#1801 No monomer full name when import from a sequence (#1820)

epam · Mar 15, 2024 · a289c03 · a289c03
1 parent 8cd9f1e
commit a289c03
Show file tree

Hide file tree

Showing 39 changed files with 247 additions and 65 deletions.
diff --git a/api/tests/integration/tests/formats/ref/acgt_1412.ket b/api/tests/integration/tests/formats/ref/acgt_1412.ket
@@ -399,6 +399,7 @@
         "classHELM": "RNA",
         "alias": "P",
         "name": "P",
+        "fullName": "Phosphate",
         "naturalAnalogShort": "P",
         "attachmentPoints": [
             {
@@ -498,6 +499,7 @@
         "classHELM": "RNA",
         "alias": "R",
         "name": "Rib",
+        "fullName": "Ribose",
         "naturalAnalogShort": "R",
         "naturalAnalog": "Rib",
         "attachmentPoints": [
@@ -726,6 +728,7 @@
         "classHELM": "RNA",
         "alias": "A",
         "name": "Ade",
+        "fullName": "Adenine",
         "naturalAnalogShort": "A",
         "naturalAnalog": "Ade",
         "attachmentPoints": [
@@ -922,6 +925,7 @@
         "classHELM": "RNA",
         "alias": "C",
         "name": "Cyt",
+        "fullName": "Cytosine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cyt",
         "attachmentPoints": [
@@ -1081,6 +1085,7 @@
         "classHELM": "RNA",
         "alias": "G",
         "name": "Gua",
+        "fullName": "Guanine",
         "naturalAnalogShort": "G",
         "naturalAnalog": "Gua",
         "attachmentPoints": [
@@ -1292,6 +1297,7 @@
         "classHELM": "RNA",
         "alias": "T",
         "name": "Thy",
+        "fullName": "Thymine",
         "naturalAnalogShort": "T",
         "naturalAnalog": "Thy",
         "attachmentPoints": [
@@ -1466,6 +1472,7 @@
         "classHELM": "RNA",
         "alias": "U",
         "name": "Ura",
+        "fullName": "Uracil",
         "naturalAnalogShort": "U",
         "naturalAnalog": "Ura",
         "attachmentPoints": [

