3.3.1 release

[jfy133]

Just bug fixes:

Added

• #758 - Added new diagram in metro-map style (by @jfy133, @prototaxites, @d4straub)

Changed

• #731 - Updated to nf-core 3.1.2 TEMPLATE (by @jfy133)
• #755 - Updated to nf-core 3.2.0 TEMPLATE (by @jfy133)

Fixed

• #748 - Fix broken phix reference channel when skipping phix removal (reported by @amizeranschi, fix by @muabnezor)
• #752 - Fix QUAST results not being displayed when skipping certain steps (reported by @amizeranschi, fix by @jfy133)
• #753 - Fix iGenomes reference support for host removal reference genome (reported by @Thomieh73, fix by @jfy133)
• #759 - Fixed parameters that allow both files or directories to not error with directories, and general file input validation improvements (repoted by @mjfi2sb3, fix by @jfy133)

PR checklist

• This comment contains a description of changes (with reason).
• If you've fixed a bug or added code that should be tested, add tests!
• If you've added a new tool - have you followed the pipeline conventions in the contribution docs
• If necessary, also make a PR on the nf-core/mag branch on the nf-core/test-datasets repository.
• Make sure your code lints (nf-core pipelines lint).
• Ensure the test suite passes (nextflow run . -profile test,docker --outdir <OUTDIR>).
• Check for unexpected warnings in debug mode (nextflow run . -profile debug,test,docker --outdir <OUTDIR>).
• Usage Documentation in docs/usage.md is updated.
• Output Documentation in docs/output.md is updated.
• CHANGELOG.md is updated.
• README.md is updated (including new tool citations and authors/contributors).

[github-actions]

nf-core pipelines lint overall result: Passed ✅ ⚠️

Posted for pipeline commit 47542c7

+| ✅ 329 tests passed       |+
#| ❔   2 tests were ignored |#
!| ❗  52 tests had warnings |!

❗ Test warnings:

• pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
• pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
• pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
• pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!
• pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
• local_component_structure - busco_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - rename_predastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths_plot.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_db.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - split_fasta.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - combine_tsv.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - gtdbtk_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - busco.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - gtdbtk_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - kraken2.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_assembly_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - pool_single_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast_bins_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bin_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - krona.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_assembly_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_removal_build.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - kraken2_db_preparation.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - busco_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - pool_paired_reads.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - busco_save_download.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - rename_postdastool.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - bowtie2_removal_align.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - mag_depths_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - centrifuge.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_summary.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast_bins.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - convert_depths.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - nanolyse.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - cat_db_generate.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - adjust_maxbin2_ext.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - quast.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - tiara_classify.nf in modules/local should be moved to a TOOL/SUBTOOL/main.nf structure
• local_component_structure - ancient_dna.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - gtdbtk.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning_refinement.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - domain_classification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning_preparation.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - tiara.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - virus_identification.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - bin_qc.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - longread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - depths.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - binning.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure
• local_component_structure - shortread_preprocessing.nf in subworkflows/local should be moved to a SUBWORKFLOW_NAME/main.nf structure

❔ Tests ignored:

• nextflow_config - Config default ignored: params.phix_reference
• nextflow_config - Config default ignored: params.lambda_reference

✅ Tests passed:

• files_exist - File found: .gitattributes
• files_exist - File found: .gitignore
• files_exist - File found: .nf-core.yml
• files_exist - File found: .editorconfig
• files_exist - File found: .prettierignore
• files_exist - File found: .prettierrc.yml
• files_exist - File found: CHANGELOG.md
• files_exist - File found: CITATIONS.md
• files_exist - File found: CODE_OF_CONDUCT.md
• files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
• files_exist - File found: nextflow_schema.json
• files_exist - File found: nextflow.config
• files_exist - File found: README.md
• files_exist - File found: .github/.dockstore.yml
• files_exist - File found: .github/CONTRIBUTING.md
• files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
• files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
• files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
• files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
• files_exist - File found: .github/workflows/branch.yml
• files_exist - File found: .github/workflows/ci.yml
• files_exist - File found: .github/workflows/linting_comment.yml
• files_exist - File found: .github/workflows/linting.yml
• files_exist - File found: assets/email_template.html
• files_exist - File found: assets/email_template.txt
• files_exist - File found: assets/sendmail_template.txt
• files_exist - File found: assets/nf-core-mag_logo_light.png
• files_exist - File found: conf/modules.config
• files_exist - File found: conf/test.config
• files_exist - File found: conf/test_full.config
• files_exist - File found: docs/images/nf-core-mag_logo_light.png
• files_exist - File found: docs/images/nf-core-mag_logo_dark.png
• files_exist - File found: docs/output.md
• files_exist - File found: docs/README.md
• files_exist - File found: docs/README.md
• files_exist - File found: docs/usage.md
• files_exist - File found: main.nf
• files_exist - File found: assets/multiqc_config.yml
• files_exist - File found: conf/base.config
• files_exist - File found: conf/igenomes.config
• files_exist - File found: conf/igenomes_ignored.config
• files_exist - File found: .github/workflows/awstest.yml
• files_exist - File found: .github/workflows/awsfulltest.yml
• files_exist - File found: modules.json
• files_exist - File found: ro-crate-metadata.json
• files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
• files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
• files_exist - File not found check: .github/workflows/push_dockerhub.yml
• files_exist - File not found check: .markdownlint.yml
• files_exist - File not found check: .nf-core.yaml
• files_exist - File not found check: .yamllint.yml
• files_exist - File not found check: bin/markdown_to_html.r
• files_exist - File not found check: conf/aws.config
• files_exist - File not found check: docs/images/nf-core-mag_logo.png
• files_exist - File not found check: lib/Checks.groovy
• files_exist - File not found check: lib/Completion.groovy
• files_exist - File not found check: lib/NfcoreTemplate.groovy
• files_exist - File not found check: lib/Utils.groovy
• files_exist - File not found check: lib/Workflow.groovy
• files_exist - File not found check: lib/WorkflowMain.groovy
• files_exist - File not found check: lib/WorkflowMag.groovy
• files_exist - File not found check: parameters.settings.json
• files_exist - File not found check: pipeline_template.yml
• files_exist - File not found check: Singularity
• files_exist - File not found check: lib/nfcore_external_java_deps.jar
• files_exist - File not found check: .travis.yml
• nextflow_config - Found nf-schema plugin
• nextflow_config - Config variable found: manifest.name
• nextflow_config - Config variable found: manifest.nextflowVersion
• nextflow_config - Config variable found: manifest.description
• nextflow_config - Config variable found: manifest.version
• nextflow_config - Config variable found: manifest.homePage
• nextflow_config - Config variable found: timeline.enabled
• nextflow_config - Config variable found: trace.enabled
• nextflow_config - Config variable found: report.enabled
• nextflow_config - Config variable found: dag.enabled
• nextflow_config - Config variable found: process.cpus
• nextflow_config - Config variable found: process.memory
• nextflow_config - Config variable found: process.time
• nextflow_config - Config variable found: params.outdir
• nextflow_config - Config variable found: params.input
• nextflow_config - Config variable found: validation.help.enabled
• nextflow_config - Config variable found: manifest.mainScript
• nextflow_config - Config variable found: timeline.file
• nextflow_config - Config variable found: trace.file
• nextflow_config - Config variable found: report.file
• nextflow_config - Config variable found: dag.file
• nextflow_config - Config variable found: validation.help.beforeText
• nextflow_config - Config variable found: validation.help.afterText
• nextflow_config - Config variable found: validation.help.command
• nextflow_config - Config variable found: validation.summary.beforeText
• nextflow_config - Config variable found: validation.summary.afterText
• nextflow_config - Config variable (correctly) not found: params.nf_required_version
• nextflow_config - Config variable (correctly) not found: params.container
• nextflow_config - Config variable (correctly) not found: params.singleEnd
• nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
• nextflow_config - Config variable (correctly) not found: params.name
• nextflow_config - Config variable (correctly) not found: params.enable_conda
• nextflow_config - Config variable (correctly) not found: params.max_cpus
• nextflow_config - Config variable (correctly) not found: params.max_memory
• nextflow_config - Config variable (correctly) not found: params.max_time
• nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
• nextflow_config - Config variable (correctly) not found: params.validationLenientMode
• nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
• nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
• nextflow_config - Config timeline.enabled had correct value: true
• nextflow_config - Config report.enabled had correct value: true
• nextflow_config - Config trace.enabled had correct value: true
• nextflow_config - Config dag.enabled had correct value: true
• nextflow_config - Config manifest.name began with nf-core/
• nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
• nextflow_config - Config dag.file ended with .html
• nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
