This repository is a usable, publicly available tutorial for analyzing differential expression data and creating topological gene networks. All steps have been provided for the UConn CBC Xanadu cluster here with appropriate headers for the Slurm scheduler that can be modified simply to run. Commands should never be executed on the submit nodes of any HPC machine. If working on the Xanadu cluster, you should use sbatch scriptname after modifying the script for each stage. Basic editing of all scripts can be performed on the server with tools such as nano, vim, or emacs. If you are new to Linux, please use this handy guide for the operating system commands. In this guide, you will be working with common bio Informatic file formats, such as FASTA, FASTQ, SAM/BAM, and GFF3/GTF. You can learn even more about each file format here. If you do not have a Xanadu account and are an affiliate of UConn/UCHC, please apply for one here.
Contents
In this tutorial, we will be analyzing thale cress (Arabidopsis thaliana) RNA-Seq data from various parts of the plant (roots, stems). Perhaps one of the most common organisms for genetic study, the aggregrate wealth of genetic Information of the thale cress makes it ideal for new-comers to learn. Organisms such as this we call "model organisms". You may think of model organisms as a subset of living things which, under the normal conventions of analysis, behave nicely. The data we will be analyzing comes from an experiment in which various cellular RNA was collected from the roots and shoots of a single thale cress. The RNA profiles are archived in the SRA, and meta Information on each may be viewed through the SRA ID: SRR8428904, SRR8428905, SRR8428906, SRR8428907, SRR8428908, SRR8428909(https://www.ncbi.nlm.nih.gov/Traces/study/?acc=SRP178230).
The Single Read Archive, or SRA, is a publicly available database containing read sequences from a variety of experiments. Scientists who would like their read sequences present on the SRA submit a report containing the read sequences, experimental details, and any other accessory meta-data.
MAGLs participate lipid mobilization and endocannabinoid signalling in mammal. However, their potential biological function in plants remains elusive. In a survey of BnMAGL molecular function, BnA9::BnMAGL8.1 transgenic plants were outstanding with their male sterile phenotype. To discover the mechanism undering the phenotype, we conducted RNAseq on flower buds in stage 6-9 from BnA9::BnMAGL8.1 transgenic plants with wild type (Col ecotype). Overall design: 3 biological replicates for BnA9::BnMAGL8.1 (mutant) transgenic buds and 3 biological replicates for WT buds
Our data, SRR8428904, SRR8428905, SRR8428906, SRR8428907, SRR8428908, SRR8428909 come from WT1, WT2, WT3, mutant1, mutant2, and mutant3 respectively. Our objective in this analysis is to determine which genes are expressed in all samples, quantify the expression of each common gene in each sample, identify genes which are lowly expressed in WT1, WT2 and WT3 but highly expressed in mutant1, mutant2, and mutant3 or vice versa, quantify the relative expression of such genes, and lastly to create a visual topological network of genes with similar expression profiles.
You may connect to Xanadu via SSH, which will place you in your home directory
-bash-4.2$ cd /home/CAM/$USER
Your home directory contains 10TB of storage and will not pollute the capacities of other users on the cluster.
The workflow may be cloned into the appropriate directory using the terminal command:
-bash-4.2$ git clone https://github.com/CBC-UCONN/RNA-Seq-Model-Organism-Arabidopsis-thaliana.git -bash-4.2$ cd rnaseq_for_model_plant -bash-4.2$ ls -bash-4.2$ cd rnaseq_for_model_plant/ -bash-4.2$ ls all_clusters.csv.png README.md complete_edge_list.csv.png Rplot.png cytoscape1.png sam_sort_bam.sh cytoscape2.png sickle_run.sh cytoscape3.png transcript_assembly.sh cytoscape4.png trimmed.html cytoscape5.png trimmed_SRR3498212_fastqc.html data_dump.sh trimmed_SRR3498213_fastqc.html hisat2_run.sh trimmed_SRR3498215_fastqc.html pcaplot_for_all_libraries.png trimmed_SRR3498216_fastqc.html quality_control.sh
All of the completed scripts for this tutorial are available for you to submit. However, before submitting, you may want to edit the scripts to include your email!
Before beginning, we need to understand a few aspects of the Xanadu server. When first logging into Xanadu from your local terminal, you will be connected to the submit node. The submit node is the interface with which users on Xanadu may submit their processes to the desired compute nodes, which will run the process. Never, under any circumstance, run processes directly in the submit node. Your process will be killed and all of your work lost! This tutorial will not teach you shell script configuration to submit your tasks on Xanadu. Therefore, before moving on, read and master the topics covered in the Xanadu tutorial.
Now that we have covered the introduction and objective of our analysis, we may begin!
We know that the SRA contain the read sequences and accessory meta Information from experiments. Rather than downloading experimental data through a browser, we may use the sratoolkit's "fastq-dump" function to directly dump raw read data into the current terminal directory. Let's have a look at this function (it is expected that you have read the Xanadu tutorial, and are familiar with loading modules):
-bash-4.2$ module load sratoolkit fastq-dump [options] [...] fastq-dump [options] Use option --help for more Information fastq-dump : 2.8.2
For our needs, we will simply be using the accession numbers to dump our experimental data into our directory. We know our accession numbers, so let's write a shell script to retrieve our raw reads. There are a variety of text editors available on Xanadu. My preferred text editor is "nano". Therefore, we will be using nano to write our shell script.
-bash-4.2$ nano data_dump.sh #!/bin/bash #SBATCH --job-name=data_dump #SBATCH --mail-user=your.email@uconn.edu #SBATCH --mail-type=ALL #SBATCH -n 1 #SBATCH -N 1 #SBATCH -c 1 #SBATCH --mem=10G #SBATCH -o %x_%j.out #SBATCH -e %x_%j.err #SBATCH --partition=general #SBATCH --qos=general mkdir /home/CAM/$USER/tmp/ export TMPDIR=/home/CAM/$USER/tmp/ module load sratoolkit fasttq-dump --split-files SRR8428909 mv SRR8428909_1.fastq wt_Rep1_R1.fastq mv SRR8428909_2.fastq wt_Rep1_R2.fastq fastq-dump --split-files SRR8428908 mv SRR8428908_1.fastq wt_Rep2_R1.fastq mv SRR8428908_2.fastq wt_Rep2_R2.fastq fastq-dump --split-files SRR8428907 mv SRR8428907_1.fastq wt_Rep3_R1.fastq mv SRR8428907_2.fastq wt_Rep3_R2.fastq fastq-dump --split-files SRR8428906 mv SRR8428906_1.fastq mutant_Rep1_R1.fastq mv SRR8428906_2.fastq mutant_Rep1_R2.fastq fastq-dump --split-files SRR8428905 mv SRR8428905_1.fastq mutant_Rep2_R1.fastq mv SRR8428905_2.fastq mutant_Rep2_R2.fastq fastq-dump --split-files SRR8428904 mv SRR8428904_1.fastq mutant_Rep3_R1.fastq mv SRR8428904_2.fastq mutant_Rep3_R2.fastq
As a precautionary measure, always include your temporary directory in the environment. While not all programs require a temporary directory to work, it takes far less time including ours in the environment than it is waiting for an error! After typing our script, we press CTRL + X to exit, 'y', and then enter to save.
Now that we have our script saved, we submit it to the compute nodes with the following command:
-bash-4.2$ sbatch data_dump.sh
Now we wait until we receive an email that our process has finished.
Let's take a look at one of our files:
-bash-4.2$ head mutant_Rep1_R1.fastq
@SRR8428906.1 1 length=150
CCTGAACAACTCATCAGCGGTAAAGAAGATGCAGCTAACAATTTCGCCCGTGGTCATTACACCATTGGGAAAGAGATTGTTGACCTGTGCTTAGACCGTATCAGAAAGCTTGCTGATAACTGTACTGGTCTCCAAGGATTCCTCGTCTTC
+SRR8428906.1 1 length=150
AAAFFJFJJ<FJFJJJJJJJJJFJJJJFJAJJJJJJFJJJJJJJJJJJJFJAJJFJJJJJJJJJJJJAAFJFJJJJFJJJJJFFJJFJJJJJJJJJJFJJ7<AFAJJFFJJJJJJJJJJJJJJJJFJFJ7AJFJJ<AJJJJFJ7FFJJJ-
@SRR8428906.2 2 length=150
GGGTCTTGTATGCCTCAGCAGGGATATCAGCGAAGTAGGTCTCGACAAGAACATTCAAACCAGAAAGAGTTGATTCAAGTTCAGCATAGGCACCAGTAAAGGCCTGGAGTTTCTGACCCTCAAGATCCATAACAAGGACAGGCTCGTCAA
+SRR8428906.2 2 length=150
<AFFFJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ7JJJJJFJJJJJJJJJJJJJJJJJJJFJJJJJJJJJJJJJJJJJ<JJ
@SRR8428906.3 3 length=150
AAAATCTGTAGAATCATCTTTCAACAATGGCTTCCACTGCTCTCTCCAGCGCAATCGTAAGCACCTCTTTCCTCCGCCGTCAACAGACACCAATCAGCCTCAGTTCCCTCCCGTTTGCCAACACACAATCTCTCTTCGGCCTCAAATCTT
We see that for our first three runs we have Information about the sampled read including its length followed by the nucleotide read and then a "+" sign. The "+" sign marks the beginning of the corresponding scores for each nucleotide read for the nucleotide sequence preceding the "+" sign.
Sickle performs quality control on illumina paired-end and single-end short read data using a sliding window. As the window slides along the fastq file, the average score of all the reads contained in the window is calculated. Should the average window score fall beneath a set threshold, sickle determines the reads responsible and removes them from the run. After visiting the SRA pages for our data, we see that our data are single end reads. Let's find out what sickle can do with these:
-bash-4.2$ module load sickle -bash-4.2$ sickle Usage: sickle [options] Command: pe paired-end sequence trimming se single-end sequence trimming --help, display this help and exit --version, output version Information and exit
We have single-end sequences.