diff --git a/api/tests/integration/tests/formats/ref/all_aminoacids.ket b/api/tests/integration/tests/formats/ref/all_aminoacids.ket
@@ -616,6 +616,7 @@
         "classHELM": "PEPTIDE",
         "alias": "A",
         "name": "Ala",
+        "fullName": "Alanine",
         "naturalAnalogShort": "A",
         "naturalAnalog": "Ala",
         "attachmentPoints": [
@@ -748,6 +749,7 @@
         "classHELM": "PEPTIDE",
         "alias": "C",
         "name": "Cys",
+        "fullName": "Cysteine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cys",
         "attachmentPoints": [
@@ -918,6 +920,7 @@
         "classHELM": "PEPTIDE",
         "alias": "D",
         "name": "Asp",
+        "fullName": "Aspartic acid",
         "naturalAnalogShort": "D",
         "naturalAnalog": "Asp",
         "attachmentPoints": [
@@ -1118,6 +1121,7 @@
         "classHELM": "PEPTIDE",
         "alias": "E",
         "name": "Glu",
+        "fullName": "Glutamic acid",
         "naturalAnalogShort": "E",
         "naturalAnalog": "Glu",
         "attachmentPoints": [
@@ -1333,6 +1337,7 @@
         "classHELM": "PEPTIDE",
         "alias": "F",
         "name": "Phe",
+        "fullName": "Phenylalanine",
         "naturalAnalogShort": "F",
         "naturalAnalog": "Phe",
         "attachmentPoints": [
@@ -1562,6 +1567,7 @@
         "classHELM": "PEPTIDE",
         "alias": "G",
         "name": "Gly",
+        "fullName": "Glycine",
         "naturalAnalogShort": "G",
         "naturalAnalog": "Gly",
         "attachmentPoints": [
@@ -1677,6 +1683,7 @@
         "classHELM": "PEPTIDE",
         "alias": "H",
         "name": "His",
+        "fullName": "Histidine",
         "naturalAnalogShort": "H",
         "naturalAnalog": "His",
         "attachmentPoints": [
@@ -1914,6 +1921,7 @@
         "classHELM": "PEPTIDE",
         "alias": "I",
         "name": "Ile",
+        "fullName": "Isoleucine",
         "naturalAnalogShort": "I",
         "naturalAnalog": "Ile",
         "attachmentPoints": [
@@ -2093,6 +2101,7 @@
         "classHELM": "PEPTIDE",
         "alias": "K",
         "name": "Lys",
+        "fullName": "Lysine",
         "naturalAnalogShort": "K",
         "naturalAnalog": "Lys",
         "attachmentPoints": [
@@ -2308,6 +2317,7 @@
         "classHELM": "PEPTIDE",
         "alias": "L",
         "name": "Leu",
+        "fullName": "Leucine",
         "naturalAnalogShort": "L",
         "naturalAnalog": "Leu",
         "attachmentPoints": [
@@ -2485,6 +2495,7 @@
         "classHELM": "PEPTIDE",
         "alias": "M",
         "name": "Met",
+        "fullName": "Methionine",
         "naturalAnalogShort": "M",
         "naturalAnalog": "Met",
         "attachmentPoints": [
@@ -2662,6 +2673,7 @@
         "classHELM": "PEPTIDE",
         "alias": "N",
         "name": "Asn",
+        "fullName": "Asparagine",
         "naturalAnalogShort": "N",
         "naturalAnalog": "Asn",
         "attachmentPoints": [
@@ -2862,6 +2874,7 @@
         "classHELM": "PEPTIDE",
         "alias": "O",
         "name": "Pyl",
+        "fullName": "Pyrrolysine",
         "naturalAnalogShort": "O",
         "attachmentPoints": [
             {
@@ -3182,6 +3195,7 @@
         "classHELM": "PEPTIDE",
         "alias": "P",
         "name": "Pro",
+        "fullName": "Proline",
         "naturalAnalogShort": "P",
         "naturalAnalog": "Pro",
         "attachmentPoints": [
@@ -3351,6 +3365,7 @@
         "classHELM": "PEPTIDE",
         "alias": "Q",
         "name": "Gln",
+        "fullName": "Glutamine",
         "naturalAnalogShort": "Q",
         "naturalAnalog": "Gln",
         "attachmentPoints": [
@@ -3566,6 +3581,7 @@
         "classHELM": "PEPTIDE",
         "alias": "R",
         "name": "Arg",
+        "fullName": "Arginine",
         "naturalAnalogShort": "R",
         "naturalAnalog": "Arg",
         "attachmentPoints": [
@@ -3811,6 +3827,7 @@
         "classHELM": "PEPTIDE",
         "alias": "S",
         "name": "Ser",
+        "fullName": "Serine",
         "naturalAnalogShort": "S",
         "naturalAnalog": "Ser",
         "attachmentPoints": [
@@ -3981,6 +3998,7 @@
         "classHELM": "PEPTIDE",
         "alias": "U",
         "name": "Sec",
+        "fullName": "Selenocysteine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cys",
         "attachmentPoints": [
@@ -4128,6 +4146,7 @@
         "classHELM": "PEPTIDE",
         "alias": "V",
         "name": "Val",
+        "fullName": "Valine",
         "naturalAnalogShort": "V",
         "naturalAnalog": "Val",
         "attachmentPoints": [
@@ -4290,6 +4309,7 @@
         "classHELM": "PEPTIDE",
         "alias": "W",
         "name": "Trp",
+        "fullName": "Tryptophan",
         "naturalAnalogShort": "W",
         "naturalAnalog": "Trp",
         "attachmentPoints": [
@@ -4594,6 +4614,7 @@
         "classHELM": "PEPTIDE",
         "alias": "Y",
         "name": "Tyr",
+        "fullName": "Tyrosine",
         "naturalAnalogShort": "Y",
         "naturalAnalog": "Tyr",
         "attachmentPoints": [

diff --git a/api/tests/integration/tests/formats/ref/conjugate.ket b/api/tests/integration/tests/formats/ref/conjugate.ket
@@ -4805,6 +4805,7 @@
         "classHELM": "RNA",
         "alias": "P",
         "name": "P",
+        "fullName": "Phosphate",
         "naturalAnalogShort": "P",
         "attachmentPoints": [
             {
@@ -4904,6 +4905,7 @@
         "classHELM": "RNA",
         "alias": "dR",
         "name": "dRib",
+        "fullName": "Deoxy-Ribose",
         "naturalAnalogShort": "R",
         "naturalAnalog": "Rib",
         "attachmentPoints": [
@@ -5115,6 +5117,7 @@
         "classHELM": "RNA",
         "alias": "T",
         "name": "Thy",
+        "fullName": "Thymine",
         "naturalAnalogShort": "T",
         "naturalAnalog": "Thy",
         "attachmentPoints": [
@@ -5289,6 +5292,7 @@
         "classHELM": "RNA",
         "alias": "G",
         "name": "Gua",
+        "fullName": "Guanine",
         "naturalAnalogShort": "G",
         "naturalAnalog": "Gua",
         "attachmentPoints": [
@@ -5500,6 +5504,7 @@
         "classHELM": "RNA",
         "alias": "C",
         "name": "Cyt",
+        "fullName": "Cytosine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cyt",
         "attachmentPoints": [
@@ -5659,6 +5664,7 @@
         "classHELM": "RNA",
         "alias": "A",
         "name": "Ade",
+        "fullName": "Adenine",
         "naturalAnalogShort": "A",
         "naturalAnalog": "Ade",
         "attachmentPoints": [

