Add nucleotide-count

config.json

@@ -304,6 +304,14 @@
         "difficulty": 1,
         "topics": null
       },
+      {
+        "slug": "nucleotide-count",
+        "name": "Nucleotide Count",
+        "uuid": "cd5fd765-2d79-4cb8-b1f0-a5891a149672",
+        "practices": [],
+        "prerequisites": [],
+        "difficulty": 2
+      },
       {
         "slug": "queen-attack",
         "name": "Queen Attack",

exercises/practice/nucleotide-count/.docs/instructions.md

@@ -0,0 +1,23 @@
+# Instructions
+
+Each of us inherits from our biological parents a set of chemical instructions known as DNA that influence how our bodies are constructed.
+All known life depends on DNA!
+
+> Note: You do not need to understand anything about nucleotides or DNA to complete this exercise.
+
+DNA is a long chain of other chemicals and the most important are the four nucleotides, adenine, cytosine, guanine and thymine.
+A single DNA chain can contain billions of these four nucleotides and the order in which they occur is important!
+We call the order of these nucleotides in a bit of DNA a "DNA sequence".
+
+We represent a DNA sequence as an ordered collection of these four nucleotides and a common way to do that is with a string of characters such as "ATTACG" for a DNA sequence of 6 nucleotides.
+'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' for thymine.
+
+Given a string representing a DNA sequence, count how many of each nucleotide is present.
+If the string contains characters that aren't A, C, G, or T then it is invalid and you should signal an error.
+
+For example:
+
+```text
+"GATTACA" -> 'A': 3, 'C': 1, 'G': 1, 'T': 2
+"INVALID" -> error
+```

exercises/practice/nucleotide-count/.meta/Example.cfc

@@ -0,0 +1,6 @@
+/**
+* Here is an example solution for the NucleotideCount exercise
+*/
+component {
+
+}

exercises/practice/nucleotide-count/.meta/ExampleTest.cfc

@@ -0,0 +1,7 @@
+component extends="NucleotideCountTest" {
+
+	function beforeAll(){
+	  SUT = createObject( 'Solution' );
+	}
+
+}

exercises/practice/nucleotide-count/.meta/config.json

@@ -0,0 +1,20 @@
+{
+  "authors": [
+    "BNAndras"
+  ],
+  "files": {
+    "solution": [
+      "NucleotideCount.cfc"
+    ],
+    "test": [
+      "NucleotideCountTest.cfc"
+    ],
+    "example": [
+      ".meta/Example.cfc", 
+      ".meta/ExampleTest.cfc"
+    ]
+  },
+  "blurb": "Given a DNA string, compute how many times each nucleotide occurs in the string.",
+  "source": "The Calculating DNA Nucleotides_problem at Rosalind",
+  "source_url": "https://rosalind.info/problems/dna/"
+}

exercises/practice/nucleotide-count/.meta/tests.toml

@@ -0,0 +1,25 @@
+# This is an auto-generated file.
+#
+# Regenerating this file via `configlet sync` will:
+# - Recreate every `description` key/value pair
+# - Recreate every `reimplements` key/value pair, where they exist in problem-specifications
+# - Remove any `include = true` key/value pair (an omitted `include` key implies inclusion)
+# - Preserve any other key/value pair
+#
+# As user-added comments (using the # character) will be removed when this file
+# is regenerated, comments can be added via a `comment` key.
+
+[3e5c30a8-87e2-4845-a815-a49671ade970]
+description = "empty strand"
+
+[a0ea42a6-06d9-4ac6-828c-7ccaccf98fec]
+description = "can count one nucleotide in single-character input"
+
+[eca0d565-ed8c-43e7-9033-6cefbf5115b5]
+description = "strand with repeated nucleotide"
+
+[40a45eac-c83f-4740-901a-20b22d15a39f]
+description = "strand with multiple nucleotides"
+
+[b4c47851-ee9e-4b0a-be70-a86e343bd851]
+description = "strand with invalid nucleotides"

exercises/practice/nucleotide-count/NucleotideCount.cfc

@@ -0,0 +1,32 @@
+/**
+* Your implementation of the NucleotideCount exercise
+*/
+component {
+
+	/**
+	* @returns 
+	*/
+	function nucleotideCounts( strand ) {
+		a = 0
+		c = 0
+		g = 0
+		t = 0
+		cfloop(index="i" from="1" to="#len(strand)#") {
+			char = strand[i]
+			if (char == "a") {
+				a += 1
+			} else if (char == "c") {
+				c += 1
+			} else if (char == "g") {
+				g += 1
+			} else if (char == "t") {
+				t += 1
+			} else {
+				Throw(message='Invalid nucleotide in strand')
+			}
+		}
+
+		return  {"A":a,"C":c,"G":g,"T":t}
+	}
+
+}

