Fix table.get("wrong_length_string") gives core dump

ChangeLog

@@ -1,3 +1,10 @@
+2014-08-30  Rhys Kidd  <rhyskidd@gmail.com>
+
+    * khmer/_khmermodule.cc: fix table.get("wrong_length_string") gives core dump
+    * lib/kmer_hash.cc: improve quality of exception error message
+    * tests/{test_counting_hash,test_counting_single,test_hashbits,
+        test_hashbits_obj}.py: add regression unit tests
+
 2014-08-28  Titus Brown  <titus@idyll.org>
 
     * scripts/normalize-by-median.py: added reporting output after main loop

khmer/_khmermodule.cc

@@ -1367,6 +1367,13 @@ static PyObject * hash_get(PyObject * self, PyObject * args)
         count = counting->get_count((unsigned int) pos);
     } else if (PyString_Check(arg)) {
         std::string s = PyString_AsString(arg);
+
+        if (strlen(s.c_str()) < counting->ksize()) {
+            PyErr_SetString(PyExc_ValueError,
+                            "string length must >= the counting table k-mer size");
+            return NULL;
+        }
+
         count = counting->get_count(s.c_str());
     }
 
@@ -2328,6 +2335,13 @@ static PyObject * hashbits_get(PyObject * self, PyObject * args)
         count = hashbits->get_count((unsigned int) pos);
     } else if (PyString_Check(arg)) {
         std::string s = PyString_AsString(arg);
+
+        if (strlen(s.c_str()) < hashbits->ksize()) {
+            PyErr_SetString(PyExc_ValueError,
+                            "string length must >= the presence table k-mer size");
+            return NULL;
+        }
+
         count = hashbits->get_count(s.c_str());
     } else {
         PyErr_SetString(PyExc_ValueError, "must pass in an int or string");

lib/kmer_hash.cc

@@ -27,7 +27,7 @@ HashIntoType _hash(const char * kmer, const WordLength k,
 {
     // sizeof(HashIntoType) * 8 bits / 2 bits/base
     if (!(k <= sizeof(HashIntoType)*4) || !(strlen(kmer) >= k)) {
-        throw khmer_exception();
+        throw khmer_exception("Supplied kmer string doesn't match the underlying k-size.");
     }
 
     HashIntoType h = 0, r = 0;

tests/test_counting_hash.py

@@ -816,6 +816,22 @@ def test_badget():
         print str(err)
 
 
+def test_badget_2():
+    countingtable = khmer.new_counting_hash(6, 1e6)
+
+    countingtable.consume(DNA)
+
+    assert countingtable.get("AGCTTT") == 1
+
+    assert countingtable.get("GATGAG") == 0
+
+    try:
+        countingtable.get("AGCTT")
+        assert 0, "this should fail"
+    except ValueError, err:
+        print str(err)
+
+
 def test_badtrim():
     countingtable = khmer.new_counting_hash(6, 1e6, 2)
 

tests/test_counting_single.py

@@ -254,6 +254,24 @@ def test_get_mincount_rc():
     assert x == 2
 
 
+def test_badget():
+    kh = khmer.new_hashtable(6, 4 ** 10)
+
+    DNA = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAG"
+
+    kh.consume(DNA)
+
+    assert kh.get("AGCTTT") == 1
+
+    assert kh.get("GATGAG") == 0
+
+    try:
+        kh.get("AGCTT")
+        assert 0, "this should fail"
+    except ValueError, err:
+        print str(err)
+
+
 def test_64bitshift():
     kh = khmer.new_hashtable(25, 4)
     fullstr = "GTATGCCAGCTCCAACTGGGCCGGTACGAGCAGGCCATTGCCTCTTGCCGCGATGCGTCGGCG"

tests/test_hashbits.py

@@ -550,6 +550,25 @@ def test_simple_median():
     assert average == 1.0
     assert stddev == 0.0
 
+
+def test_badget():
+    hbts = khmer.new_hashbits(6, 1e6, 1)
+
+    dna = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAG"
+
+    hbts.consume(dna)
+
+    assert hbts.get("AGCTTT") == 1
+
+    assert hbts.get("GATGAG") == 0
+
+    try:
+        hbts.get("AGCTT")
+        assert 0, "this should fail"
+    except ValueError, err:
+        print str(err)
+
+
 ####
 
 

tests/test_hashbits_obj.py

@@ -557,6 +557,24 @@ def test_simple_median():
     assert stddev == 0.0
 
 
+def test_badget():
+    hbts = khmer.Hashbits(6, 1e6, 1)
+
+    dna = "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAG"
+
+    hbts.consume(dna)
+
+    assert hbts.get("AGCTTT") == 1
+
+    assert hbts.get("GATGAG") == 0
+
+    try:
+        hbts.get("AGCTT")
+        assert 0, "this should fail"
+    except ValueError, err:
+        print str(err)
+
+
 def test_bad_primes():
     try:
         countingtable = khmer._Hashbits.__new__(