-bash-4.2$ sickle pe Usage: sickle pe [options] -f -r -t -o -p -s Options: Options: Paired-end separated reads -------------------------- -f, --pe-file1, Input paired-end forward fastq file (Input files must have same number of records) -r, --pe-file2, Input paired-end reverse fastq file -o, --output-pe1, Output trimmed forward fastq file -p, --output-pe2, Output trimmed reverse fastq file. Must use -s option. Paired-end interleaved reads ---------------------------- -c, --pe-combo, Combined (interleaved) input paired-end fastq -m, --output-combo, Output combined (interleaved) paired-end fastq file. Must use -s option. -M, --output-combo-all, Output combined (interleaved) paired-end fastq file with any discarded read written to output file as a single N. Cannot be used with the -s option. Global options -------------- -t, --qual-type, Type of quality values (solexa (CASAVA < 1.3), illumina (CASAVA 1.3 to 1.7), sanger (which is CASAVA >= 1.8)) (required) -s, --output-single, Output trimmed singles fastq file -q, --qual-threshold, Threshold for trimming based on average quality in a window. Default 20. -l, --length-threshold, Threshold to keep a read based on length after trimming. Default 20. -x, --no-fiveprime, Don't do five prime trimming. -n, --truncate-n, Truncate sequences at position of first N. -g, --gzip-output, Output gzipped files. --quiet, do not output trimming info --help, display this help and exit --version, output version information and exit
The quality may be any score from 0 to 40. The default of 20 is much too low for a robust analysis. We want to select only reads with a quality of 35 or better. Additionally, the desired length of each read is 50bp. Again, we see that a default of 20 is much too low for analysis confidence. We want to select only reads whose lengths exceed 45bp. Lastly, we must know the scoring type. While the quality type is not listed on the SRA pages, most SRA reads use the "sanger" quality type. Unless explicitly stated, try running sickle using the sanger qualities. If an error is returned, try illumina. If another error is returned, lastly try solexa.
Let's put all of this together for our sickle script using our downloaded fastq files:
-bash-4.2$ nano sickle_run.sh #!/bin/bash #SBATCH --job-name=sickle_run #SBATCH --mail-user= #SBATCH --mail-type=ALL #SBATCH -n 1 #SBATCH -N 1 #SBATCH -c 1 #SBATCH --mem=10G #SBATCH -o sickle_run_%j.out #SBATCH -e sickle_run_%j.err #SBATCH --partition=general #SBATCH --qos=general export TMPDIR=/home/CAM/$USER/tmp/ module load sickle mkdir -p trimmed_reads sickle pe -t sanger -f /raw_data/wt_Rep1_R1.fastq -r /raw_data/wt_Rep1_R2.fastq -o /trimmed_reads/trimmed_wt_Rep1_R1.fastq -p /trimmed_reads/trimmed_wt_Rep1_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_wt_Rep1_R1.fastq sickle pe -t sanger -f /raw_data/wt_Rep2_R1.fastq -r /raw_data/wt_Rep2_R2.fastq -o /trimmed_reads/trimmed_wt_Rep2_R1.fastq -p /trimmed_reads/trimmed_wt_Rep2_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_wt_Rep2_R1.fastq sickle pe -t sanger -f /raw_data/wt_Rep3_R1.fastq -r /raw_data/wt_Rep3_R2.fastq -o /trimmed_reads/trimmed_wt_Rep3_R1.fastq -p /trimmed_reads/trimmed_wt_Rep3_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_wt_Rep3_R1.fastq sickle pe -t sanger -f /raw_data/mutant_Rep1_R1.fastq -r /raw_data/mutant_Rep1_R2.fastq -o /trimmed_reads/trimmed_mutant_Rep1_R1.fastq -p /trimmed_reads/trimmed_mutant_Rep1_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_mutant_Rep1_R1.fastq sickle pe -t sanger -f /raw_data/mutant_Rep2_R1.fastq -r /raw_data/mutant_Rep2_R2.fastq -o /trimmed_reads/trimmed_mutant_Rep2_R1.fastq -p /trimmed_reads/trimmed_mutant_Rep2_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_mutant_Rep2_R1.fastq sickle pe -t sanger -f /raw_data/mutant_Rep3_R1.fastq -r /raw_data/mutant_Rep3_R2.fastq -o /trimmed_reads/trimmed_mutant_Rep3_R1.fastq -p /trimmed_reads/trimmed_mutant_Rep3_R2.fastq -l 45 -q 25 -s /trimmed_reads/singles_mutant_Rep3_R1.fastq
-bash-4.2$ sbatch sickle_run.sh
It is helpful to see how the quality of the data has changed after using sickle. To do this, we will be using the commandline versions of fastqc and MultiQC. These two programs simply create reports of the average quality of our trimmed reads, with some graphs. There is no way to view a --help menu for these programs in the command-line. However, their use is quite simple, we simply run "fastqc <trimmed_fastq>" or "multiqc -f -n trimmed trimmed*". Do not worry too much about the options for MultiQC! Let's write our script:
-bash-4.2$ nano quality_control.sh #!/bin/bash #SBATCH --job-name=quality_control #SBATCH --mail-user= #SBATCH --mail-type=ALL #SBATCH -n 1 #SBATCH -N 1 #SBATCH -c 4 #SBATCH --mem=10G #SBATCH -o %x_%j.out #SBATCH -e %x_%j.err #SBATCH --partition=general #SBATCH --qos=general export TMPDIR=/home/CAM/$USER/tmp/ module load fastqc module load MultiQC mkdir -p ../trimmed_fastqc fastqc -t 4 -o ../trimmed_fastqc trimmed_wt_Rep1_R1.fastq trimmed_wt_Rep1_R2.fastq fastqc -t 4 -o ../trimmed_fastqc trimmed_wt_Rep2_R1.fastq trimmed_wt_Rep2_R2.fastq fastqc -t 4 -o ../trimmed_fastqc trimmed_wt_Rep3_R1.fastq trimmed_wt_Rep3_R2.fastq fastqc -t 4 -o ../trimmed_fastqc trimmed_mutant_Rep1_R1.fastq trimmed_mutant_Rep1_R2.fastq fastqc -t 4 -o ../trimmed_fastqc trimmed_mutant_Rep2_R1.fastq trimmed_mutant_Rep2_R2.fastq fastqc -t 4 -o ../trimmed_fastqc trimmed_mutant_Rep3_R1.fastq trimmed_mutant_Rep3_R2.fastq multiqc ../trimmed_fastqc [ Read 26 lines ]
-bash-4.2$ sbatch quality_control.sh
fastqc will create the files "trimmed_file_fastqc.html". To have a look at one, we need to move all of our "trimmed_file_fastqc.html" files into a single directory, and then secure copy that folder to our local directory. Then, we may open our files! If that seems like too much work for you, you may open the files directly through this github. Simply click on any "html" file and you may view it in your browser immediately. Because of this, the steps mentioned above will not be placed in this tutorial.
This script will also create a directory "trimmed_data". Let's look inside of that directory:
-bash-4.2$ cd trimmed_data< -bash-4.2$ ls multiqc_fastqc.txt multiqc.log multiqc_general_stats.txt multiqc_sources.txt
Let's have a look at the file format from fastqc and multiqc. When loading the fastqc file, you will be greeted with this screen:
There are some basic statistics which are all pretty self-explanatory. Notice that none of our sequences fail the quality report! It would be concerning if we had even one because this report is from our trimmed sequence! The same thinking applies to our sequence length. Should the minimum of the sequence length be below 45, we would know that sickle had not run properly. Let's look at the next index in the file:
This screen is simply a box-and-whiskers plot of our quality scores per base pair. Note that there is a large variance and lower mean scores (but still about in our desired range) for base pairs 1-5. These are the primer sequences! I will leave it to you to ponder the behavior of this graph. If you're stumped, you may want to learn how Illumina sequencing" works.
Our next index is the per sequence quality scores:
This index is simply the total number of base pairs (y-axis) which have a given quality score (x-axis). This plot is discontinuous and discrete, and should you calculate the Riemann sum the result is the total number of base pairs present across all reads.
The last index at which we are going to look is the "Overrepresented Sequences" index:
This is simply a list of sequences which appear disproportionately in our reads file. The reads file actually includes the primer sequences for this exact reason. When fastqc calculates a sequence which appears many times beyond the expected distribution, it may check the primer sequences in the reads file to determine if the sequence is a primer. If the sequence is not a primer, the result will be returned as "No Hit". Sequences which are returned as "No Hit" are most likely highly expressed genes.
We see that our multiqc file has the same indices as our fastqc files, but is simply the mean of all the statistics across our fastqc files:
-bash-4.2$ module load hisat2 -bash-4.2$ hisat2-build No input sequence or sequence file specified! HISAT2 version 2.1.0 by Daehwan Kim ( Infphilo@gmail.com, http://www.ccb.jhu.edu/people/ Infphilo) Usage: hisat2-build [options]* reference_in comma-separated list of files with ref sequences hisat2_index_base write ht2 data to files with this dir/basename
As you can see, we simply enter our reference genome files and the desired prefix for our .ht2 files. Now, fortunately for us, Xanadu has many indexed genomes which we may use. To see if there is a hisat2 Arabidopsis thaliana indexed genome we need to look at the Xanadu databases page. We see that our desired indexed genome is in the location /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/Athaliana_HISAT2/. Now we are ready to align our reads using hisat2 (for hisat2, the script is going to be written first with an explanation of the options after).
nano hisat2_run.sh
#!/bin/bash
#SBATCH --job-name=hisat2_run
#SBATCH --mail-user=
#SBATCH --mail-type=ALL
#SBATCH -n 1
#SBATCH -N 1
#SBATCH -c 8
#SBATCH --mem=120G
#SBATCH -o hisat2_run_%j.out
#SBATCH -e hisat2_run_%j.err
#SBATCH --partition=general
#SBATCH --qos=general
export TMPDIR=/home/CAM/$USER/tmp/
module load hisat2
mkdir -p ../mapping
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_wt_Rep1_R1.fastq -2 ../trimmed_reads/trimmed_wt_Rep1_R2.fastq -S ../mapping/wt_Rep1.sam
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_wt_Rep2_R1.fastq -2 ../trimmed_reads/trimmed_wt_Rep2_R2.fastq -S ../mapping/wt_Rep2.sam
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_wt_Rep3_R1.fastq -2 ../trimmed_reads/trimmed_wt_Rep3_R2.fastq -S ../mapping/wt_Rep3.sam
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_mutant_Rep1_R1.fastq -2 ../trimmed_reads/trimmed_mutant_Rep1_R2.fastq -S ../mapping/mutant_Rep1.sam
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_mutant_Rep2_R1.fastq -2 ../trimmed_reads/trimmed_mutant_Rep2_R2.fastq -S ../mapping/mutant_Rep2.sam
hisat2 -p 8 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/athaliana10/athaliana10 -1 ../trimmed_reads/trimmed_mutant_Rep3_R1.fastq -2 ../trimmed_reads/trimmed_mutant_Rep3_R2.fastq -S ../mapping/mutant_Rep3.sam
Command
-p : number of processors been used
--dta: report alignments tailored for transcript assemblers
-x: path to index generated from previous step
-q: query input files in fastq format
-S: output SAM file
You can run this using sbatch hisat2_run.sh
Once the mapping have been completed, the file structure is as follows:
bash-4.2$ ls wt_Rep1.sam wt_Rep2.sam wt_Rep3.sam mutant_Rep1.sam mutant_Rep2.sam mutant_Rep3.sam
When HISAT2 completes its run, it will summarize each of it’s alignments, and it is written to the standard error file, which can be found in the same folder once the run is completed.
