Adding pipeline nf-tests to nf-core/mag #550

CarsonJM · 2023-12-13T00:57:36Z

PR checklist

Release 2.4

Release: 2.5.0

Patch release 2.5.1

…nto pipeline-nf-tests

github-actions · 2023-12-13T00:59:51Z

`nf-core lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit 41c682a

+| ✅ 209 tests passed       |+
#| ❔   4 tests were ignored |#
!| ❗   4 tests had warnings |!

❗ Test warnings:

pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in WorkflowMag.groovy: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
schema_lint - Input mimetype is missing or empty

❔ Tests ignored:

nextflow_config - Config default ignored: params.phix_reference
nextflow_config - Config default ignored: params.lambda_reference
files_unchanged - File ignored due to lint config: lib/NfcoreTemplate.groovy
actions_ci - actions_ci

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .editorconfig
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/ci.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: lib/NfcoreTemplate.groovy
files_exist - File found: lib/Utils.groovy
files_exist - File found: lib/WorkflowMain.groovy
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: lib/WorkflowMag.groovy
files_exist - File found: modules.json
files_exist - File found: pyproject.toml
files_exist - File not found check: Singularity
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: params.validationShowHiddenParams
nextflow_config - Config variable found: params.validationSchemaIgnoreParams
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config manifest.version ends in dev: 2.5.5dev
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.max_cpus= 16
nextflow_config - Config default value correct: params.max_memory= 128.GB
nextflow_config - Config default value correct: params.max_time= 240.h
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.gtdb_db= https://data.ace.uq.edu.au/public/gtdb/data/releases/release214/214.1/auxillary_files/gtdbtk_r214_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1.0
nextflow_config - Config default value correct: params.gtdbtk_pplacer_scratch= true
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.binqc_tool= busco
nextflow_config - Config default value correct: params.checkm_download_url= https://data.ace.uq.edu.au/public/CheckM_databases/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
files_unchanged - pyproject.toml matches the template
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 23.04.0, Config: 23.04.0
readme - README Zenodo placeholder was replaced with DOI.
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (275 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: ci.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: fix-linting.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - 'assets/multiqc_config.yml' contains report_section_order
multiqc_config - 'assets/multiqc_config.yml' contains export_plots
multiqc_config - 'assets/multiqc_config.yml' contains report_comment
multiqc_config - 'assets/multiqc_config.yml' follows the ordering scheme of the minimally required plugins.
multiqc_config - 'assets/multiqc_config.yml' contains a matching 'report_comment'.
multiqc_config - 'assets/multiqc_config.yml' contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'

Run details

nf-core/tools version 2.12.1
Run at 2024-02-14 19:09:09

CarsonJM · 2024-01-17T22:43:41Z

@nf-core-bot fix linting

…f-tests

…-tests

…nto pipeline-nf-tests

…-tests

jfy133 and others added 15 commits September 26, 2023 10:59

Merge pull request nf-core#499 from nf-core/dev

18a1645

Release 2.4

Merge pull request nf-core#524 from nf-core/dev

ba72349

Release: 2.5.0

Merge pull request nf-core#541 from nf-core/dev

e728900

Patch release 2.5.1

Added ability to auto-create samplesheet for phageannotator

65034b5

Created tests for samplesheet creation

43491d8

Added nf-core-pipeline parameter to schema

e39111e

Changed input to samplesheet creation

69c684e

Conditional running of samplesheet creation

bd06532

Updated docs and added pipeline to output file name

a564425

Started structuring mag for nf-tests

11bc721

Moving config file params to nf-test files

f97ef32

virus identification test complete

53e58e1

Added test_adapterremoval tests

4dc19db

Merge branch 'pipeline-nf-tests' of https://github.com/CarsonJM/mag i…

848f4ef

…nto pipeline-nf-tests

Merge branch 'nf-core:master' into pipeline-nf-tests

d5ec5e4

CarsonJM changed the base branch from master to dev December 13, 2023 00:58

nf-core deleted a comment from github-actions bot Dec 13, 2023

CarsonJM added the WIP Work in progress label Dec 13, 2023

CarsonJM added 11 commits December 13, 2023 01:02

Updated CI to run nf-tests

8ecb7ed

Fixed test_nothing nf-test

490260b

Modified names and used collectFile()

647a197

Restructured workflows dir and added more nf-tests

ff096dc

Fixed linting and CI

155a152

Fixed CI part 2

857fb2d

Added ancient_dna test and reproducibility for binning

40b4ebf

Added and fixed nf-tests

2188e59

Updated CI tags

edb4a80

Fixed snapshots and linting

065c3a6

Fixed resource requests

6110f5f

CarsonJM and others added 5 commits January 17, 2024 10:36

Fixed CPU./mem requests

c5a0b86

Update genomad hash

bdaa7e6

Removed unecessary reproducibility options and updated schema

fafb1b2

Fixed linting

972ec92

Fixed CI yet again

f4c7633

nf-core-bot and others added 10 commits January 17, 2024 22:44

[automated] Fix linting with Prettier

2cadf7b

[automated] Fix linting with Prettier

332b7c7

Merge branch 'dev' of https://github.com/CarsonJM/mag into pipeline-n…

c15f253

…f-tests

Merge branch 'nf-core:dev' into dev

7509201

Merge branch 'dev' of https://github.com/CarsonJM/mag into pipeline-n…

3317f8f

…f-tests

Updated cat/cat and bin_summary

96c48cc

Started updating nf-test snapshots

bd07e3a

Merge branch 'dev' of https://github.com/nf-core/mag into pipeline-nf…

4a9e9e3

…-tests

Updated several workflow nf-tests after pipeline version update

a9c8c08

Added test.config to CI for mem req

61d86aa

CarsonJM self-assigned this Feb 9, 2024

CarsonJM added 12 commits February 12, 2024 09:04

Updated virus identification test

03e3631

Merge branch 'pipeline-nf-tests' of https://github.com/CarsonJM/mag i…

6f1bf11

…nto pipeline-nf-tests

Merge branch 'dev' of https://github.com/nf-core/mag into pipeline-nf…

95e770f

…-tests

Updated test config temporarily to test CI

4f3068b

Update virus_identification snap

1f4d36f

Include test_data for nf-tests

9ade6a3

Added nf-test config file

1bc4619

Fixed path to nf-test config

5561b5f

Added back config files and restructued nf-test config

1bdbc49

Added config file to each nf-test file

6080045

Renamed test configs and included profiles in nf-tests

e625dee

Removed local proxy code

41c682a

jfy133 marked this pull request as draft December 11, 2024 09:31

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Adding pipeline nf-tests to nf-core/mag #550

Adding pipeline nf-tests to nf-core/mag #550

CarsonJM commented Dec 13, 2023

github-actions bot commented Dec 13, 2023 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

CarsonJM commented Jan 17, 2024

Adding pipeline nf-tests to nf-core/mag #550

Are you sure you want to change the base?

Adding pipeline nf-tests to nf-core/mag #550

Conversation

CarsonJM commented Dec 13, 2023

PR checklist

github-actions bot commented Dec 13, 2023 • edited Loading

nf-core lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

CarsonJM commented Jan 17, 2024

github-actions bot commented Dec 13, 2023 •

edited

Loading

`nf-core lint` overall result: Passed ✅ ⚠️