• nextflow_config - Config manifest.version does not contain dev for release: 3.3.1
• nextflow_config - Config params.custom_config_version is set to master
• nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
• nextflow_config - Lines for loading custom profiles found
• nextflow_config - nextflow.config contains configuration profile test
• nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
• nextflow_config - Config default value correct: params.custom_config_version= master
• nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
• nextflow_config - Config default value correct: params.publish_dir_mode= copy
• nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
• nextflow_config - Config default value correct: params.validate_params= true
• nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
• nextflow_config - Config default value correct: params.spades_fix_cpus= -1
• nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
• nextflow_config - Config default value correct: params.metabat_rng_seed= 1
• nextflow_config - Config default value correct: params.clip_tool= fastp
• nextflow_config - Config default value correct: params.reads_minlength= 15
• nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
• nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
• nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
• nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
• nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
• nextflow_config - Config default value correct: params.bbnorm_target= 100
• nextflow_config - Config default value correct: params.bbnorm_min= 5
• nextflow_config - Config default value correct: params.longreads_min_length= 1000
• nextflow_config - Config default value correct: params.longreads_keep_percent= 90
• nextflow_config - Config default value correct: params.longreads_length_weight= 10
• nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
• nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
• nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.ecogenomic.org/releases/release220/220.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r220_data.tar.gz
• nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
• nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
• nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
• nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
• nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
• nextflow_config - Config default value correct: params.genomad_min_score= 0.7
• nextflow_config - Config default value correct: params.genomad_splits= 1
• nextflow_config - Config default value correct: params.binning_map_mode= group
• nextflow_config - Config default value correct: params.min_contig_size= 1500
• nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
• nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
• nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
• nextflow_config - Config default value correct: params.tiara_min_length= 3000
• nextflow_config - Config default value correct: params.binqc_tool= busco
• nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
• nextflow_config - Config default value correct: params.checkm2_db_version= 5571251
• nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
• nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
• nextflow_config - Config default value correct: params.gunc_database_type= progenomes
• nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
• nextflow_config - Config default value correct: params.freebayes_ploidy= 1
• nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
• nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
• nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
• nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
• nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
• files_unchanged - .gitattributes matches the template
• files_unchanged - .prettierrc.yml matches the template
• files_unchanged - CODE_OF_CONDUCT.md matches the template
• files_unchanged - LICENSE matches the template
• files_unchanged - .github/.dockstore.yml matches the template
• files_unchanged - .github/CONTRIBUTING.md matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
• files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
• files_unchanged - .github/PULL_REQUEST_TEMPLATE.md matches the template
• files_unchanged - .github/workflows/branch.yml matches the template
• files_unchanged - .github/workflows/linting_comment.yml matches the template
• files_unchanged - .github/workflows/linting.yml matches the template
• files_unchanged - assets/email_template.html matches the template
• files_unchanged - assets/email_template.txt matches the template
• files_unchanged - assets/sendmail_template.txt matches the template
• files_unchanged - assets/nf-core-mag_logo_light.png matches the template
• files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
• files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
• files_unchanged - docs/README.md matches the template
• files_unchanged - .gitignore matches the template
• files_unchanged - .prettierignore matches the template
• actions_ci - '.github/workflows/ci.yml' is triggered on expected events
• actions_ci - '.github/workflows/ci.yml' checks minimum NF version
• actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
• actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
• actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
• readme - README Nextflow minimum version badge matched config. Badge: 24.04.2, Config: 24.04.2
• readme - README Zenodo placeholder was replaced with DOI.
• plugin_includes - No wrong validation plugin imports have been found
• pipeline_name_conventions - Name adheres to nf-core convention
• template_strings - Did not find any Jinja template strings (0 files)
• schema_lint - Schema lint passed
• schema_lint - Schema title + description lint passed
• schema_lint - Input mimetype lint passed: 'text/csv'
• schema_params - Schema matched params returned from nextflow config
• system_exit - No System.exit calls found
• actions_schema_validation - Workflow validation passed: branch.yml
• actions_schema_validation - Workflow validation passed: awsfulltest.yml
• actions_schema_validation - Workflow validation passed: download_pipeline.yml
• actions_schema_validation - Workflow validation passed: awstest.yml
• actions_schema_validation - Workflow validation passed: ci.yml
• actions_schema_validation - Workflow validation passed: template_version_comment.yml
