Add nucleotide-count exercise

config.json

@@ -100,6 +100,14 @@
         "prerequisites": [],
         "difficulty": 2
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "6fc1e4ab-157d-4237-b5dd-9686d3b03feb",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 3
+      },
       {
         "slug": "sum-of-multiples",
         "name": "Sum of Multiples",

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,22 @@
+{
+  "authors": [
+    "erikschierboom"
+  ],
+  "contributors": [
+    "BNAndras"
+  ],
+  "files": {
+    "solution": [
+      "src/nucleotide-count.art"
+    ],
+    "test": [
+      "tests/test-nucleotide-count.art"
+    ],
+    "example": [
+      ".meta/src/example.art"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/src/example.art

@@ -0,0 +1,10 @@
+nucleotideCounts: function [strand][
+    counts: #[A: 0 C: 0 G: 0 T: 0]
+    loop strand 'nucleotide [
+        switch not? contains? keys counts to :string nucleotide
+            -> return null
+            -> counts\[nucleotide]: inc counts\[nucleotide]
+    ]
+
+    counts
+]

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/src/nucleotide-count.art

@@ -0,0 +1,3 @@
+nucleotideCounts: function [strand][
+    panic "Please implement the nucleotideCounts function"
+]

exercises/practice/nucleotide-count/tester.art

@@ -0,0 +1,3 @@
+import {unitt}!
+
+runTests.failFast findTests "tests"

exercises/practice/nucleotide-count/tests/test-nucleotide-count.art

@@ -0,0 +1,33 @@
+import {unitt}!
+import {src/nucleotide-count}!
+
+suite "Nucleotide Count" [
+    test "an empty strand does not increment the counts" [
+        result: nucleotideCounts ""
+        expected: #[A: 0 C: 0 G: 0 T: 0]
+        assert -> expected = result
+    ]
+
+    test.skip "a strand with one nucleotide increments that nucleotide's count" [
+        result: nucleotideCounts "G"
+        expected: #[A: 0 C: 0 G: 1 T: 0]
+        assert -> expected = result
+    ]
+
+    test.skip "a strand with a repeated nucleotide increments that nucleotide's count" [
+        result: nucleotideCounts "GGGGGGG"
+        expected: #[A: 0 C: 0 G: 7 T: 0]
+        assert -> expected = result
+    ]
+
+    test.skip "a strand with multiple nucleotides increments the respective nucleotide counts" [
+        result: nucleotideCounts "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+        expected: #[A: 20 C: 12 G: 17 T: 21]
+        assert -> expected = result
+    ]
+
+    test.skip "a strand with invalid nucleotides returns null instead" [
+        result: nucleotideCounts "AGXXACT"
+        assert -> null = result
+    ]
+]