens.GRCh38.dna_sm.chromosome.${i}.fa.gz
		gunzip $dbdir/genome/fa/Homo_sapiens_chr${i}.fa.gz
		cat $dbdir/genome/fa/Homo_sapiens_chr${i}.fa >> $dbdir/genome/fa/Homo_sapiens_chrs.fa
		rm $dbdir/genome/fa/Homo_sapiens_chr${i}.fa
  done

	cd $dbdir/genome/fa/
	ln -s Homo_sapiens_chrs.fa ${alias}.fa

...

# Change all occurences of 'Homo_sapiens' for your reference genome.
wget -O $dbdir/annotation/Homo_sapiens.gff.gz http://ftp.ensembl.org/pub/release-103/gff3/homo_sapiens/Homo_sapiens.GRCh38.103.chr.gff3.gz
gunzip $dbdir/annotation/Homo_sapiens.gff.gz
cd $dbdir/annotation
ln -s Homo_sapiens.gff ${alias}.gff

Under construction How to change the human reference genome for new or old versions.

Prepare GPL sequence file

Show a platform structure with a tree command:

tree ../platforms/

Strutucure of GPL directory.

../platforms/
|-- GPL10558
|   |-- probe_sequence.tsv
|-- GPL13287
|   |-- probe_sequence.tsv
|-- GPL13497
|   |-- probe_sequence.tsv

The content of probe_sequence.tsv should be "ID" and "SEQUENCE" columns.

head ../platforms/GPL10558/probe_sequence.tsv

"ID"    "SEQUENCE"
"ILMN_1343048"  "GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA"
"ILMN_1343049"  "CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA"
"ILMN_1343050"  "CCGACAGATGTATGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGAT"
"ILMN_1343052"  "TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC"
"ILMN_1343059"  "CTTGTGCCTGAGCTGTCAAAAGTAGAGCACGTCGCCGAGATGAAGGGCGC"
"ILMN_1343061"  "AATTAAAACGATGCACTCAGGGTTTAGCGCGTAGACGTATTGCATTATGC"
"ILMN_1343062"  "GAAGCATTCAGAGCAAATGAGGCAGCGTTGGTGTAGCACGATAATAATAT"
"ILMN_1343063"  "CGGACGTTATGATTTACCGTGGAAAGATTTGTGAAGTGTTCTGAATGCTC"
"ILMN_1343064"  "GCCCCGTATTCAGTGTGGCTGATTTGTATTGTCAGAAGTTGTTTTTACGT"

Based on the existent platforms directories, create a new directory for the new platforms.

To start all processes to reannotation of each probe

Execute the pipeline

./pipeline

The results of output Reannotation are stored in all_annotated_probes.tsv file!

head ../results/all_annotated_probes.tsv

ProbeID Symbol  EnsemblIDs      Biotypes2       Biotypes1       Symbols
ILMN_1799969    SNAPIN  ENSG00000143553|ENST00000462880 protein_coding|processed_transcript     gene|lnc_RNA    SNAPIN|SNAPIN-202
ILMN_1783231    PLEKHB1 ENSG00000021300|ENST00000426191|ENST00000544282 protein_coding|retained_intron|processed_transcript     gene|lnc_RNA|lnc_RNA >
ILMN_1745398    PCDH15  ENST00000463095|ENSG00000150275 processed_transcript|protein_coding     lnc_RNA|gene    PCDH15-218|PCDH15
ILMN_2072091    HNRNPUL2        ENSG00000234857|ENSG00000214753 protein_coding|protein_coding   gene|gene       HNRNPUL2-BSCL2|HNRNPUL2
ILMN_1737738    NDUFA12 ENSG00000184752 protein_coding  gene    NDUFA12
ILMN_1668194    LMTK3   ENSG00000142235 protein_coding  gene    LMTK3
ILMN_1734542    OVGP1   ENSG00000085465 protein_coding  gene    OVGP1
ILMN_1672623    LRRC77P ENST00000481578|ENST00000459923 processed_transcript|processed_transcript       lnc_RNA|lnc_RNA LRRC77P-206|LRRC77P-201
ILMN_1666200    SHLD2   ENSG00000122376 protein_coding  gene    SHLD2

Cleaning result to execute the pipeline again!!

If you need to execute the pipeline for the same platforms, you need to execute the cleaner script before:

./cleaner

If you add new platforms after any execution, the pipeline will analyze the new platform only.

Use the Docker image for reannotator pipeline

Docker installation

Access the website https://www.docker.com/get-started to install the docker program in Windows, MacOS or Linux systems.

Download the reannotator image from the Docker hub. Access the terminal and execute the command line.

$ docker pull csblusp/reannotator

For Linux and MacOS

Create a Docker container for reannotator image

docker run -d -it --rm --name reannotator [-v <put your directory path here!>:/home] csblusp/reannotator

-v corresponds to the volumes parameter to link the local directory to the container directory and access/download files from the Docker container. Check out more details at the Docker volumes website: https://docs.docker.com/storage/volumes/

Entry on the Docker container of reannotator

docker exec -it reannotator bash

Entry on the reannotator pipeline directory

cd /home/reannotator_microarray_probes
git pull

cd /home/reannotator_microarray_probes/src
conda activate reannotator

Execute the same steps from the Prepare the human genome sequence and mapper index

For Windows system

Under construction