bash-4.2$ nano hisat2_run*err 34475799 reads; of these: 34475799 (100.00%) were unpaired; of these: 33017550 (95.77%) aligned 0 times 1065637 (3.09%) aligned exactly 1 time 392612 (1.14%) aligned >1 times 4.23% overall alignment rate 42033973 reads; of these: 42033973 (100.00%) were unpaired; of these: 40774230 (97.00%) aligned 0 times 931377 (2.22%) aligned exactly 1 time 328366 (0.78%) aligned >1 times 3.00% overall alignment rate 31671127 reads; of these: 31671127 (100.00%) were unpaired; of these: 31103167 (98.21%) aligned 0 times 465131 (1.47%) aligned exactly 1 time 102829 (0.32%) aligned >1 times 1.79% overall alignment rate 49890217 reads; of these: 49890217 (100.00%) were unpaired; of these: 48622480 (97.46%) aligned 0 times 1029943 (2.06%) aligned exactly 1 time 237794 (0.48%) aligned >1 times 2.54% overall alignment rate
Let's have a look at a SAM file:
-bash-4.2$ head -n 20 rnaseq_athaliana_root_1.sam @HD VN:1.0 SO:unsorted @SQ SN:Chr1 LN:30427671 @SQ SN:Chr2 LN:19698289 @SQ SN:Chr3 LN:23459830 @SQ SN:Chr4 LN:18585056 @SQ SN:Chr5 LN:26975502 @SQ SN:ChrM LN:366924 @SQ SN:ChrC LN:154478 @PG ID:hisat2 PN:hisat2 VN:2.1.0 CL:"/isg/shared/apps/hisat2/2.1.0/hisat2-align-s --wrapper basic-0 -p 16 --dta -x /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/Athaliana_HISAT2/thaliana -q trimmed_SRR3498212.fastq -S rnaseq_athaliana_root_1.sam" SRR3498212.6 4 * 0 0 * * 0 0 TTTCCAAGCCCTTTCTAGTCTGCGCTTGAGTTTGATTGCAGAGATCGGAA DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.1 4 * 0 0 * * 0 0 CAATCGGTCAGAGCACCGCCCTGTCAAGGCGGAAGCAGATCGGAAGAG DDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.4 4 * 0 0 * * 0 0 AAAGGGCGTGGGTTCAAATCCCACAGATGTCACCAGATCGGAAGAGC DDHIIIIIIIIIEHHHIHIIIIHIIIIIIIIIIIIIIIIIIIIIIHH YT:Z:UU SRR3498212.8 4 * 0 0 * * 0 0 TTAAGATTGCTGATTTTGGCCTGGCACGTGAGGTTAAGATCGGAAGAGCA DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.19 4 * 0 0 * * 0 0 TGGATGATGGAAAAACCAGCAAGCCCCTCTTCTTTCAAGATCGGAAGAGC DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.23 4 * 0 0 * * 0 0 TTTGCCTTCCAAGCAATAGACCCGGGTAGATCGGAAGAGCACACGTCTGA DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.24 4 * 0 0 * * 0 0 TGAAACTTCTTGGTTTTAAAGTGTGAATATAGCTGACAAAAGATTGGAAG DDDDDIIIIIIIIIIIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.12 4 * 0 0 * * 0 0 AAGGGTGTTCTCTGCTACGGACCTCCAGATCGGAAGAGCACACGTCTGAA DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.27 4 * 0 0 * * 0 0 ATTGTTCCGGGCTGCCCAGTCCAAGCTGAGAGTGAAGATCGGAAGAGCAC DDDDDIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.29 4 * 0 0 * * 0 0 TATGTCTACGCTGGTTCAAATCCAGCTCGGCCCACCAAGATCGGAAGAGC DDDDDIIIIIIIIIHIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII YT:Z:UU SRR3498212.18 4 * 0 0 * * 0 0 CGTGGGTTCGACTCCCACTGTGGTCGCCAAGATCGGAAGAGCACACGTC DDDCHCCHHHEIHIGIIIEGHHIIIIGHHHIIIIIIIIIIIIIIIIIII YT:Z:UU
All of the lines starting with an "@" symbol tell us something about the chromosomes or our input. For instance "@SQ SN:Chr1 LN:30427671" tells us that we have a sequence (@SQ) whose sequence name is Chr1 (SN:Chr1), lastly the sequence has a length of 30427671bp (LN:30427671). You may be wondering what the first line means. It is quite straightfoward! The first line is simply the header (@HD) stating that the file is unsorted (SO:unsorted). The second column in the first line is somewhat of a dummy variable, but stands for "version number". Lastly we have the "@PG" line, which, in order, keeps track of the software used to write the file (ID:hisat2), the program name used to align the reads (PN:hisat2), the version of the program used (VN:2.1.0), and lastly the user input which started the process (written in the form that the program reads, not in which we wrote it).
The alignment portion of the SAM file is much more straight-forward and may be understood by reading the SAM output formatting guide linked in the beginning of this tutorial.
Because of the density of the sam file, it is compressed to binary to create a more easily tractable file for manipulation by future programs. We convert the sam file to bam with the following command and sort it such that the alignments are listed in the order the genes appear in the genome. To do this we use the software samtools:
-bash-4.2$ module load samtools bash-4.2$ samtools Usage: samtools [options] Commands: -- Indexing dict create a sequence dictionary file faidx index/extract FASTA index index alignment -- Editing calmd recalculate MD/NM tags and '=' bases fixmate fix mate Information reheader replace BAM header targetcut cut fosmid regions (for fosmid pool only) addreplacerg adds or replaces RG tags markdup mark duplicates -- File operations collate shuffle and group alignments by name cat concatenate BAMs merge merge sorted alignments mpileup multi-way pileup sort sort alignment file split splits a file by read group quickcheck quickly check if SAM/BAM/CRAM file appears intact fastq converts a BAM to a FASTQ fasta converts a BAM to a FASTA -- Statistics bedcov read depth per BED region depth compute the depth flagstat simple stats idxstats BAM index stats phase phase heterozygotes stats generate stats (former bamcheck) -- Viewing flags explain BAM flags tview text alignment viewer view SAM<->BAM<->CRAM conversion depad convert padded BAM to unpadded BAM
We are truly only interested in sorting our SAM files.
-bash-4.2$ samtools sort Usage: samtools sort [options...] [in.bam] Options: -l INT Set compression level, from 0 (uncompressed) to 9 (best) -m INT Set maximum memory per thread; suffix K/M/G recognized [768M] -n Sort by read name -t TAG Sort by value of TAG. Uses position as secondary index (or read name if -n is set) -o FILE Write final output to FILE rather than standard output -T PREFIX Write temporary files to PREFIX.nnnn.bam --input-fmt-option OPT[=VAL] Specify a single input file format option in the form of OPTION or OPTION=VALUE -O, --output-fmt FORMAT[,OPT[=VAL]]... Specify output format (SAM, BAM, CRAM) --output-fmt-option OPT[=VAL] Specify a single output file format option in the form of OPTION or OPTION=VALUE --reference FILE Reference sequence FASTA FILE [null] -@, --threads INT Number of additional threads to use [0]
The sort function converts SAM files to BAM automatically. Therefore, we can cut through most of these options and do a simple "samtools sort -o <output.bam> <inupt.sam>. Let's write our script:
bash-4.2$ #!/bin/bash #SBATCH --job-name=sam_sort_bam #SBATCH --mail-user= #SBATCH --mail-type=ALL #SBATCH -n 1 #SBATCH -N 1 #SBATCH -c 8 #SBATCH --mem=20G #SBATCH -o %x_%j.out #SBATCH -e %x_%j.err #SBATCH --partition=general #SBATCH --qos=general export TMPDIR=/home/CAM/$USER/tmp/ module load samtools samtools view -@ 8 -bhS ../mapping/wt_Rep1.sam -o ../mapping/wt_Rep1.bam samtools sort -@ 8 ../mapping/wt_Rep1.bam -o ../mapping/wt_Rep1_sort.bam samtools view -@ 8 -bhS ../mapping/wt_Rep2.sam -o ../mapping/wt_Rep2.bam samtools sort -@ 8 ../mapping/wt_Rep2.bam -o ../mapping/wt_Rep2_sort.bam samtools view -@ 8 -bhS ../mapping/wt_Rep3.sam -o ../mapping/wt_Rep3.bam samtools sort -@ 8 ../mapping/wt_Rep3.bam -o ../mapping/wt_Rep3_sort.bam samtools view -@ 8 -bhS ../mapping/mutant_Rep1.sam -o ../mapping/mutant_Rep1.bam samtools sort -@ 8 ../mapping/mutant_Rep1.bam -o ../mapping/mutant_Rep1_sort.bam samtools view -@ 8 -bhS ../mapping/mutant_Rep2.sam -o ../mapping/mutant_Rep2.bam samtools sort -@ 8 ../mapping/mutant_Rep2.bam -o ../mapping/mutant_Rep2_sort.bam samtools view -@ 8 -bhS ../mapping/mutant_Rep3.sam -o ../mapping/mutant_Rep3.bam samtools sort -@ 8 ../mapping/mutant_Rep3.bam -o ../mapping/mutant_Rep3_sort.bam
bash-4.2$ sbatch sam_sort_bam.sh
In order to quantify the expression of transcripts/genes we will require a annotation file. The annotation file is available in gff format and can be downloaded from https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_gff3/TAIR10_GFF3_genes.gff We can download the GFF file for the thale cress with the following code:
bash-4.2$ wget https://www.arabidopsis.org/download_files/Genes/TAIR10_genome_release/TAIR10_gff3/TAIR10_GFF3_genes.gff bash-4.2$ head TAIR_GFF3_genes.gff Chr1 TAIR10 chromosome 1 30427671 . . . ID=Chr1;Name=Chr1 Chr1 TAIR10 gene 3631 5899 . + . ID=AT1G01010;Note=protein_coding_gene;Name=AT1G01010 Chr1 TAIR10 mRNA 3631 5899 . + . ID=AT1G01010.1;Parent=AT1G01010;Name=AT1G01010.1;Index=1 Chr1 TAIR10 protein 3760 5630 . + . ID=AT1G01010.1-Protein;Name=AT1G01010.1;Derives_from=AT1G01010.1 Chr1 TAIR10 exon 3631 3913 . + . Parent=AT1G01010.1 Chr1 TAIR10 five_prime_UTR 3631 3759 . + . Parent=AT1G01010.1 Chr1 TAIR10 CDS 3760 3913 . + 0 Parent=AT1G01010.1,AT1G01010.1-Protein; Chr1 TAIR10 exon 3996 4276 . + . Parent=AT1G01010.1 Chr1 TAIR10 CDS 3996 4276 . + 2 Parent=AT1G01010.1,AT1G01010.1-Protein; Chr1 TAIR10 exon 4486 4605 . + . Parent=AT1G01010.1
The GFF file is quite self-explanatory. However, it'd be nice if could combine all of the pieces of Information from the GFF into something better. For instance, if there are multiple overlapping, but distinct exons from a single gene, we could use that Information to determine the isoforms of that gene. Then, we could make a file which gives each isoform its own track (there are other extrapolations to be made, but this is our most relevant example). Luckily for us, we can use the program "gffread" to transform our GFF file into the more useful form just stated, The output of gffread --help is much too dense for us to go into here, but the necessary options will be explained. Do not run this code! We are compiling this code with various other chunks into one script, be patient!
