Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Backmerge: #1801 No monomer full name when import from a sequence #1813

Merged
merged 5 commits into from
Mar 15, 2024
Merged
Show file tree
Hide file tree
Changes from all commits
Commits
File filter

Filter by extension

Filter by extension

Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
7 changes: 7 additions & 0 deletions api/tests/integration/tests/formats/ref/acgt_1412.ket
Original file line number Diff line number Diff line change
Expand Up @@ -399,6 +399,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -498,6 +499,7 @@
"classHELM": "RNA",
"alias": "R",
"name": "Rib",
"fullName": "Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -726,6 +728,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down Expand Up @@ -922,6 +925,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -1081,6 +1085,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -1292,6 +1297,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -1466,6 +1472,7 @@
"classHELM": "RNA",
"alias": "U",
"name": "Ura",
"fullName": "Uracil",
"naturalAnalogShort": "U",
"naturalAnalog": "Ura",
"attachmentPoints": [
Expand Down
21 changes: 21 additions & 0 deletions api/tests/integration/tests/formats/ref/all_aminoacids.ket
Original file line number Diff line number Diff line change
Expand Up @@ -616,6 +616,7 @@
"classHELM": "PEPTIDE",
"alias": "A",
"name": "Ala",
"fullName": "Alanine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ala",
"attachmentPoints": [
Expand Down Expand Up @@ -748,6 +749,7 @@
"classHELM": "PEPTIDE",
"alias": "C",
"name": "Cys",
"fullName": "Cysteine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cys",
"attachmentPoints": [
Expand Down Expand Up @@ -918,6 +920,7 @@
"classHELM": "PEPTIDE",
"alias": "D",
"name": "Asp",
"fullName": "Aspartic acid",
"naturalAnalogShort": "D",
"naturalAnalog": "Asp",
"attachmentPoints": [
Expand Down Expand Up @@ -1118,6 +1121,7 @@
"classHELM": "PEPTIDE",
"alias": "E",
"name": "Glu",
"fullName": "Glutamic acid",
"naturalAnalogShort": "E",
"naturalAnalog": "Glu",
"attachmentPoints": [
Expand Down Expand Up @@ -1333,6 +1337,7 @@
"classHELM": "PEPTIDE",
"alias": "F",
"name": "Phe",
"fullName": "Phenylalanine",
"naturalAnalogShort": "F",
"naturalAnalog": "Phe",
"attachmentPoints": [
Expand Down Expand Up @@ -1562,6 +1567,7 @@
"classHELM": "PEPTIDE",
"alias": "G",
"name": "Gly",
"fullName": "Glycine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gly",
"attachmentPoints": [
Expand Down Expand Up @@ -1677,6 +1683,7 @@
"classHELM": "PEPTIDE",
"alias": "H",
"name": "His",
"fullName": "Histidine",
"naturalAnalogShort": "H",
"naturalAnalog": "His",
"attachmentPoints": [
Expand Down Expand Up @@ -1914,6 +1921,7 @@
"classHELM": "PEPTIDE",
"alias": "I",
"name": "Ile",
"fullName": "Isoleucine",
"naturalAnalogShort": "I",
"naturalAnalog": "Ile",
"attachmentPoints": [
Expand Down Expand Up @@ -2093,6 +2101,7 @@
"classHELM": "PEPTIDE",
"alias": "K",
"name": "Lys",
"fullName": "Lysine",
"naturalAnalogShort": "K",
"naturalAnalog": "Lys",
"attachmentPoints": [
Expand Down Expand Up @@ -2308,6 +2317,7 @@
"classHELM": "PEPTIDE",
"alias": "L",
"name": "Leu",
"fullName": "Leucine",
"naturalAnalogShort": "L",
"naturalAnalog": "Leu",
"attachmentPoints": [
Expand Down Expand Up @@ -2485,6 +2495,7 @@
"classHELM": "PEPTIDE",
"alias": "M",
"name": "Met",
"fullName": "Methionine",
"naturalAnalogShort": "M",
"naturalAnalog": "Met",
"attachmentPoints": [
Expand Down Expand Up @@ -2662,6 +2673,7 @@
"classHELM": "PEPTIDE",
"alias": "N",
"name": "Asn",
"fullName": "Asparagine",
"naturalAnalogShort": "N",
"naturalAnalog": "Asn",
"attachmentPoints": [
Expand Down Expand Up @@ -2862,6 +2874,7 @@
"classHELM": "PEPTIDE",
"alias": "O",
"name": "Pyl",
"fullName": "Pyrrolysine",
"naturalAnalogShort": "O",
"attachmentPoints": [
{
Expand Down Expand Up @@ -3182,6 +3195,7 @@
"classHELM": "PEPTIDE",
"alias": "P",
"name": "Pro",
"fullName": "Proline",
"naturalAnalogShort": "P",
"naturalAnalog": "Pro",
"attachmentPoints": [
Expand Down Expand Up @@ -3351,6 +3365,7 @@
"classHELM": "PEPTIDE",
"alias": "Q",