exercises/practice/nucleotide-count/NucleotideCountTest.cfc

@@ -0,0 +1,35 @@
+component extends="testbox.system.BaseSpec" {
+
+	function beforeAll(){
+	  SUT = createObject( 'NucleotideCount' );
+	}
+
+	function run(){
+
+		describe( "My NucleotideCount class", function(){			
+
+			it( 'empty strand', function(){
+				expect( SUT.nucleotideCounts( strand='' ) ).toBe( {"A":0,"C":0,"G":0,"T":0} );
+			});
+
+			it( 'can count one nucleotide in single-character input', function(){
+				expect( SUT.nucleotideCounts( strand='G' ) ).toBe( {"A":0,"C":0,"G":1,"T":0} );
+			});
+
+			it( 'strand with repeated nucleotide', function(){
+				expect( SUT.nucleotideCounts( strand='GGGGGGG' ) ).toBe( {"A":0,"C":0,"G":7,"T":0} );
+			});
+
+			it( 'strand with multiple nucleotides', function(){
+				expect( SUT.nucleotideCounts( strand='AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC' ) ).toBe( {"A":20,"C":12,"G":17,"T":21} );
+			});
+
+			it( 'strand with invalid nucleotides', function(){
+				expect( function(){ SUT.nucleotideCounts( strand='AGXXACT' ); } ).toThrow( message='Invalid nucleotide in strand' );
+			});
+
+		});
+
+	}
+
+}

exercises/practice/nucleotide-count/TestRunner.cfc

@@ -0,0 +1,103 @@
+/**
+* I am a CommandBox task runner which you can use to test your implementation of this exercise against the 
+* provided test suite.  To use me, open the CommandBox CLI and run this:
+* 
+* CommandBox> task run TestRunner
+*
+* To start up a test watcher that will automatically rerun the test suite every time you save a file change, run this:
+*
+* CommandBox> task run TestRunner --watcher
+*
+*/
+component {
+
+	/**
+	* @solution Runs the tests against the solution
+	* @watcher Start up a file watch that re-runs the tests on file changes. Use Ctrl-C to stop
+	*/
+	function run( boolean solution=false, boolean watcher=false ) {
+
+		ensureTestBox();
+
+		if( watcher ) {
+
+			// Tabula rasa
+			command( 'cls' ).run();
+
+			// Start watcher
+			watch()
+				.paths( '*.cfc' )
+				.inDirectory( getCWD() )
+				.withDelay( 500 )
+				.onChange( function() {
+
+					// Clear the screen
+					command( 'cls' )
+						.run();
+
+					// This is neccessary so changes to tests get picked up right away.
+					pagePoolClear();	
+
+					runTests( solution );
+
+				} )
+				.start();
+
+		} else {
+			runTests( solution );
+		}			
+
+	}
+
+	/**
+	* Make sure the TestBox framework is installed
+	*/
+	private function ensureTestBox() {
+		var excerciseRoot = getCWD();
+		var testBoxRoot = excerciseRoot & '/testbox';
+
+		if( !directoryExists( testBoxRoot ) ) {
+
+			print.boldYellowLine( 'Installing some missing dependencies for you!' ).toConsole();
+			command( 'install' )
+				.inWorkingDirectory( excerciseRoot )
+				.run();
+		}
+
+		// Bootstrap TestBox framework
+		filesystemUtil.createMapping( '/testbox', testBoxRoot );
+	}
+
+	/**
+	* Invoke TestBox to run the test suite
+	*/
+	private function runTests( boolean solution=false ) {
+
+		// Create TestBox and run the tests
+		testData = new testbox.system.TestBox()
+			.runRaw( directory = {
+				// Find all CFCs...
+				mapping = filesystemUtil.makePathRelative( getCWD() ),
+				// ... in this directory ...
+				recurse = false,
+				// ... whose name ends in "test"
+				filter = function( path ) {
+					return path.reFind( ( solution ? 'Solution' : '' ) & 'Test.cfc$' );
+				 }
+			} )
+			.getMemento();
+
+		// Print out the results with ANSI formatting for the CLI
+		getInstance( 'CLIRenderer@testbox-commands' )
+			.render( print, testData, true );
+
+		print.toConsole();
+
+		// Set proper exit code
+		if( testData.totalFail || testData.totalError ) {
+			setExitCode( 1 );
+		}
+	}
+
+}
+

exercises/practice/nucleotide-count/box.json

@@ -0,0 +1,8 @@
+{
+    "dependencies":{
+        "testbox":"^2.5.0+107"
+    },
+    "installPaths":{
+        "testbox":"testbox/"
+    }
+}

exercises/practice/nucleotide-count/index.cfm

@@ -0,0 +1,37 @@
+<!--- 
+
+This file will only be used if you want to start up a web server in this directory.  You can do so by running:
+
+$> box
+CommandBox> install
+CommandBox> server start
+
+However, this is not necessary unless you really just want to use the HTML reporters on TestBox.  
+Ideally, you'll skip the need for this file entirely and just run the tests directly frm the CLI like this:
+
+CommandBox> task run TestRunner
+
+ --->
+<cfsetting showDebugOutput="false">
+<cfparam name="url.reporter" 		default="simple">
+<cfscript>
+	// get a list of all CFCs in this folder whose name looks like "XXXTest.cfc"
+	// And turn it into compnent path relative to the web root
+	url.bundles = directoryList(
+			path=expandPath( '/' ),
+			filter='*Test.cfc' )
+		.map( function( path ) {
+			return path
+					.replaceNoCase( expandPath( '/' ), '' )
+					.left( -4 )
+		} )
+		.toList();
+</cfscript>
+
+<!--- Ensure TestBox --->
+<cfif fileExists( "/testbox/system/runners/HTMLRunner.cfm" )>
+	<!--- Include the TestBox HTML Runner --->
+	<cfinclude template="/testbox/system/runners/HTMLRunner.cfm">
+<cfelse>
+	Oops, you don't have TestBox installed yet! Please run <b>box install</b> from the root of your excercise folder and refresh this page.	
+</cfif>