bash-4.2$ module load gffread gffread TAIR10_GFF3_genes.gff -T -o athaliana_TAIR10_genes.gtf
The option -T tells gffread to convert our input into the gtf format, and the option -o simply is how we call the output. The GTF format is simply the transcript assembly file, and is composed of exons and coding sequences. Let's have a look at the GTF file:
-bash-4.2$ head athaliana_TAIR10_genes.gtf Chr1 TAIR10 exon 3631 3913 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 exon 3996 4276 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 exon 4486 4605 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 exon 4706 5095 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 exon 5174 5326 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 exon 5439 5899 . + . transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 CDS 3760 3913 . + 0 transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 CDS 3996 4276 . + 2 transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 CDS 4486 4605 . + 0 transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; Chr1 TAIR10 CDS 4706 5095 . + 0 transcript_id "AT1G01010.1"; gene_id "AT1G01010"; gene_name "AT1G01010"; -bash-4.2$ tail athaliana_TAIR10_genes.gtf ChrM TAIR10 exon 349830 351413 . - . transcript_id "ATMG01360.1"; gene_id "ATMG01360"; gene_name "ATMG01360"; ChrM TAIR10 CDS 349830 351413 . - 0 transcript_id "ATMG01360.1"; gene_id "ATMG01360"; gene_name "ATMG01360"; ChrM TAIR10 exon 360717 361052 . - . transcript_id "ATMG01370.1"; gene_id "ATMG01370"; gene_name "ATMG01370"; ChrM TAIR10 CDS 360717 361052 . - 0 transcript_id "ATMG01370.1"; gene_id "ATMG01370"; gene_name "ATMG01370"; ChrM TAIR10 exon 361062 361179 . - . transcript_id "ATMG01380.1"; gene_id "ATMG01380"; gene_name "ATMG01380"; ChrM TAIR10 exon 361350 363284 . - . transcript_id "ATMG01390.1"; gene_id "ATMG01390"; gene_name "ATMG01390"; ChrM TAIR10 exon 363725 364042 . + . transcript_id "ATMG01400.1"; gene_id "ATMG01400"; gene_name "ATMG01400"; ChrM TAIR10 CDS 363725 364042 . + 0 transcript_id "ATMG01400.1"; gene_id "ATMG01400"; gene_name "ATMG01400"; ChrM TAIR10 exon 366086 366700 . - . transcript_id "ATMG01410.1"; gene_id "ATMG01410"; gene_name "ATMG01410"; ChrM TAIR10 CDS 366086 366700 . - 0 transcript_id "ATMG01410.1"; gene_id "ATMG01410"; gene_name "ATMG01410";
We see that whereas in our GFF file we have various untranslated regions included, as well as annotations, the GTF format contains Information only on various transcripts for each gene. The "transcript_id" denoter in the last column tells us the gene and its isoform, and everything else about the GTF file is quite apparent!
Just as was stated for our conversion from gff to gtf, it would be helpful for us to perform the same operation on our aligned reads. That is, if there are multiple, overlapping but distinct reads from a single gene, we could combine these reads into one transcript isoform. Because we have the gene isoforms in the gtf file, we can re-map each assembled transcript to a gene isoform and then count how many mappings there are per isoform. This, in effect, allows us to quantify the expression rates of each isoform. We will be using the program StringTie to assemble the transcripts for each sample. StringTie requires three input arguments: the BAM alignment file, the genomic GTF file, and the desired output GTF filename. Thus, our code will look like (do not run this!):
#!/bin/bash #SBATCH --job-name=stringtie #SBATCH --mail-user= #SBATCH --mail-type=ALL #SBATCH -n 1 #SBATCH -N 1 #SBATCH -c 8 #SBATCH --mem=120G #SBATCH -o %x_%j.out #SBATCH -e %x_%j.err #SBATCH --partition=general #SBATCH --qos=general export TMPDIR=/home/CAM/$USER/tmp/ mkdir -p ../ballgown/{athaliana_wt_Rep1,athaliana_wt_Rep2,athaliana_wt_Rep3,athaliana_mutant_Rep1,athaliana_mutant_Rep2,athaliana_mutant_Rep3} module load stringtie stringtie -e -B -p 8 ../mapping/wt_Rep1_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_wt_Rep1/athaliana_wt_Rep1.count -A ../ballgown/athaliana_wt_Rep1/wt_Rep1_gene_abun.out stringtie -e -B -p 8 ../mapping/wt_Rep2_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_wt_Rep2/athaliana_wt_Rep2.count -A ../ballgown/athaliana_wt_Rep2/wt_Rep2_gene_abun.out stringtie -e -B -p 8 ../mapping/wt_Rep3_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_wt_Rep3/athaliana_wt_Rep3.count -A ../ballgown/athaliana_wt_Rep3/wt_Rep3_gene_abun.out stringtie -e -B -p 8 ../mapping/mutant_Rep1_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_mutant_Rep1/athaliana_mutant_Rep1.count -A ../ballgown/athaliana_mutant_Rep1/mutant_Rep1_gene_abun.out stringtie -e -B -p 8 ../mapping/mutant_Rep2_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_mutant_Rep2/athaliana_mutant_Rep2.count -A ../ballgown/athaliana_mutant_Rep2/mutant_Rep2_gene_abun.out stringtie -e -B -p 8 ../mapping/mutant_Rep3_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o ../ballgown/athaliana_mutant_Rep3/athaliana_mutant_Rep3.count -A ../ballgown/athaliana_mutant_Rep3/mutant_Rep3_gene_abun.out
The following files will be genrated from the above command
bash-4.2$ e2t.ctab e_data.ctab i2t.ctab i_data.ctab t_data.ctab wt_Rep1_gene_abun.out athaliana_wt_Rep1.count
Description of above files
e_data.ctab: exon-level expression measurements. One row per exon. Columns are e_id (numeric exon id), chr, strand, start, end (genomic location of the exon), and the following expression measurements for each sample:
rcount: reads overlapping the exon
ucount: uniquely mapped reads overlapping the exon
mrcount: multi-map-corrected number of reads overlapping the exon
cov average per-base read coverage
cov_sd: standard deviation of per-base read coverage
mcov: multi-map-corrected average per-base read coverage
mcov_sd: standard deviation of multi-map-corrected per-base coverage
i_data.ctab: intron- (i.e., junction-) level expression measurements. One row per intron. Columns are i_id (numeric intron id), chr, st rand, start, end (genomic location of the intron), and the following expression measurements for each sample:
rcount: number of reads supporting the intron
ucount: number of uniquely mapped reads supporting the intron
mrcount: multi-map-corrected number of reads supporting the intron
t_data.ctab: transcript-level expression measurements. One row per transcript. Columns are:
t_id: numeric transcript id
chr, strand, start, end: genomic location of the transcript
t_name: Cufflinks-generated transcript id
num_exons: number of exons comprising the transcript
length: transcript length, including both exons and introns
gene_id: gene the transcript belongs to
gene_name: HUGO gene name for the transcript, if known
cov: per-base coverage for the transcript (available for each sample)
FPKM: Cufflinks-estimated FPKM for the transcript (available for each sample)
e2t.ctab: table with two columns, e_id and t_id, denoting which exons belong to which transcripts. These ids match the ids in the e_data and t_data tables.
i2t.ctab: table with two columns, i_id and t_id, denoting which introns belong to which transcripts. These ids match the ids in the i_data and t_data tables.
Let's have a look at the stringtie output .counts file which we will be using in ballgown:
# stringtie -e -B -p 8 /UCHC/LABS/CBC/Tutorials/model_arabidopsis//mapping/wt_Rep1_sort.bam -G /isg/shared/databases/alignerIndex/plant/Arabidopsis/thaliana/TAIR10_GFF3_genes.gtf -o /UCHC/LABS/CBC/Tutorials/model_arabidopsis//counts/athaliana_wt_Rep1/athaliana_wt_Rep1.count -A /UCHC/LABS/CBC/Tutorials/model_arabidopsis//counts/athaliana_wt_Rep1/wt_Rep1_gene_abun.out # StringTie version 1.3.4d 1 StringTie transcript 3631 5899 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; ref_gene_name "AT1G01010"; cov "3.623815"; FPKM "1.882998"; TPM "2.287898"; 1 StringTie exon 3631 3913 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "1"; ref_gene_name "AT1G01010"; cov "2.756184"; 1 StringTie exon 3996 4276 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "2"; ref_gene_name "AT1G01010"; cov "4.473310"; 1 StringTie exon 4486 4605 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "3"; ref_gene_name "AT1G01010"; cov "2.566667"; 1 StringTie exon 4706 5095 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "4"; ref_gene_name "AT1G01010"; cov "2.882051"; 1 StringTie exon 5174 5326 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "5"; ref_gene_name "AT1G01010"; cov "7.189542"; 1 StringTie exon 5439 5899 1000 + . gene_id "AT1G01010"; transcript_id "AT1G01010.1"; exon_number "6"; ref_gene_name "AT1G01010"; cov "3.357918";
For many organisms, many of the same genes are expressed in separate cell types, with a variety of phenotype differences a result of the specific isoforms a cell will use. Therefore, when performing a differential expression analysis from different parts of one organism (not one species, but a singular organism), it is wise to perform an isoform expression analysis alongside a standard differential expression analysis and combine the results (as we are doing here). We will only be performing the isoform expresion analysis. Ballgown is a differential expression package for R via Bioconductor ideal for isoform expression analyses. Before beginning, you need to secure copy our ballgown directory from Xanadu to your local machine:
-bash-4.2$ exit Connection to transfer.cam.uchc.edu closed. user:~$ scp -r YOUR.USER.NAME@transfer.cam.uchc.edu:/home/CAM/$USER/rnaseq_for_model_plant/ballgown .
