fix some unit tests

igvteam · Oct 17, 2020 · daf6be3 · daf6be3
1 parent b765f6b
commit daf6be3
Show file tree

Hide file tree

Showing 4 changed files with 8 additions and 87 deletions.
diff --git a/src/test/java/org/broad/igv/feature/genome/fasta/FastaIndexedSequenceTest.java b/src/test/java/org/broad/igv/feature/genome/fasta/FastaIndexedSequenceTest.java
@@ -52,39 +52,15 @@ public class FastaIndexedSequenceTest {
 
     @BeforeClass
     public static void setup() throws IOException {
-        String path = "http://data.broadinstitute.org/igvdata/test/fasta/ci2_test.fa";
+        String path = "https://s3.amazonaws.com/igv.org.test/data/ci2_test.fa";
         fastaSequence = new FastaIndexedSequence(path);
     }
 
-    /**
-     * Compare a direct read of sequence from a file vs a read from and indexed fasta for the same interval.
-     *
-     * @throws Exception
-     */
-    @Test
-    public void testReadSequence() throws Exception {
-
-        String chr02qSeqPath = "http://data.broadinstitute.org/igvdata/test/fasta/";
-
-        String chr = "chr02q";
-        int start = 3531385;
-        int end = 3531425;
-
-
-        // TAATTTTTACGTCTTATTTAAACACATATAATGAATAGGT;
-        Sequence igvSequence = new IGVSequence(chr02qSeqPath);
-        byte[] expectedBytes = igvSequence.getSequence(chr, start, end, true);
-        String expectedSequence = new String(expectedBytes);
-
-        byte[] bytes = fastaSequence.getSequence(chr, start, end, true);
-        String seq = new String(bytes);
-        assertEquals(expectedSequence, seq);
-    }
 
     @Test
     public void testReadEnd() throws Exception {
 
-        String path = "http://data.broadinstitute.org/igvdata/test/fasta/ci2_test.fa";
+        String path = "https://s3.amazonaws.com/igv.org.test/data/ci2_test.fa";
 
         String chr = "chr02q";
         int chrLen = 8059593;

diff --git a/src/test/java/org/broad/igv/tdf/TDFRegressionTests.java b/src/test/java/org/broad/igv/tdf/TDFRegressionTests.java
@@ -68,12 +68,6 @@ public void test_IGV1417() {
         assertEquals(1, reader.getVersion());
     }
 
-    @Test
-    public void test_v3() {
-        String tdfFile = "http://data.broadinstitute.org/igvdata/test/tdf/NA12878.pilot2.454.bam.tdf";
-        TDFReader reader = TDFReader.getReader(tdfFile);
-        assertEquals(3, reader.getVersion());
-    }
 
     String[] dm3posChromos = new String[]{"chr2RHet", "chr4", "chrU"};
     String[] dm3emptyChromos = new String[]{"chrUextra"};

diff --git a/src/test/java/org/broad/igv/util/IGVHttpClientUtilsTest.java b/src/test/java/org/broad/igv/util/IGVHttpClientUtilsTest.java
@@ -25,15 +25,9 @@
 
 package org.broad.igv.util;
 
-import org.broad.igv.exceptions.HttpResponseException;
-import org.broad.igv.prefs.Constants;
-import org.broad.igv.prefs.IGVPreferences;
-import org.broad.igv.prefs.PreferencesManager;
-import org.junit.Ignore;
 import org.junit.Test;
 
 import java.io.IOException;
-import java.net.URL;
 
 import static junit.framework.Assert.assertFalse;
 import static junit.framework.Assert.assertTrue;
@@ -46,20 +40,19 @@
 
 public class IGVHttpClientUtilsTest {
 
-    private static String hg18URL = "http://data.broadinstitute.org/igvdata/test/hg18.unittest.genome";
-    private static int hg18bytes = 3617644;
+    String url = "https://s3.amazonaws.com/igv.org.test/csi_test/chr10p.bam.csi";
+    int byteCount = 105063;
 
     @Test
     public void testGetContentLength() throws IOException {
 
-        String url = hg18URL;
-        assertEquals(hg18bytes, HttpUtils.getInstance().getContentLength(HttpUtils.createURL(url)));
+        assertEquals(byteCount, HttpUtils.getInstance().getContentLength(HttpUtils.createURL(url)));
     }
 
     @Test
     public void testExists() throws IOException {
-        String url = hg18URL;
-        assertTrue("Resource unexpectedly does not exist", HttpUtils.getInstance().resourceAvailable(hg18URL));
+
+        assertTrue("Resource unexpectedly does not exist", HttpUtils.getInstance().resourceAvailable(url));
 
         url = "http://nosuchserver/genomes/hg18.genome";
         assertFalse("Resource unexpectedly found", HttpUtils.getInstance().resourceAvailable(url));
@@ -68,46 +61,4 @@ public void testExists() throws IOException {
         assertFalse(HttpUtils.getInstance().resourceAvailable(url));
     }
 
-    /**
-     * This test will only work if on the Broad intranet, as that's where the test proxy server is.
-     *
-     * @throws IOException
-     */
-    @Ignore
-    @Test
-    public void testProxy() throws IOException {
-
-        final URL testURL = HttpUtils.createURL(hg18URL);
-
-        IGVPreferences mgr = PreferencesManager.getPreferences();
-        mgr.override(Constants.PROXY_HOST, "igvdev01.broadinstitute.org");
-        mgr.override(Constants.PROXY_PORT, "3128");
-        mgr.override(Constants.PROXY_USER, "proxytest");
-        String enc_pword = Utilities.base64Encode("test@123");
-        mgr.override(Constants.PROXY_PW, enc_pword);
-        mgr.override(Constants.USE_PROXY, "true");
-        mgr.override(Constants.PROXY_AUTHENTICATE, "true");
-        HttpUtils.getInstance().updateProxySettings();
-
-        long contentLength = 0;
-        try {
-            contentLength = HttpUtils.getInstance().getContentLength(testURL);
-            assertEquals(hg18bytes, contentLength);
-        } catch (IOException e) {
-            System.out.println("Proxy unreachable.  Skipping proxy test");
-            return;
-        }
-
-        // Now try to get a file not on the squid "allowed" domains to verify requests are going through the proxy
-        // This should fail and return -1 for the content length
-        try {
-            contentLength = HttpUtils.getInstance().getContentLength(HttpUtils.createURL("http://www.boston.com"));
-            junit.framework.Assert.fail("Proxy test is apparently bypassing proxy");
-        } catch (HttpResponseException e) {
-            // This is expected
-            assertEquals(403, e.getStatusCode());
-        }
-
-
-    }
 }
diff --git a/src/test/java/org/broad/igv/util/stream/IGVSeekableBufferedStreamTest.java b/src/test/java/org/broad/igv/util/stream/IGVSeekableBufferedStreamTest.java
@@ -50,7 +50,7 @@ public class IGVSeekableBufferedStreamTest extends AbstractHeadlessTest{
 
     //    private final File BAM_INDEX_FILE = new File("testdata/net/sf/samtools/BAMFileIndexTest/index_test.bam.bai");
     private final File BAM_FILE = new File(TestUtils.DATA_DIR + "/samtools/index_test.bam");
-    private final String BAM_URL_STRING = "http://data.broadinstitute.org/igvdata/test/data/bam/index_test.bam";
+    private final String BAM_URL_STRING = "https://s3.amazonaws.com/igv.org.test/data/index_test.bam";
     private static File megabyteZerosFile = new File(TestUtils.DATA_DIR + "/samtools/megabyteZeros.dat");
 
     static int expectedFileSize = 20000;