feat: exercise initalize

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Description
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/Example.bat

@@ -0,0 +1,46 @@
+@echo off
+SETLOCAL EnableDelayedExpansion
+
+call :macro
+
+REM TODO: Need to cleanup the code
+
+set "string=%~1"
+
+REM set "string=G"
+REM set "string=GGGGGGG"
+REM set "string=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+
+echo -%string%-
+
+%getlen% %string%
+set /a "len[0]=length"
+
+for %%i in (A C G T) do (
+	set "string=!string:%%i=!"
+	%getlen% !string!
+	set /a "c+=1", "d=c - 1"
+	set /a "len[!c!]=length"
+	set /a "%%i_difference=len[!d!] - len[!c!]"
+)
+
+if !T_difference! equ 0 (
+	set /a "T_difference=len[4]"
+	set "len[4]=0"
+)
+
+echo !A_difference!,!C_difference!,!G_difference!,!T_difference!
+
+goto end
+
+:macro
+(set \n=^^^
+%= This creates an escaped Line Feed - DO NOT ALTER =%
+)
+
+set getlen=for %%# in (1 2) do if %%#==2 ( for %%1 in (^^!args^^!) do (%\n%
+	set "str=X%%~1" ^& set "length=0" ^& for /l %%b in (10,-1,0) do set /a "length|=1<<%%b" ^& for %%c in (^^!length^^!) do if "^!str:~%%c,1^!" equ "" set /a "length&=~1<<%%b"%\n%
+)) else set args=
+goto :eof
+
+:end

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,17 @@
+{
+  "authors": ["IcarusLivesHF", "GroophyLifefor"],
+  "files": {
+    "solution": [
+      "NucleotideCount.bat"
+    ],
+    "test": [
+      "NucleotideCountTest.bat"
+    ],
+    "example": [
+      ".meta/Example.bat"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,13 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[af9ffe10-dc13-42d8-a742-e7bdafac449d]
+description = "Say Hi!"

exercises/practice/nucleotide-count/NucleotideCount.bat

@@ -0,0 +1,45 @@
+@echo off
+SETLOCAL EnableDelayedExpansion
+
+call :macro
+
+REM TODO: Need to cleanup the code
+
+set "string=%~1"
+
+REM set "string=G"
+REM set "string=GGGGGGG"
+REM set "string=AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+
+%getlen% %string%
+set /a "len[0]=length"
+
+for %%i in (A C G T) do (
+	set "string=!string:%%i=!"
+	%getlen% !string!
+	set /a "c+=1", "d=c - 1"
+	set /a "len[!c!]=length"
+	set /a "%%i_difference=len[!d!] - len[!c!]"
+)
+
+if !T_difference! equ 0 (
+	set /a "T_difference=len[4]"
+	set "len[4]=0"
+)
+
+echo !A_difference!,!C_difference!,!G_difference!,!T_difference!
+echo Invalid nucleotide in strand	=	!len[4]!	=	!string!
+
+goto end
+
+:macro
+(set \n=^^^
+%= This creates an escaped Line Feed - DO NOT ALTER =%
+)
+
+set getlen=for %%# in (1 2) do if %%#==2 ( for %%1 in (^^!args^^!) do (%\n%
+	set "str=X%%~1" ^& set "length=0" ^& for /l %%b in (10,-1,0) do set /a "length|=1<<%%b" ^& for %%c in (^^!length^^!) do if "^!str:~%%c,1^!" equ "" set /a "length&=~1<<%%b"%\n%
+)) else set args=
+goto :eof
+
+:end

exercises/practice/nucleotide-count/NucleotideCountTest.bat

@@ -0,0 +1,109 @@
+@echo off
+REM ---------------------------------------------------
+REM NucleotideCount Unit Testing
+REM ---------------------------------------------------
+
+:Main
+    REM Initalize result variable
+    set "slug=NucleotideCount"
+
+    CALL :Initialize
+
+    REM --------------------
+    REM Test Case Start \/\/
+    REM Resource: https://github.com/exercism/problem-specifications/blob/ce02684e726a1b78a1c1e591188e4e268fd27b15/exercises/nucleotide-count/canonical-data.json
+    REM --------------------
+    set "expected=0,0,0,0"
+    set "if_success=Test passed"
+    set "if_failed=Test failed: empty strand. (expected: %expected%, actually: %stdout%^)"
+    CALL :Assert ""
+
+    set "expected=0,0,1,0"
+    set "if_success=Test passed"
+    set "if_failed=Test failed: can count one nucleotide in single-character input. (expected: %expected%, actually: %stdout%^)"
+    CALL :Assert "G"
+
+    set "expected=0,0,7,0"
+    set "if_success=Test passed"
+    set "if_failed=Test failed: strand with repeated nucleotide. (expected: %expected%, actually: %stdout%^)"
+    CALL :Assert "GGGGGGG"
+
+    set "expected=20,12,17,21"
+    set "if_success=Test passed"
+    set "if_failed=Test failed: strand with multiple nucleotides. (expected: %expected%, actually: %stdout%^)"
+    CALL :Assert "AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC"
+
+    set "expected=Invalid nucleotide in strand"
+    set "if_success=Test passed"
+    set "if_failed=Test failed: strand with invalid nucleotides - Print just 'Invalid nucleotide in strand'. (expected: %expected%, actually: %stdout%^)"
+    CALL :Assert "AGXXACT"
+
+    REM --------------------
+    REM Test Case End /\/\/\
+    REM --------------------
+
+    CALL :ResolveStatus
+    exit /b %errorlevel%
+REM End of Main
+
+REM ---------------------------------------------------
+REM Assert [..Parameters(up to 9)]
+REM ---------------------------------------------------
+GOTO :End REM Prevents the code below from being executed
+:Assert
+set "stdout="
+
+REM Run the program and capture the output then delete the file
+CALL %slug%.bat %~1 %~2 %~3 %~4 %~5 %~6 %~7 %~8 %~9 > stdout.bin 2>&1
+set /p stdout=<stdout.bin
+del stdout.bin
+
+REM Check if the result is correct
+if "%stdout%" == "%expected%" (
+    if defined if_success (
+        echo %if_success%
+
+        REM Reset the variable to avoid duplicating the message.
+        set "if_success="
+        set "if_failed="
+    )
+
+    REM If the result is correct, exit with code 0
+    set /a successCount+=1
+    exit /b 0
+) else (
+    if defined if_failed (
+        echo %if_failed%
+
+        REM Reset the variable to avoid duplicating the message.
+        set "if_success="
+        set "if_failed="
+    )
+
+    REM If the result is incorrect, exit with code 1
+    set /a failCount+=1
+    exit /b 1
+)
+GOTO :EOF REM Go back to the line after the call to :Assert
+
+:Initialize
+REM It's for initialize, not about checking empty file
+set "successCount=0"
+set "failCount=0"
+GOTO :EOF REM Go back to the line after the call to :CheckEmptyFile
+
+:ResolveStatus
+set "status="
+if %failCount% gtr 0 (
+    REM status: Fail
+    REM message: The test failed.
+    exit /b 1
+
+) else (
+    REM status: Pass
+    exit /b 0
+
+)
+GOTO :EOF REM Go back to the line after the call to :ExportResultAsJson
+
+:End