Now we load RStudio with administrator privileges (otherwise you cannot install packages!).
To begin we must download and load the proper packages:
install.packages("devtools") install.packages("RFLPtools") source("http://www.bioconductor.org/biocLite.R") biocLite(c("alyssafrazee/RSkittleBrewer","ballgown", "genefilter", "dplyr", "devtools")) library(ballgown) library(RSkittleBrewer) library(genefilter) library(dplyr) library(ggplot2) library(gplots) library(devtools) library(RFLPtools)
Now we need to set our working directory to the directory which contains our "ballgown" folder. For me, this is:
setwd("/Users/vijendersingh/Documents/workshop_2019/") list.files()
You should see the "ballgown" folder after the list.files() command.
Let's have a look at the ballgown function:
help("ballgown") constructor function for ballgown objects Description constructor function for ballgown objects Usage ballgown(samples = NULL, dataDir = NULL, samplePattern = NULL, bamfiles = NULL, pData = NULL, verbose = TRUE, meas = "all") Arguments samples vector of file paths to folders containing sample-specific ballgown data (generated by tablemaker). If samples is provided, dataDir and samplePattern are not used. dataDir file path to top-level directory containing sample-specific folders with ballgown data in them. Only used if samples is NULL. samplePattern regular expression identifying the subdirectories of\ dataDir containing data to be loaded into the ballgown object (and only those subdirectories). Only used if samples is NULL. bamfiles optional vector of file paths to read alignment files for each sample. If provided, make sure to sort properly (e.g., in the same order as samples). Default NULL. pData optional data.frame with rows corresponding to samples and columns corresponding to phenotypic variables. verbose if TRUE, print status messages and timing Information as the object is constructed. meas character vector containing either "all" or one or more of: "rcount", "ucount", "mrcount", "cov", "cov_sd", "mcov", "mcov_sd", or "FPKM". The resulting ballgown object will only contain the specified expression measurements, for the appropriate features. See vignette for which expression measurements are available for which features. "all" creates the full object.
Because of the structure of our ballgown directory, we may use dataDir = "ballgown", samplePattern = "athaliana", measure = "FPKM", and pData = some_type_of_phenotype_matrix.
We want all of the objects in our arguments to be in the same order as they are present in the ballgown directory. Therefore, we want our pData matrix to have two columns -- the first column being the samples as they appear in the ballgown directory, and the second being the phenotype of each sample in the column before it (root or shoot). Let's see the order of our sample files:
list.files("ballgown/") [1] "athaliana_mutant_Rep1" "athaliana_mutant_Rep2" "athaliana_mutant_Rep3" [4] "athaliana_wt_Rep1" "athaliana_wt_Rep2" "athaliana_wt_Rep3"
Now we construct a 6x2 phenotype matrix with the first column being our samples in order and the second each sample's phenotype:
pheno_data = c("athaliana_root_1", "athaliana_root_2", "athaliana_shoot_1", "athaliana_shoot_2","root","root","shoot","shoot")
sample<-c("athaliana_mutant_Rep1","athaliana_mutant_Rep2", "athaliana_mutant_Rep3", "athaliana_wt_Rep1", "athaliana_wt_Rep2", "athaliana_wt_Rep3" ) type<-c(rep("mutant",3),rep("wt",3)) pheno_df<-data.frame("sample"=sample,"type"=type) rownames(pheno_df)<-pheno_df[,1] pheno_f sample type athaliana_mutant_Rep1 athaliana_mutant_Rep1 mutant athaliana_mutant_Rep2 athaliana_mutant_Rep2 mutant athaliana_mutant_Rep3 athaliana_mutant_Rep3 mutant athaliana_wt_Rep1 athaliana_wt_Rep1 wt athaliana_wt_Rep2 athaliana_wt_Rep2 wt athaliana_wt_Rep3 athaliana_wt_Rep3 wt
We may now create our ballgown object:
bg <- ballgown(dataDir = ".", pData=pheno_df, samplePattern = "athaliana") Thu May 2 22:33:46 2019 Thu May 2 22:33:46 2019: Reading linking tables Thu May 2 22:33:46 2019: Reading intron data files Thu May 2 22:33:49 2019: Merging intron data Thu May 2 22:33:50 2019: Reading exon data files Thu May 2 22:33:54 2019: Merging exon data Thu May 2 22:33:55 2019: Reading transcript data files Thu May 2 22:33:56 2019: Merging transcript data Wrapping up the results Thu May 2 22:33:56 2019 head(texpr(bg))
We filter our ballgown object to take only genes with variances above 1 using rowVars().
??ballgown::subset
subset ballgown objects to specific samples or genomic locations Description subset ballgown objects to specific samples or genomic locations Usage subset(x, ...) ## S4 method for signature 'ballgown' subset(x, cond, genomesubset = TRUE) Arguments x a ballgown object ... further arguments to generic subset cond Condition on which to subset. See details. genomesubset if TRUE, subset x to a specific part of the genome. Otherwise, subset x to only include specific samples. TRUE by default. Details To use subset, you must provide the cond argument as a string representing a logical expression specifying your desired subset. The subset expression can either involve column names of texpr(x, "all") (if genomesubset is TRUE) or of pData(x) (if genomesubset is FALSE). For example, if you wanted a ballgown object for only chromosome 22, you might call subset(x, "chr == 'chr22'"). (Be sure to handle quotes within character strings appropriately).
bg_filtered=subset(bg, "rowVars(texpr(bg))>1")
We follow the guide and subset our ballgown object under the condition that the row-variances of the expression data are greater than one, keeping the gene names.
To perform the isoform differential expression analysis we use ballgown's "stattest" function. Let's have a look at it:
??ballgown::stattest
statistical tests for differential expression in ballgown Description Test each transcript, gene, exon, or intron in a ballgown object for differential expression, using comparisons of linear models. Usage stattest(gown = NULL, gowntable = NULL, pData = NULL, mod = NULL, mod0 = NULL, feature = c("gene", "exon", "intron", "transcript"), meas = c("cov", "FPKM", "rcount", "ucount", "mrcount", "mcov"), timecourse = FALSE, covariate = NULL, adjustvars = NULL, gexpr = NULL, df = 4, getFC = FALSE, libadjust = NULL, log = TRUE) Arguments gown name of an object of class ballgown gowntable matrix or matrix-like object with rownames representing feature IDs and columns representing samples, with expression estimates in the cells. Provide the feature name with feature. You must provide exactly one of gown or gowntable. NB: gowntable is log-transformed within stattest if log is TRUE, so provide un-logged expression values in gowntable. pData Required if gowntable is provided: data frame giving phenotype data for the samples in the columns of gowntable. (Rows of pData correspond to columns of gowntable). If gown is used instead, it must have a non-null, valid pData slot (and the pData argument to stattest should be left NULL). mod object of class model.matrix representing the design matrix for the linear regression model including covariates of interest mod0 object of class model.matrix representing the design matrix for the linear regression model without the covariates of interest. feature the type of genomic feature to be tested for differential expression. If gown is used, must be one of "gene", "transcript", "exon", or "intron". If gowntable is used, this is just used for labeling and can be whatever the rows of gowntable represent. meas the expression measurement to use for statistical tests. Must be one of "cov", "FPKM", "rcount", "ucount", "mrcount", or "mcov". Not all expression measurements are available for all features. Leave as default if gowntable is provided. timecourse if TRUE, tests whether or not the expression profiles of genomic features vary over time (or another continuous covariate) in the study. Default FALSE. Natural splines are used to fit time profiles, so you must have more timepoints than degrees of freedom used to fit the splines. The default df is 4. covariate string representing the name of the covariate of interest for the differential expression tests. Must correspond to the name of a column of pData(gown). If timecourse=TRUE, this should be the study's time variable. adjustvars optional vector of strings representing the names of potential confounders. Must correspond to names of columns of pData(gown). gexpr optional data frame that is the result of calling gexpr(gown)). (You can speed this function up by pre-creating gexpr(gown).) df degrees of freedom used for modeling expression over time with natural cubic splines. Default 4. Only used if timecourse=TRUE. getFC if TRUE, also return estimated fold changes (adjusted for library size and confounders) between populations. Only available for 2-group comparisons at the moment. Default FALSE. libadjust library-size adjustment to use in linear models. By default, the adjustment is defined as the sum of the sample's log expression measurements below the 75th percentile of those measurements. To use a different library-size adjustment, provide a numeric vector of each sample's adjustment value. Entries of this vector correspond to samples in in rows of pData. If no library size adjustment is desired, set to FALSE. log if TRUE, outcome variable in linear models is log(expression+1), otherwise it's expression. Default TRUE.
We see we can determine which transcripts and genes are differentially expressed in the roots or shoots, alongside the fold changes of each differentially expressed gene as measured in FPKM with the following code:
results_transcripts = stattest(bg_filtered, feature="transcript" , covariate = "type" , getFC = TRUE, meas = "FPKM") results_genes = stattest(bg_filtered, feature="gene" , covariate = "type" , getFC = TRUE, meas = "FPKM")
Let's take a look at this object:
head(results_genes) feature id fc pval qval 1 gene AT1G01050 0.8216286 0.038409878 0.9996177 2 gene AT1G01060 1.2906809 0.825960521 0.9996177 3 gene AT1G01080 0.8156244 0.276868361 0.9996177 4 gene AT1G01090 1.0838842 0.009539157 0.9996177 5 gene AT1G01100 0.9755726 0.687152148 0.9996177 6 gene AT1G01110 0.9522035 0.706397431 0.9996177
Each differentially expressed gene (or isoform) is listed, alongside its ID, fold-change (percent increase), p-value, and q-value.