• actions_schema_validation - Workflow validation passed: linting.yml
• actions_schema_validation - Workflow validation passed: linting_comment.yml
• actions_schema_validation - Workflow validation passed: clean-up.yml
• actions_schema_validation - Workflow validation passed: fix-linting.yml
• actions_schema_validation - Workflow validation passed: release-announcements.yml
• merge_markers - No merge markers found in pipeline files
• modules_json - Only installed modules found in modules.json
• multiqc_config - assets/multiqc_config.yml found and not ignored.
• multiqc_config - assets/multiqc_config.yml contains report_section_order
• multiqc_config - assets/multiqc_config.yml contains export_plots
• multiqc_config - assets/multiqc_config.yml contains report_comment
• multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
• multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
• multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
• modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
• base_config - conf/base.config found and not ignored.
• base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
• base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
• base_config - FILTLONG found in conf/base.config and Nextflow scripts.
• base_config - CENTRIFUGE_CENTRIFUGE found in conf/base.config and Nextflow scripts.
• base_config - KRAKEN2 found in conf/base.config and Nextflow scripts.
• base_config - KRONA_KTIMPORTTAXONOMY found in conf/base.config and Nextflow scripts.
• base_config - CAT_DB_GENERATE found in conf/base.config and Nextflow scripts.
• base_config - CAT found in conf/base.config and Nextflow scripts.
• base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
• base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
• base_config - SPADES found in conf/base.config and Nextflow scripts.
• base_config - SPADESHYBRID found in conf/base.config and Nextflow scripts.
• base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
• base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
• base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
• base_config - BUSCO found in conf/base.config and Nextflow scripts.
• base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
• base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
• base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
• modules_config - conf/modules.config found and not ignored.
• modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
• modules_config - FASTP found in conf/modules.config and Nextflow scripts.
• modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
• modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
• modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
• modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
• modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
• modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
• modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
• modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
• modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
• modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
• modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
• modules_config - CENTRIFUGE_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
• modules_config - CENTRIFUGE_KREPORT found in conf/modules.config and Nextflow scripts.
• modules_config - KRAKEN2 found in conf/modules.config and Nextflow scripts.
• modules_config - KREPORT2KRONA_CENTRIFUGE found in conf/modules.config and Nextflow scripts.
• modules_config - KRONA_KTIMPORTTAXONOMY found in conf/modules.config and Nextflow scripts.
• modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
• modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
• modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
• modules_config - QUAST found in conf/modules.config and Nextflow scripts.
• modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
• modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
• modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
• modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO_DB_PREPARATION found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO_SAVE_DOWNLOAD found in conf/modules.config and Nextflow scripts.
• modules_config - BUSCO_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - ARIA2_UNTAR found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
• modules_config - COMBINE_BINQC_TSV found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
• modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
• modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
• modules_config - CAT_DB_GENERATE found in conf/modules.config and Nextflow scripts.
• modules_config - CAT found in conf/modules.config and Nextflow scripts.
• modules_config - CAT_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
• modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
• modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
• modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
• modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
• modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
• modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
• modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
• modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS found in conf/modules.config and Nextflow scripts.
• modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
• modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
• modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
• modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
• modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_METABAT2 found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_MAXBIN2 found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_CONCOCT found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
• modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
• modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
• modules_config - TIARA_SUMMARY found in conf/modules.config and Nextflow scripts.
• modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
• modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
• modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
• nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
• nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.2.0
• version_consistency - Version tags are numeric and consistent between container, release tag and config.
• included_configs - Pipeline config includes custom configs.