diff --git a/api/tests/integration/tests/formats/ref/dna_acgtu.ket b/api/tests/integration/tests/formats/ref/dna_acgtu.ket
@@ -374,6 +374,7 @@
         "classHELM": "RNA",
         "alias": "A",
         "name": "Ade",
+        "fullName": "Adenine",
         "naturalAnalogShort": "A",
         "naturalAnalog": "Ade",
         "attachmentPoints": [
@@ -570,6 +571,7 @@
         "classHELM": "RNA",
         "alias": "dR",
         "name": "dRib",
+        "fullName": "Deoxy-Ribose",
         "naturalAnalogShort": "R",
         "naturalAnalog": "Rib",
         "attachmentPoints": [
@@ -781,6 +783,7 @@
         "classHELM": "RNA",
         "alias": "C",
         "name": "Cyt",
+        "fullName": "Cytosine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cyt",
         "attachmentPoints": [
@@ -940,6 +943,7 @@
         "classHELM": "RNA",
         "alias": "P",
         "name": "P",
+        "fullName": "Phosphate",
         "naturalAnalogShort": "P",
         "attachmentPoints": [
             {
@@ -1039,6 +1043,7 @@
         "classHELM": "RNA",
         "alias": "G",
         "name": "Gua",
+        "fullName": "Guanine",
         "naturalAnalogShort": "G",
         "naturalAnalog": "Gua",
         "attachmentPoints": [
@@ -1250,6 +1255,7 @@
         "classHELM": "RNA",
         "alias": "T",
         "name": "Thy",
+        "fullName": "Thymine",
         "naturalAnalogShort": "T",
         "naturalAnalog": "Thy",
         "attachmentPoints": [
@@ -1424,6 +1430,7 @@
         "classHELM": "RNA",
         "alias": "U",
         "name": "Ura",
+        "fullName": "Uracil",
         "naturalAnalogShort": "U",
         "naturalAnalog": "Ura",
         "attachmentPoints": [

diff --git a/api/tests/integration/tests/formats/ref/dna_mod.ket b/api/tests/integration/tests/formats/ref/dna_mod.ket
@@ -3555,6 +3555,7 @@
         "classHELM": "RNA",
         "alias": "P",
         "name": "P",
+        "fullName": "Phosphate",
         "naturalAnalogShort": "P",
         "attachmentPoints": [
             {
@@ -3654,6 +3655,7 @@
         "classHELM": "RNA",
         "alias": "dR",
         "name": "dRib",
+        "fullName": "Deoxy-Ribose",
         "naturalAnalogShort": "R",
         "naturalAnalog": "Rib",
         "attachmentPoints": [
@@ -3865,6 +3867,7 @@
         "classHELM": "RNA",
         "alias": "T",
         "name": "Thy",
+        "fullName": "Thymine",
         "naturalAnalogShort": "T",
         "naturalAnalog": "Thy",
         "attachmentPoints": [
@@ -4039,6 +4042,7 @@
         "classHELM": "RNA",
         "alias": "G",
         "name": "Gua",
+        "fullName": "Guanine",
         "naturalAnalogShort": "G",
         "naturalAnalog": "Gua",
         "attachmentPoints": [
@@ -4250,6 +4254,7 @@
         "classHELM": "RNA",
         "alias": "C",
         "name": "Cyt",
+        "fullName": "Cytosine",
         "naturalAnalogShort": "C",
         "naturalAnalog": "Cyt",
         "attachmentPoints": [
@@ -4409,6 +4414,7 @@
         "classHELM": "RNA",
         "alias": "A",
         "name": "Ade",
+        "fullName": "Adenine",
         "naturalAnalogShort": "A",
         "naturalAnalog": "Ade",
         "attachmentPoints": [

diff --git a/api/tests/integration/tests/formats/ref/dna_mod.seq b/api/tests/integration/tests/formats/ref/dna_mod.seq
@@ -1 +1 @@
-TGGCGAACTCACCAGTC*CCGC
+TGGCGAACTCACCAGTCTCCGC