Skip to content

Commit

Permalink
Backmerge: #1801 No monomer full name when import from a sequence (#1813
Browse files Browse the repository at this point in the history
)
  • Loading branch information
even1024 authored Mar 15, 2024
1 parent 610d8e9 commit fb2f17e
Show file tree
Hide file tree
Showing 39 changed files with 247 additions and 65 deletions.
7 changes: 7 additions & 0 deletions api/tests/integration/tests/formats/ref/acgt_1412.ket
Original file line number Diff line number Diff line change
Expand Up @@ -399,6 +399,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -498,6 +499,7 @@
"classHELM": "RNA",
"alias": "R",
"name": "Rib",
"fullName": "Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -726,6 +728,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down Expand Up @@ -922,6 +925,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -1081,6 +1085,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -1292,6 +1297,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -1466,6 +1472,7 @@
"classHELM": "RNA",
"alias": "U",
"name": "Ura",
"fullName": "Uracil",
"naturalAnalogShort": "U",
"naturalAnalog": "Ura",
"attachmentPoints": [
Expand Down
21 changes: 21 additions & 0 deletions api/tests/integration/tests/formats/ref/all_aminoacids.ket
Original file line number Diff line number Diff line change
Expand Up @@ -616,6 +616,7 @@
"classHELM": "PEPTIDE",
"alias": "A",
"name": "Ala",
"fullName": "Alanine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ala",
"attachmentPoints": [
Expand Down Expand Up @@ -748,6 +749,7 @@
"classHELM": "PEPTIDE",
"alias": "C",
"name": "Cys",
"fullName": "Cysteine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cys",
"attachmentPoints": [
Expand Down Expand Up @@ -918,6 +920,7 @@
"classHELM": "PEPTIDE",
"alias": "D",
"name": "Asp",
"fullName": "Aspartic acid",
"naturalAnalogShort": "D",
"naturalAnalog": "Asp",
"attachmentPoints": [
Expand Down Expand Up @@ -1118,6 +1121,7 @@
"classHELM": "PEPTIDE",
"alias": "E",
"name": "Glu",
"fullName": "Glutamic acid",
"naturalAnalogShort": "E",
"naturalAnalog": "Glu",
"attachmentPoints": [
Expand Down Expand Up @@ -1333,6 +1337,7 @@
"classHELM": "PEPTIDE",
"alias": "F",
"name": "Phe",
"fullName": "Phenylalanine",
"naturalAnalogShort": "F",
"naturalAnalog": "Phe",
"attachmentPoints": [
Expand Down Expand Up @@ -1562,6 +1567,7 @@
"classHELM": "PEPTIDE",
"alias": "G",
"name": "Gly",
"fullName": "Glycine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gly",
"attachmentPoints": [
Expand Down Expand Up @@ -1677,6 +1683,7 @@
"classHELM": "PEPTIDE",
"alias": "H",
"name": "His",
"fullName": "Histidine",
"naturalAnalogShort": "H",
"naturalAnalog": "His",
"attachmentPoints": [
Expand Down Expand Up @@ -1914,6 +1921,7 @@
"classHELM": "PEPTIDE",
"alias": "I",
"name": "Ile",
"fullName": "Isoleucine",
"naturalAnalogShort": "I",
"naturalAnalog": "Ile",
"attachmentPoints": [
Expand Down Expand Up @@ -2093,6 +2101,7 @@
"classHELM": "PEPTIDE",
"alias": "K",
"name": "Lys",
"fullName": "Lysine",
"naturalAnalogShort": "K",
"naturalAnalog": "Lys",
"attachmentPoints": [
Expand Down Expand Up @@ -2308,6 +2317,7 @@
"classHELM": "PEPTIDE",
"alias": "L",
"name": "Leu",
"fullName": "Leucine",
"naturalAnalogShort": "L",
"naturalAnalog": "Leu",
"attachmentPoints": [
Expand Down Expand Up @@ -2485,6 +2495,7 @@
"classHELM": "PEPTIDE",
"alias": "M",
"name": "Met",
"fullName": "Methionine",
"naturalAnalogShort": "M",
"naturalAnalog": "Met",
"attachmentPoints": [
Expand Down Expand Up @@ -2662,6 +2673,7 @@
"classHELM": "PEPTIDE",
"alias": "N",
"name": "Asn",
"fullName": "Asparagine",
"naturalAnalogShort": "N",
"naturalAnalog": "Asn",
"attachmentPoints": [
Expand Down Expand Up @@ -2862,6 +2874,7 @@
"classHELM": "PEPTIDE",
"alias": "O",
"name": "Pyl",
"fullName": "Pyrrolysine",
