RiboAbacus is a computational tool that, given the sequence and the abundance of a transcript, provides estimation of the number of ribosomes per mRNA and transcript-specific translation efficiencies.
Please cite the following article when using RiboAbacus:
Lauria F, Tebaldi T, Lunelli L, Struffi P, Gatto P, Pugliese A, Brigotti M, Montanaro L, Ciribilli Y, Inga A, Quattrone A, Sanguinetti G, Viero G. RiboAbacus: a model trained on polyribosome images predicts ribosome density and translational efficiency from mammalian transcriptomes. Nucleic Acids Res. 2015 Dec 15;43(22):e153
Place RiboAbacus.c in the same folder of the .txt file(s) that will be used as input (see below for more details on the input files).
Using a Linux command-line interface: open a bash shell and type the following line to compile RiboAbacus.c and generate the executable file (that will be placed in the same folder of 'RiboAbacus.c')
gcc -o RiboAbacus RiboAbacus.c -lm
then type
./RiboAbacus
to run RiboAbacus.
To set RiboAbacus options, a "user definition part" is present in 'RiboAbacus.c'. The user can modify the following parameters:
- CODON_USAGE specifies the organism codon usage bias: 1 for Homo Sapiens, 2 for Mus Musculus, 3 for Saccharomyces Cerevisiae and 0 if an input file with custom codon usage is given by the user (see the input files section below)
- PROTEIN_INPUT assumes only values 0 and 1: 0 if the input file with the list of transcripts (see the input files section below) does not contain data related to protein amounts, 1 otherwise
- RAMP_HYPOTHESIS assumes only values 0 and 1: 0 if the ramp hypothesis is not considered, 1 otherwise
- RAMP_LENGTH specifies the ramp length (measured in codons). If RAMP_LENGTH is set equal to 0, RAMP_LENGTH will not affect the simulation
- SLOWDOWN_RATE specifies the ribosomes slowdown rate on the ramp (it is a percentage: for example, 70 means that the speed of the ribosomes is reduced by 70%). If RAMP_LENGTH is set equal to 0, SLOWDOWN_RATE will not affect the simulation
- WIDTH_BIN specifies the width of the bin for the mRNA length distribution
The first input file must contain for each transcript TWO lines: the first reporting (in this order) the gene ID, the transcript level, the protein amount, the protein ID and the transcript ID; the second reporting the mRNA sequence. An example:
ENSG00000000971 2101.85 150.60 ENSP00000356399 ENST00000367429
ATGAGACTTCTAGCAAAGATTATTTGCCTTATGTTATGGGCTATTTGTGTAGCAGAAGATTGCAATGAACTTCCTCCAAGAAGAAATACAGAAATTCTGACAGGTTCCTGGTCTGACCAAACATATCCAGAAGGCACCCAGGCTATCTATAAATGCCGCCCTGGATATAGATCTCTTGGAAATGTAATAATGGTATGCAGGAAGGGAGAATGGGTTGCTCTTAATCCATTAAGGAAATGTCAGAAAAGGCCCTGTGGACATCCTGGAGATACTCCTTTTGGTACTTTTACCCTTACAGGAGGAAATGTGTTTGAATATGGTGTAAAAGCTGTGTATACATGTAATGAGGGGTATCAATTGCTAGGTGAGATTAATTACCGTGAATGTGACACAGATGGATGGA.......
ENSG00000002745 54.52 110.58 ENSP00000355065 ENST00000361301
ATGCAGCTCACCACTTGCCTCAGGGAGACCCTCTTCACAGGGGCTTCTCAAAAGACCTCCCTATGGTGGTTGGGCATTGCCTCCTTCGGGGTTCCAGAGAAGCTGGGCTGCGCCAATTTGCCGCTGAACAGCCGCCAGAAGGAGCTGTGCAAGAGGAAACCGTACCTGCTGCCGAGCATCCGAGAGGGCGCCCGGCTGGGCATTCAGGAGTGCGGGAGCCAGTTCAGACACGAGAGATGGAACTGCATGATCACCGCCGCCGCCACTACC.......