Now we want to order our results according to their p-value, and then subset to only take results with p-values below 0.01, writing our findings to a csv:
results_genes = arrange(results_genes,pval) results_genes = subset(results_genes, pval < 0.01) results_transcripts = arrange(results_transcripts, pval) results_transcripts = subset(results_transcripts, pval < 0.01) write.csv(results_transcripts, "[PATH-correction]transcript_results.csv", row.names=FALSE) write.csv(results_genes, "[PATH-correction]results_genes.csv", row.names=FALSE) ##we use row.names=FALSE because currently the row names are just the numbers 1, 2, 3. . .
Now we want to visualize our data: We want to compare our genes based on their FPKM values. We know from reading ballgown's vignette that we can extract the expression data using texpr() and specifying a measure.
fpkm = texpr(bg, meas = "FPKM") ##let's look at the distribution plot(density(fpkm[,1]),typr="l",main="Density Plot of \nUntransformed FPKM",col="blue") lines(density(fpkm[,2]),col="red") lines(density(fpkm[,3]),col="green") lines(density(fpkm[,4]),col="dodgerblue") lines(density(fpkm[,5]),col="pink") lines(density(fpkm[,6]),col="limegreen")We can see virtually nothing except that there are many, many genes that are lowly expressed. The reason for the sharp peak is that the density plot automatically scales its x-axis from the lowest expressed to the highest expressed. Let's see what those values are:
min(fpkm) 0 max(fpkm) 13386.3
Due to the scaling, we cannot truly see the distribution. However, what we can do is to transform the data such that the variance is not so staggering, allowing us to see better. There are a few rules for this, all of the data must be transformed in a consistent and reversible manner, after transformation no data may have a negative value, and all data with a value of 0 must also be 0 after transformation. The reason for the second and third rules is more epistemological. For us, if a gene has an FPKM of 0, then for that sample the gene is unexpressed. Should we transform the data and that particular gene's FPKM is now above 0, we are fundamentally changing the nature of that sample -- i.e., we are now saying it is expresesing a gene it actually is not! Additionally, there is no such thing as negative expression, so there is no physical reality where we will have an FPKM beneath 0. With these three rules, we see that taking the log of all our data will prevent negative values, be consistent and reversible, and scale down our variance. However, log(0) = Inf! We have broken a cardinal rule (oddly enough, the fact that it is Infinity is not a rule-breaker, but rather that it is negative Infinity! Seeing this, we can simply add 1 to our data before log transforming, log(0+1) = 0. Now we have fulfilled all three rules.
fpkm = log2(fpkm + 1) head(fpkm) plot(density(fpkm[,1]),type="l",main="Density Comparison",col="red") lines(density(fpkm[,2]),col="blue") lines(density(fpkm[,3]),col="green") lines(density(fpkm[,4]),col="red") lines(density(fpkm[,5]),col="blue") lines(density(fpkm[,6]),col="green")
We now we see an actual distribution. Let's see the difference in distribution between each individual part. To do this we are going to plot the density for each part, one by one, and watch for great changes.
Now we will generate a PCA plot. I strongly advise you read the PCA link before continuing if you are not familiar with Principal Component Analysis. It will not be explained in this tutorial.
Let's create a vector with our PCA point names
short_names = c("mu1","mu2","mu3","wt1","wt2","wt3")
We are going to be using the Pearson coefficient for our PCA plot. You may think of the Pearson coefficient simply as a measure of similarity. If two datasets are very similar, they will have a Pearson coefficient approaching 1 (every data compared to itself has a Pearson coefficient of 1). If two datasets are very dissimilar, they will have a Pearson coefficient approaching 0 Let's calculate a vector containing the correlation coefficient:
r = cor(fpkm, use="pairwise.complete.obs", method="pearson")
Let's have a look at r:
r FPKM.athaliana_mutant_Rep1 FPKM.athaliana_mutant_Rep2 FPKM.athaliana_mutant_Rep3 FPKM.athaliana_wt_Rep1 FPKM.athaliana_wt_Rep2 FPKM.athaliana_wt_Rep3 FPKM.athaliana_mutant_Rep1 1.0000000 0.9689147 0.9701448 0.9617423 0.9738848 0.9716859 FPKM.athaliana_mutant_Rep2 0.9689147 1.0000000 0.9713023 0.9659690 0.9676161 0.9644472 FPKM.athaliana_mutant_Rep3 0.9701448 0.9713023 1.0000000 0.9668139 0.9684712 0.9649888 FPKM.athaliana_wt_Rep1 0.9617423 0.9659690 0.9668139 1.0000000 0.9606613 0.9631253 FPKM.athaliana_wt_Rep2 0.9738848 0.9676161 0.9684712 0.9606613 1.0000000 0.9733014 FPKM.athaliana_wt_Rep3 0.9716859 0.9644472 0.9649888 0.9631253 0.9733014 1.0000000
Here we see each member of the diagonal is 1.000000. Of course we knew this already, as each member is 100% similar to itself! Then we have the similarity measures of each sample to each other sample.
Rather than calculate the similarity, it would be nicer to calculate the dissimilarity or distance between each sample. We know that if two samples are the same, their similarity measure is 1.000000. We also know that then their dissimilarity is 0%, or 0.000000. Here we see that if we subtract each element from 1, we get the dissimilarity matrix! Let's do it:
d = 1 - r d FPKM.athaliana_mutant_Rep1 FPKM.athaliana_mutant_Rep2 FPKM.athaliana_mutant_Rep3 FPKM.athaliana_wt_Rep1 FPKM.athaliana_wt_Rep2 FPKM.athaliana_wt_Rep3 FPKM.athaliana_mutant_Rep1 0.00000000 0.03108533 0.02985520 0.03825768 0.02611516 0.02831408 FPKM.athaliana_mutant_Rep2 0.03108533 0.00000000 0.02869768 0.03403101 0.03238395 0.03555277 FPKM.athaliana_mutant_Rep3 0.02985520 0.02869768 0.00000000 0.03318614 0.03152878 0.03501125 FPKM.athaliana_wt_Rep1 0.03825768 0.03403101 0.03318614 0.00000000 0.03933872 0.03687471 FPKM.athaliana_wt_Rep2 0.02611516 0.03238395 0.03152878 0.03933872 0.00000000 0.02669858 FPKM.athaliana_wt_Rep3 0.02831408 0.03555277 0.03501125 0.03687471 0.02669858 0.00000000
R has a function which will perform the principal component analysis for us when provided with a dissimilarity matrix, cmdscale. Let's have a look at it:
help(cmdscale)
Classical (Metric) Multidimensional Scaling Description Classical multidimensional scaling (MDS) of a data matrix. Also known as principal coordinates analysis (Gower, 1966). Usage cmdscale(d, k = 2, eig = FALSE, add = FALSE, x.ret = FALSE, list. = eig || add || x.ret) Arguments d a distance structure such as that returned by dist or a full symmetric matrix containing the dissimilarities. k the maximum dimension of the space which the data are to be represented in; must be in {1, 2, …, n-1}. eig indicates whether eigenvalues should be returned. add logical indicating if an additive constant c* should be computed, and added to the non-diagonal dissimilarities such that the modified dissimilarities are Euclidean. x.ret indicates whether the doubly centred symmetric distance matrix should be returned. list. logical indicating if a list should be returned or just the n * k matrix, see ‘Value:’. Details Multidimensional scaling takes a set of dissimilarities and returns a set of points such that the distances between the points are approximately equal to the dissimilarities. (It is a major part of what ecologists call ‘ordination’.) A set of Euclidean distances on n points can be represented exactly in at most n - 1 dimensions. cmdscale follows the analysis of Mardia (1978), and returns the best-fitting k-dimensional representation, where k may be less than the argument k. The representation is only determined up to location (cmdscale takes the column means of the configuration to be at the origin), rotations and reflections. The configuration returned is given in principal-component axes, so the reflection chosen may differ between R platforms (see prcomp). When add = TRUE, a minimal additive constant c* is computed such that the dissimilarities d[i,j] + c* are Euclidean and hence can be represented in n - 1 dimensions. Whereas S (Becker et al, 1988) computes this constant using an approximation suggested by Torgerson, R uses the analytical solution of Cailliez (1983), see also Cox and Cox (2001). Note that because of numerical errors the computed eigenvalues need not all be non-negative, and even theoretically the representation could be in fewer than n - 1 dimensions.
Let's perform our principal component analysis:
pca = cmdscale(d, k=2)
We expect pca to have four rows, each row corresponding to a sample, and two columns, the first column representing our first coordinate axis and the second dimension representing our second coordinate axis. If we plot the first column against the second column, the distances between points is the dissimilarity between points.
pca [,1] [,2] FPKM.athaliana_mutant_Rep1 0.010188699 0.0037862309 FPKM.athaliana_mutant_Rep2 -0.007391951 0.0125768089 FPKM.athaliana_mutant_Rep3 -0.006736291 0.0104882107 FPKM.athaliana_wt_Rep1 -0.021280708 -0.0133394678 FPKM.athaliana_wt_Rep2 0.013442569 0.0001839026 FPKM.athaliana_wt_Rep3 0.011777681 -0.0136956852
For this next step it is assumed that you are familiar with plotting in R. If not you may look here.