"name": "Gln",
"fullName": "Glutamine",
"naturalAnalogShort": "Q",
"naturalAnalog": "Gln",
"attachmentPoints": [
Expand Down Expand Up @@ -3566,6 +3581,7 @@
"classHELM": "PEPTIDE",
"alias": "R",
"name": "Arg",
"fullName": "Arginine",
"naturalAnalogShort": "R",
"naturalAnalog": "Arg",
"attachmentPoints": [
Expand Down Expand Up @@ -3811,6 +3827,7 @@
"classHELM": "PEPTIDE",
"alias": "S",
"name": "Ser",
"fullName": "Serine",
"naturalAnalogShort": "S",
"naturalAnalog": "Ser",
"attachmentPoints": [
Expand Down Expand Up @@ -3981,6 +3998,7 @@
"classHELM": "PEPTIDE",
"alias": "U",
"name": "Sec",
"fullName": "Selenocysteine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cys",
"attachmentPoints": [
Expand Down Expand Up @@ -4128,6 +4146,7 @@
"classHELM": "PEPTIDE",
"alias": "V",
"name": "Val",
"fullName": "Valine",
"naturalAnalogShort": "V",
"naturalAnalog": "Val",
"attachmentPoints": [
Expand Down Expand Up @@ -4290,6 +4309,7 @@
"classHELM": "PEPTIDE",
"alias": "W",
"name": "Trp",
"fullName": "Tryptophan",
"naturalAnalogShort": "W",
"naturalAnalog": "Trp",
"attachmentPoints": [
Expand Down Expand Up @@ -4594,6 +4614,7 @@
"classHELM": "PEPTIDE",
"alias": "Y",
"name": "Tyr",
"fullName": "Tyrosine",
"naturalAnalogShort": "Y",
"naturalAnalog": "Tyr",
"attachmentPoints": [
Expand Down
6 changes: 6 additions & 0 deletions api/tests/integration/tests/formats/ref/conjugate.ket
Original file line number Diff line number Diff line change
Expand Up @@ -4805,6 +4805,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -4904,6 +4905,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -5115,6 +5117,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -5289,6 +5292,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -5500,6 +5504,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -5659,6 +5664,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down
7 changes: 7 additions & 0 deletions api/tests/integration/tests/formats/ref/dna_acgtu.ket
Original file line number Diff line number Diff line change
Expand Up @@ -374,6 +374,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down Expand Up @@ -570,6 +571,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -781,6 +783,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -940,6 +943,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -1039,6 +1043,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -1250,6 +1255,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -1424,6 +1430,7 @@
"classHELM": "RNA",
"alias": "U",
"name": "Ura",
"fullName": "Uracil",
"naturalAnalogShort": "U",
"naturalAnalog": "Ura",
"attachmentPoints": [
Expand Down
6 changes: 6 additions & 0 deletions api/tests/integration/tests/formats/ref/dna_mod.ket
Original file line number Diff line number Diff line change
Expand Up @@ -3555,6 +3555,7 @@
"classHELM": "RNA",
"alias": "P",
"name": "P",
"fullName": "Phosphate",
"naturalAnalogShort": "P",
"attachmentPoints": [
{
Expand Down Expand Up @@ -3654,6 +3655,7 @@
"classHELM": "RNA",
"alias": "dR",
"name": "dRib",
"fullName": "Deoxy-Ribose",
"naturalAnalogShort": "R",
"naturalAnalog": "Rib",
"attachmentPoints": [
Expand Down Expand Up @@ -3865,6 +3867,7 @@
"classHELM": "RNA",
"alias": "T",
"name": "Thy",
"fullName": "Thymine",
"naturalAnalogShort": "T",
"naturalAnalog": "Thy",
"attachmentPoints": [
Expand Down Expand Up @@ -4039,6 +4042,7 @@
"classHELM": "RNA",
"alias": "G",
"name": "Gua",
"fullName": "Guanine",
"naturalAnalogShort": "G",
"naturalAnalog": "Gua",
"attachmentPoints": [
Expand Down Expand Up @@ -4250,6 +4254,7 @@
"classHELM": "RNA",
"alias": "C",
"name": "Cyt",
"fullName": "Cytosine",
"naturalAnalogShort": "C",
"naturalAnalog": "Cyt",
"attachmentPoints": [
Expand Down Expand Up @@ -4409,6 +4414,7 @@
"classHELM": "RNA",
"alias": "A",
"name": "Ade",
"fullName": "Adenine",
"naturalAnalogShort": "A",
"naturalAnalog": "Ade",
"attachmentPoints": [
Expand Down
2 changes: 1 addition & 1 deletion api/tests/integration/tests/formats/ref/dna_mod.seq
Original file line number Diff line number Diff line change
@@ -1 +1 @@
TGGCGAACTCACCAGTC*CCGC
TGGCGAACTCACCAGTCTCCGC
Loading
Loading