ENSG00000002746 93.00 155.60 ENSP00000379228 ENST00000395891
ATGCTGCTGCACCTGTGTAGTGTGAAGAATCTGTACCAGAACAGGTTTTTAGGCCTGGCCGCCATGGCGTCTCCTTCTAGAAACTCCCAGAGCCGACGCCGGTGCAAGGAGCCGCTCCGATACAGCTACAACCCCGACCAGTTCCACAACATGGACCTCAGGGGCGGCCCCCACGATGGCGTCACCATTCCCCGCTCCACCAGCGACACTGACCTGGTCACCTCGGACAGCCGCTCCACGCTCATGGTCAGCAGCTCCTACTATTCCATCGGGCACTCTCAGGACCTGGTCATCCACTGGGACATAAAGGAGGAAGTGGACGCTGGGGACTGGATTGGCATGTACCTCATTGATGAGGTCTTGTCCGAAAACTTTCTGGACTATAAAAACCGTGGAGTCAATGGT.......
Note that if the protein amounts are not available, the corresponding column can be omitted. In this case, in the variable PROTEIN_INPUT (see the Settings section above) has to be set equal to 0.
The presence of a second input file depends on the parameter CODON_USAGE in the "user definition part" (see the Settings section above): if it is set equal to 0, an input file containing the 64 triplets and the corresponding codon usage values (without any header) must be present in the same folder of RiboAbacus.c. The following lines show an example of the organization of the file:
CUG 39.6
CCG 6.9
CAG 34.2
CGG 11.4
AUU 16
...
No specific order of the triplets is required.
RiboAbacus creates 3 output:
-
A file in which each row corresponds to an mRNA. In each line both general transcript information and predicted data provided by RiboAbacus are reported. More in detail each line contains:
- gene ID;
- mRNA level- protein amount (optional);
- protein ID;
- transcript ID;
- transcript length;
- estimated number of ribosome per transcript;
- estimated number of ribosomes bound to the ramp region (if the ramp hypothesis was considered. Otherwise this value would be always 0);
- % of GC content of the transcript;
- % of GC content of the ramp region (if the ramp hypothesis was considered. Otherwise this value would be always 0);
- Codon Adaptation Index of the transcript;
- Codon Adaptation Index of the ramp region (if the ramp hypothesis was considered. Otherwise this value would be always 0);
- ribosome occupancy (%) based on the estimated number of ribosome per transcript;
- corrected translation efficiency based on the estimated number of ribosome per transcript;
- exit flux.
The following lines show an example of the organization of the file (ramp hypothesis: ramp length 50 codons, ribosome slowdown rate 70%):
gene ID mRNA level protein amount protein ID transcript ID "transcript length" # ribosomes "# ribosome (ramp)" GC% "GC% (ramp)" CAI "CAI (ramp)" "ribosome occupancy" "translation efficiency" exit flux ENSG00000000971 2101.850098 150.6 ENSP00000356399 ENST00000367429 3696 32 3 39.826839 34 0.72072 0.719603 25.802345 547.0099281 44 ENSG00000004455 3493.550049 64600.76 ENSP00000346921 ENST00000354858 720 8 3 52.361111 62 0.79733 0.791008 31.911211 2287.06706 82 ENSG00000006712 8962.950195 182.54 ENSP00000221265 ENST00000221265 1596 15 3 54.699249 72 0.832251 0.887574 27.7791 2894.230964 221 -
A file containing the frequencies of the number of ribosomes per transcript predicted by the model, useful to produce a number of ribosomes per transcript distribution that takes into account the transcript level. The following lines show an example of the organization of the file
rib/tr events freq_int 0 0 0.000000 1 0 0.000000 2 1619 0.006346 3 1605 0.006291 4 2097 0.008217 5 12859 0.050386 ... -
A file containing information useful to generate a transcript length distribution with specified width of the bins and that takes into account the transcript level. The following lines show an example of the organization of the file:
length events freq_int 0 544 0.000710 150 1562 0.002040 300 6784 0.008862 450 8545 0.011163 600 7378 0.009639 650 8654 0.011306 ...