plot.new() par(mfrow=c(1,1)) ##point colors point_colors = c("red", "red","red","blue", "blue", "blue") plot(pca[,1],pca[,2], xlab="", ylab="", main="PCA plot for all libraries", xlim=c(-0.025,0.02), ylim=c(-0.05,0.05),col=point_colors) text(pca[,1],pca[,2],pos=2,short_names, col=c("red", "red","red","blue", "blue", "blue"))
We should take advantage while we have this results_genes object and annotate the genes we have deemed significant (p-values below 0.01, every gene now in this object). To annotate the genes we will be using biomaRt and biomartr. You can install these with the following code:
## try http:// if https:// URLs are not supported source("https://bioconductor.org/biocLite.R") biocLite("biomaRt") install.packages("biomartr")
The first step in annotating our genes of interest is to choose our database. We do this using the "useMart" function of biomaRt:
library(biomaRt) library(biomartr) ??biomaRt::useMart useMart {biomaRt} R Documentation Connects to the selected BioMart database and dataset Description A first step in using the biomaRt package is to select a BioMart database and dataset to use. The useMart function enables one to connect to a specified BioMart database and dataset within this database. To know which BioMart databases are available see the listMarts function. To know which datasets are available within a BioMart database, first select the BioMart database using useMart and then use the listDatasets function on the selected BioMart, see listDatasets function. Usage useMart(biomart, dataset, host="www.ensembl.org", path="/biomart/martservice", port=80, archive=FALSE, ssl.verifypeer = TRUE, ensemblRedirect = NULL, version, verbose = FALSE) Arguments biomart BioMart database name you want to connect to. Possible database names can be retrieved with the functio listMarts dataset Dataset you want to use. To see the different datasets available within a biomaRt you can e.g. do: mart = useMart('ensembl'), followed by listDatasets(mart). host Host to connect to. Defaults to www.ensembl.org path Path that should be pasted after to host to get access to the web service URL port port to connect to, will be pasted between host and path archive Boolean to indicate if you want to access archived versions of BioMart databases. Note that this argument is now deprecated and will be removed in the future. A better alternative is to leave archive = FALSE and to specify the url of the archived BioMart you want to access. For Ensembl you can view the list of archives using listEnsemblArchives ssl.verifypeer Set SSL peer verification on or off. By default ssl.verifypeer is set to TRUE ensemblRedirect This argument has now been deprecated. version Use version name instead of biomart name to specify which BioMart you want to use verbose Give detailed output of what the method is doing while in use, for debugging
A quick google search will show that the genome we used, TAIR10, is the Ensembl format of the thale cress. We are going to want to use the gene dataset. Let's verify that it is there following the instructions provided:
mart = useMart("ensembl") head(listDatasets(mart)) dataset description version 1 abrachyrhynchus_gene_ensembl Pink-footed goose genes (ASM259213v1) ASM259213v1 2 acalliptera_gene_ensembl Eastern happy genes (fAstCal1.2) fAstCal1.2 3 acarolinensis_gene_ensembl Anole lizard genes (AnoCar2.0) AnoCar2.0 4 acitrinellus_gene_ensembl Midas cichlid genes (Midas_v5) Midas_v5 5 ahaastii_gene_ensembl Great spotted kiwi genes (aptHaa1) aptHaa1 6 amelanoleuca_gene_ensembl Panda genes (ailMel1) ailMel1
We want to scan this for the thale cress. But first, let's make sure we can scan it, period:
listDatasets(mart)[grep("ahaastii",listDatasets(mart)[,1]),] dataset description version 5 ahaastii_gene_ensembl Great spotted kiwi genes (aptHaa1) aptHaa1
We subset the listDatasets(mart) dataframe to include all rows which have the substring "amelanoleuca" in them. The return is row 2, which we can easily verify matches the head of the dataframe. Now let's try it with our species, "thaliana":
listDatasets(mart)[grep("thaliana",listDatasets(mart)[,1]),] [1] dataset description version <0 rows> (or 0-length row.names)
There is no match. The reason for this is that biomaRt defaults to animal model organisms! We need to access the plant database. Now let's try:
listMarts(host="plants.ensembl.org") biomart version 1 plants_mart Ensembl Plants Genes 43 2 plants_variations Ensembl Plants Variations 43 ##if you are confused by the use of the listMarts function, read the useMart guide above! mart = useMart("plants_mart", host="plants.ensembl.org") head(listDatasets(mart)) dataset description version 1 achinensis_eg_gene Actinidia chinensis Red5 genes (Red5_PS1_1.69.0) Red5_PS1_1.69.0 2 ahalleri_eg_gene Arabidopsis halleri genes (Ahal2.2) Ahal2.2 3 alyrata_eg_gene Arabidopsis lyrata genes (v.1.0) v.1.0 4 atauschii_eg_gene Aegilops tauschii genes (Aet v4.0) Aet v4.0 5 athaliana_eg_gene Arabidopsis thaliana genes (TAIR10) TAIR10 6 atrichopoda_eg_gene Amborella trichopoda genes (AMTR1.0) AMTR1.0 ##we see the thale cress as row 3! now we may choose our dataset: thale_mart = useMart("plants_mart",host="plants.ensembl.org",dataset="athaliana_eg_gene") head(thale_mart) Error in x[seq_len(n)] : object of type 'S4' is not subsettable
Our mart is in the S4 class and not readable right now. We can process it by using the "getBM" function:
??biomaRt::getBM Retrieves Information from the BioMart database Description This function is the main biomaRt query function. Given a set of filters and corresponding values, it retrieves the user specified attributes from the BioMart database one is connected to. Usage getBM(attributes, filters = "", values = "", mart, curl = NULL, checkFilters = TRUE, verbose = FALSE, uniqueRows = TRUE, bmHeader = FALSE, quote = "\"") Arguments attributes Attributes you want to retrieve. A possible list of attributes can be retrieved using the function listAttributes. filters Filters (one or more) that should be used in the query. A possible list of filters can be retrieved using the function listFilters. values Values of the filter, e.g. vector of affy IDs. If multiple filters are specified then the argument should be a list of vectors of which the position of each vector corresponds to the position of the filters in the filters argument. mart object of class Mart, created with the useMart function. curl An optional 'CURLHandle' object, that can be used to speed up getBM when used in a loop. checkFilters Sometimes attributes where a value needs to be specified, for example upstream\_flank with value 20 for obtaining upstream sequence flank regions of length 20bp, are treated as filters in BioMarts. To enable such a query to work, one must specify the attribute as a filter and set checkFilters = FALSE for the query to work. verbose When using biomaRt in webservice mode and setting verbose to TRUE, the XML query to the webservice will be printed. uniqueRows If the result of a query contains multiple identical rows, setting this argument to TRUE (default) will result in deleting the duplicated rows in the query result at the server side. bmHeader Boolean to indicate if the result retrieved from the BioMart server should include the data headers or not, defaults to FALSE. This should only be switched on if the default behavior results in errors, setting to on might still be able to retrieve your data in that case quote Sometimes parsing of the results fails due to errors in the Ensembl data fields such as containing a quote, in such cases you can try to change the value of quote to try to still parse the results. Value A data.frame. There is no implicit mapping between its rows and the function arguments (e.g. filters, values), therefore make sure to have the relevant identifier(s) returned by specifying them in attributes. See Examples.
Let's find out the attributes and filters by following the instructions in the vignette:
dim(listAttributes(thale_mart)) [1] 1212 3 ##1118 attributes is too many for us to look through. They are ordered somewhat in prevalence of use. ##let's look at the most commonly used attributes and see if they'll work for us head(listAttributes(thale_mart)) name description page 1 ensembl_gene_id Gene stable ID feature_page 2 ensembl_transcript_id Transcript stable ID feature_page 3 ensembl_peptide_id Protein stable ID feature_page 4 ensembl_exon_id Exon stable ID feature_page 5 description Gene description feature_page 6 chromosome_name Chromosome/scaffold name feature_page ##we don't know the chromosome name, so we can just take attributes 1,3, and 5 thale_data_frame = getBM(attributes=c("ensembl_gene_id","ensembl_peptide_id","description"),mart=thale_mart) head(thale_data_frame) ensembl_gene_id ensembl_peptide_id description 1 AT3G11415 2 AT1G31258 other RNA [Source:TAIR;Acc:AT1G31258] 3 AT5G24735 other RNA [Source:TAIR;Acc:AT5G24735] 4 AT2G45780 other RNA [Source:TAIR;Acc:AT2G45780] 5 AT2G42425 Unknown gene [Source:TAIR;Acc:AT2G42425] 6 AT4G01533 other RNA [Source:TAIR;Acc:AT4G01533]
The default descriptions are certainly underwhelming. Let's see if there are any other types of descriptions we can get:
listAttributes(thale_mart)[grep("descr",listAttributes(thale_mart)[,1]),] name description page 5 description Gene description feature_page 34 goslim_goa_description GOSlim GOA Description feature_page 113 interpro_short_description Interpro Short Description feature_page 114 interpro_description Interpro Description feature_page 151 description Gene description structure 178 description Gene description homologs 1133 description Gene description snp 1136 source_description Variant source description snp 1174 description Gene description sequences
Using the other descriptions will take much, much longer as the Information is extracted from the appropriate databases via internet connection. For this tutorial we will be sticking with our un-impressive descriptions. However, you may choose the description best for you and your resesarch. Before we move on to annotating, let's have a look at the filters:
head(listFilters(thale_mart)) name description 1 chromosome_name Chromosome/scaffold name 2 start Start 3 end End 4 strand Strand 5 chromosomal_region e.g. 1:100:10000:-1, 1:100000:200000:1 6 with_chembl With ChEMBL ID(s)