Run details

• nf-core/tools version 3.2.0
• Run at 2025-02-10 08:37:24

[heuermh]

LGTM, nice work!

[erikrikarddaniel]

Looks all good to me!
A comment and a question:

• I could have commented earlier but as I see it now: The subway map gives me the impression that it's XOR between e.g. CheckM, Prokka and GTDB-Tk.
• I note that you added a comma after the last parameter to process calls -- are we supposed to do that now?

[jfy133]

Looks all good to me! A comment and a question:

* I could have commented earlier but as I see it now: The subway map gives me the impression that it's XOR between e.g. CheckM, Prokka and GTDB-Tk.

* I note that you added a comma after the last parameter to process calls -- are we supposed to do that now?

Thanks @erikrikarddaniel !

1. Could you explain why it gives you that imporession? I don't really see what you mean.
2. That's from the language server auto-formatter 🤷

[erikrikarddaniel]

Looks all good to me! A comment and a question:

* I could have commented earlier but as I see it now: The subway map gives me the impression that it's XOR between e.g. CheckM, Prokka and GTDB-Tk.

* I note that you added a comma after the last parameter to process calls -- are we supposed to do that now?

Thanks @erikrikarddaniel !

1. Could you explain why it gives you that imporession? I don't really see what you mean.

Because all those processes are shown as parallel paths. In other parts of the diagram there are places when one can skip a step indicated by a bubble to the step that can be skipped. It hence looks to me like one takes one path through those alternatives. But I'm certainly not an authority on this.

2. That's from the language server auto-formatter 🤷

I see, good to know.

[jfy133]

Looks all good to me! A comment and a question:

* I could have commented earlier but as I see it now: The subway map gives me the impression that it's XOR between e.g. CheckM, Prokka and GTDB-Tk.

* I note that you added a comma after the last parameter to process calls -- are we supposed to do that now?

Thanks @erikrikarddaniel !

1. Could you explain why it gives you that imporession? I don't really see what you mean.

Because all those processes are shown as parallel paths. In other parts of the diagram there are places when one can skip a step indicated by a bubble to the step that can be skipped. It hence looks to me like one takes one path through those alternatives. But I'm certainly not an authority on this.

2. That's from the language server auto-formatter 🤷

I see, good to know.

1. Hrmm I guess I can see what you mean now.... would making the 'bubble' lines dashed help?

[erikrikarddaniel]

[...]

1. Hrmm I guess I can see what you mean now.... would making the 'bubble' lines dashed help?

Not really, but I don't want you to waste too much time on this... My view of these diagrams is the "particle view" of quantum physics, not the "wave view", i.e. I can take one path through the diagram. I suppose you made it this way because these steps are executed in parallel though. But, no big deal!