"naturalAnalogShort": "O",
"attachmentPoints": [
{
Expand Down Expand Up @@ -3182,6 +3195,7 @@
"classHELM": "PEPTIDE",
"alias": "P",
"name": "Pro",
"fullName": "Proline",
"naturalAnalogShort": "P",
"naturalAnalog": "Pro",
"attachmentPoints": [
Expand Down Expand Up @@ -3351,6 +3365,7 @@
"classHELM": "PEPTIDE",
"alias": "Q",
"name": "Gln",
"fullName": "Glutamine",
"naturalAnalogShort": "Q",
"naturalAnalog": "Gln",
"attachmentPoints": [
Expand Down Expand Up @@ -3566,6 +3581,7 @@
"classHELM": "PEPTIDE",
"alias": "R",
"name": "Arg",
"fullName": "Arginine",
"naturalAnalogShort": "R",
"naturalAnalog": "Arg",
"attachmentPoints": [
Expand Down Expand Up @@ -3811,6 +3827,7 @@
"classHELM": "PEPTIDE",
"alias": "S",
"name": "Ser",
"fullName": "Serine",
"naturalAnalogShort": "S",
"naturalAnalog": "Ser",
"attachmentPoints": [
Expand Down Expand Up @@ -3981,6 +3998,7 @@
"classHELM": "PEPTIDE",
"alias": "U",
"name": "Sec",
"fullName": "Selenocysteine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cys",
"attachmentPoints": [
Expand Down Expand Up @@ -4128,6 +4146,7 @@
"classHELM": "PEPTIDE",
"alias": "V",
"name": "Val",
"fullName": "Valine",
"naturalAnalogShort": "V",
"naturalAnalog": "Val",
"attachmentPoints": [
Expand Down Expand Up @@ -4290,6 +4309,7 @@
"classHELM": "PEPTIDE",
"alias": "W",
"name": "Trp",
"fullName": "Tryptophan",
"naturalAnalogShort": "W",
"naturalAnalog": "Trp",
"attachmentPoints": [
Expand Down Expand Up @@ -4594,6 +4614,7 @@
"classHELM": "PEPTIDE",
"alias": "Y",
"name": "Tyr",
"fullName": "Tyrosine",
"naturalAnalogShort": "Y",
"naturalAnalog": "Tyr",
"attachmentPoints": [
Expand Down
6 changes: 6 additions & 0 deletions api/tests/integration/tests/formats/ref/conjugate.ket
Original file line number Diff line number Diff line change
Expand Up @@ -4805,6 +4805,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -4904,6 +4905,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -5115,6 +5117,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -5289,6 +5292,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -5500,6 +5504,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -5659,6 +5664,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down
7 changes: 7 additions & 0 deletions api/tests/integration/tests/formats/ref/dna_acgtu.ket
Original file line number Diff line number Diff line change
Expand Up @@ -374,6 +374,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down Expand Up @@ -570,6 +571,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -781,6 +783,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -940,6 +943,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -1039,6 +1043,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -1250,6 +1255,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -1424,6 +1430,7 @@
"classHELM": "RNA",
"alias": "U",
"name": "Ura",
"fullName": "Uracil",
"naturalAnalogShort": "U",
"naturalAnalog": "Ura",
"attachmentPoints": [
Expand Down
6 changes: 6 additions & 0 deletions api/tests/integration/tests/formats/ref/dna_mod.ket
Original file line number Diff line number Diff line change
Expand Up @@ -3555,6 +3555,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -3654,6 +3655,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -3865,6 +3867,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -4039,6 +4042,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -4250,6 +4254,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -4409,6 +4414,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down
2 changes: 1 addition & 1 deletion api/tests/integration/tests/formats/ref/dna_mod.seq
Original file line number Diff line number Diff line change
@@ -1 +1 @@
TGGCGAACTCACCAGTC*CCGC
TGGCGAACTCACCAGTCTCCGC
Loading

0 comments on commit fb2f17e

Please sign in to comment.