Should we only want to annotate genes from a specific chromosome or any other critera, we would use the "filter" argument in getBM to select only the subset of the genome we desire. We now have all of the pieces required for us to annotate our results. Let's have a look at our gene results object and our thale cress data frame one more time:
head(thale_data_frame) ensembl_gene_id ensembl_peptide_id description 1 AT3G11415 2 AT1G31258 other RNA [Source:TAIR;Acc:AT1G31258] 3 AT5G24735 other RNA [Source:TAIR;Acc:AT5G24735] 4 AT2G45780 other RNA [Source:TAIR;Acc:AT2G45780] 5 AT2G42425 Unknown gene [Source:TAIR;Acc:AT2G42425] 6 AT4G01533 other RNA [Source:TAIR;Acc:AT4G01533] head(results_genes) feature id fc pval qval 1 gene AT1G01050 0.8216286 0.038409878 0.9996177 2 gene AT1G01060 1.2906809 0.825960521 0.9996177 3 gene AT1G01080 0.8156244 0.276868361 0.9996177 4 gene AT1G01090 1.0838842 0.009539157 0.9996177 5 gene AT1G01100 0.9755726 0.687152148 0.9996177 6 gene AT1G01110 0.9522035 0.706397431 0.9996177
Funny enough, we do not actually use a biomaRt function to annotate our genes! We can simply subset the thale cress data frame to consist of only rows whose ensemble_gene_id matches our results_genes id. Let's give it a try:
annotated_genes = subset(thale_data_frame, ensembl_gene_id %in% results_genes$id) head(annotated_genes) ensembl_gene_id ensembl_peptide_id description 15 AT3G48115 other RNA [Source:TAIR;Acc:AT3G48115] 151 AT4G04223 other RNA [Source:TAIR;Acc:AT4G04223] 588 AT2G46685 MIR166/MIR166A; miRNA [Source:TAIR;Acc:AT2G46685] 2239 AT2G18917 other RNA [Source:TAIR;Acc:AT2G18917] 2380 AT4G38932 Potential natural antisense gene, locus overlaps with AT4G38930 [Source:TAIR;Acc:AT4G38932] 5312 AT1G77590 AT1G77590.1 Long chain acyl-CoA synthetase 9, chloroplastic [Source:UniProtKB/Swiss-Prot;Acc:Q9CAP8] ##let's check our dimensions to ensure every gene was annotated dim(results_genes) [1] 117 5 dim(annotated_genes) [1] 254 3 ##our dimensions do not match! Let's investigate: head(annotated_genes) ensembl_gene_id ensembl_peptide_id description 15 AT3G48115 other RNA [Source:TAIR;Acc:AT3G48115] 151 AT4G04223 other RNA [Source:TAIR;Acc:AT4G04223] 588 AT2G46685 MIR166/MIR166A; miRNA [Source:TAIR;Acc:AT2G46685] 2239 AT2G18917 other RNA [Source:TAIR;Acc:AT2G18917] 2380 AT4G38932 Potential natural antisense gene, locus overlaps with AT4G38930 [Source:TAIR;Acc:AT4G38932] 5312 AT1G77590 AT1G77590.1 Long chain acyl-CoA synthetase 9, chloroplastic [Source:UniProtKB/Swiss-Prot;Acc:Q9CAP8] tail(annotated_genes) ensembl_gene_id ensembl_peptide_id description 52922 AT5G21930 AT5G21930.4 Copper-transporting ATPase PAA2, chloroplastic [Source:UniProtKB/Swiss-Prot;Acc:B9DFX7] 52923 AT5G21930 AT5G21930.1 Copper-transporting ATPase PAA2, chloroplastic [Source:UniProtKB/Swiss-Prot;Acc:B9DFX7] 53221 AT1G80290 AT1G80290.1 Nucleotide-diphospho-sugar transferases superfamily protein [Source:TAIR;Acc:AT1G80290] 53222 AT1G80290 AT1G80290.2 Nucleotide-diphospho-sugar transferases superfamily protein [Source:TAIR;Acc:AT1G80290] 53365 AT1G26670 AT1G26670.1 VTI1B [Source:UniProtKB/TrEMBL;Acc:A0A178W140] 53499 AT4G26490 AT4G26490.1 Late embryogenesis abundant (LEA) hydroxyproline-rich glycoprotein family [Source:UniProtKB/TrEMBL;Acc:Q56Y59]
A-ha. We see the mismatch in dimension length is due to some genes having different isoforms and therefore different peptide ids. Because we matched our data frames by gene id, some of the genes we have extracted multiple peptides! Also, take notice of this:
annotated_genes$ensembl_gene_id [1] "AT3G48115" "AT4G04223" "AT2G46685" "AT2G18917" "AT4G38932" "AT1G77590" "AT1G77590" "AT5G09480" "AT3G58760" "AT3G58760" [11] "AT3G58760" "AT3G58760" "AT3G58760" "AT3G58760" "AT5G09650" "AT4G36430" "AT5G23570" "AT5G23570" "AT5G23570" "AT5G23570" [21] "AT4G07990" "AT4G07990" "AT4G07990" "AT3G21720" "AT3G48240" "AT5G16660" "AT5G16660" "AT3G14070" "AT1G20680" "AT1G20680" [31] "AT5G21920" "AT5G21920" "AT3G20570" "AT3G56910" "AT2G19110" "AT2G19110" "AT2G19110" "AT5G44450" "AT5G44450" "AT3G24820" [41] "AT5G18550" "AT5G18550" "AT5G18550" "AT5G18550" "AT3G27830" "AT3G27830" "AT1G18680" "AT5G11980" "AT5G11980" "AT1G78200" [51] "AT1G78200" "AT1G78200" "AT1G78200" "AT1G78200" "AT1G63110" "AT1G63110" "AT1G63110" "AT4G14880" "AT4G14880" "AT4G14880" [61] "AT4G14880" "AT4G14880" "AT4G12230" "AT2G46680" "AT2G46680" "AT5G09995" "AT5G09995" "AT5G09995" "AT3G49810" "AT1G80560" [71] "AT3G58550" "AT4G24020" "AT4G24020" "AT5G49990" "AT5G49990" "AT5G49990" "AT5G49990" "AT2G43560" "AT2G43560" "AT3G53490" [81] "AT5G10450" "AT5G10450" "AT5G10450" "AT5G10450" "AT5G07020" "AT2G45950" "AT2G45950" "AT2G45950" "AT2G45950" "AT2G45950" [91] "AT5G22450" "AT5G22450" "AT5G22450" "AT2G43190" "AT2G43190" "AT2G43190" "AT2G43190" "AT2G43190" "AT1G26762" "AT5G48960" [101] "AT1G11905" "AT1G11905" "AT2G37920" "AT1G77570" "AT5G07460" "AT5G44580" "AT3G62730" "AT3G62730" "AT5G65120" "AT5G65120" [111] "AT4G01037" "AT1G06190" "AT1G06190" "AT1G06190" "AT1G06190" "AT1G06190" "AT3G08910" "AT1G15980" "AT1G78370" "AT1G58360" [121] "AT1G01090" "AT1G63860" "AT1G63860" "AT1G63860" "AT1G63860" "AT1G63860" "AT1G63860" "AT4G23710" "AT3G18870" "AT5G21040" [131] "AT5G21040" "AT5G21040" "AT4G31420" "AT4G31420" "AT3G05510" "AT3G05510" "AT5G38895" "AT5G38895" "AT5G38895" "AT4G30630" [141] "AT4G30630" "AT1G02560" "AT2G21510" "AT2G21510" "AT2G21510" "AT2G21510" "AT2G21510" "AT5G56190" "AT5G56190" "AT5G56190" [151] "AT5G56190" "AT5G56190" "AT5G56190" "AT5G56190" "AT1G67950" "AT1G67950" "AT1G67950" "AT1G67950" "AT1G05710" "AT1G05710" [161] "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" "AT1G05710" [171] "AT1G05710" "AT1G05710" "AT1G73720" "AT5G62680" "AT1G07950" "AT1G07950" "AT1G16560" "AT1G16560" "AT1G16560" "AT1G16560" [181] "AT1G16560" "AT1G16560" "AT1G16560" "AT1G16560" "AT1G16560" "AT5G65810" "AT2G18090" "AT2G18090" "AT2G26340" "AT2G26340" [191] "AT1G75460" "AT1G31940" "AT4G19230" "AT4G19230" "AT4G11370" "AT4G19006" "AT4G19006" "AT2G21640" "AT1G14400" "AT1G14400" [201] "AT1G12050" "AT5G52020" "AT3G52150" "AT3G52150" "AT2G36885" "AT2G36885" "AT2G40060" "AT1G51570" "AT1G07640" "AT1G07640" [211] "AT1G07640" "AT5G24780" "AT5G24780" "AT1G02750" "AT1G02750" "AT1G78040" "AT1G78040" "AT1G78040" "AT2G35550" "AT2G35550" [221] "AT2G35550" "AT2G35550" "AT3G61530" "AT3G61530" "AT1G70760" "AT3G19390" "AT5G42830" "AT1G23060" "AT1G23060" "AT1G23060" [231] "AT1G23060" "AT1G23060" "AT3G56170" "AT2G18150" "AT4G24220" "AT4G24220" "AT4G09060" "AT4G09060" "AT4G26950" "AT4G26950" [241] "AT2G37790" "AT5G17210" "AT5G17210" "AT5G43066" "AT1G10430" "AT1G10430" "AT5G21930" "AT5G21930" "AT5G21930" "AT5G21930" [251] "AT1G80290" "AT1G80290" "AT1G26670" "AT4G26490" write.csv(file="[PATH-correction]annotated_genes.csv",annotated_genes,row.names=F)
Cytoscape is a desktop program which creates visual topological networks of data. To visualise our differentially regulated genes in a network on cytoscape we will follow the following steps
- Load networkfile
- Lay the network out
- Load Expression Data
- Examine node attributes
A detailed slides and tutorial is available at this LINK. Lets start cytoscape and the application will start with following screen.
Have a look around at different tabs and menu and familiarise yourself with it. A network can be loaded in cytoscape using the import function located under file menu as shown in the image below. A network can be imported from a file (as we are going to do it), url or from public database. Import TAIR10 network file TairPP_refined.txt using file>import>Network from FIle option . The following table will be displayed .
The table will display different columns of the network file. In this we have to specify which column represent protein A (source node) and which column represent protein B (target node) of A --> B type protein-protein intercation.
Once imported different layouts can be tried listed under layout tab of cytoscape. Once you have chosen an appropriate layout and then import differential expression data stored in csv or txt file using icon.
Once the genes with differential expression is loaded, select the "Style tab and choose the "Fill Color". Under fill color choose Column value to "fc" (fold change from csv file) and set Mapping type to "Continous mapping". You can double click on the color panel to set colors of your choice and can set boudries.
This will highlight the nodes based on the value of fc for protein present in differentially expressed genes and in the network list.
Downloaded experimental data Performed quality control on the experimental data Aligned the experimental data to the reference genome, allowing us to determine which genes are active in each sample Determined and quantified the gene isoforms present in each sample Determined which gene isoforms had different general expression patterns between phenotypes Created visual gene topologial networks Extracted computational Information about those networks
While our work may have seemed completed after creating the visualization, the picture itself is not of much use to other scientists! However, all of the csv files we created are. A scientist may have an interest in one particular gene we studied. With our differential expression results output she will be able to determine how the gene's behavior varied according to phenotype. Perhaps she wants to begin investigating if one gene codes for a transcription factor of another. She can consult our gene complete clusters file and see if the two genes belong to the same cluster (as the activation of one will activate the other!). She may be interested in the total behavior of one cluster in activating or suppressing another cluster. She can determine her base and target clusters by locating the genes in our complete clusters file, extract all genes from those clusters, and then explore how downstream each cluster's effect may be by utilizing the degree of relationship csv. Bio Informatics is a collaborative field. We are always dependent on the work of others to solve the questions about which we are the most passionate. Because of this, it is important to always dig deep in your own analysis, and to create as readable and handy data as you can. Not only because you do not want another scientist to be lost in your files, but they must be readable by a computer! Sometimes, it may have felt like we were going down the rabbit hole in this tutorial. However, the Information we compiled is easy and immediately helpful for fellow scientists to use. Congratulations on finishing this tutorial successfully!