This is a bioinformatics-related code kata designed for practicing test-driven development in tasks that involve data processing.
Write a program that can take a DNA sequence as input and, as output, show all the hypothetical protein sequences that could be translated from it.
Example:
- Input DNA Sequence: AGGACGGGCTAACTCCGCTCGTCACAAAGCGCAATGCAGCTATGGCAGATGTTCATGCCG
- Output Protein Sequence: MNICHSCIALCDERS
Below are the specifications in written form. For a diagram, see the picture dna_kata_explanation.png in this folder.
-
DNA sequences are sequences of A, T, C, and G nucleotides.
- Example DNA Sequence: ttatttgggcatcc
- Because DNA is double-stranded, for every dna sequence there is also the antisense sequence, which is the sequence reversed and changed in the following pattern: A->T, T->A, C->G, G->C
-
DNA is transcribed into RNA sequences, which contain A, U, C, and G nucleotides.
- DNA is read in reverse order.
- RNA transcription follows the following pattern: A->U, T->A, C->G, G->C.
- Example Transcription: TTATGCATC -> GAUGCAUAA
-
RNA is translated into a protein sequence by converting sets of 3 nucleotides (called a codon) into a single peptide.
- RNA is read in the forwards direction and can be started from the 1st, 2nd, or 3rd nucleotide.
- The table "codons.json" contains the relationships between RNA codons and the peptides produced.
- The first peptide in the protein sequence is always Met -- everything beforehand is ignored.
- The last peptide in the sequence is always the one before a "STOP" codon--everything afterward, including the first STOP, is ignored.
- If there is no "Met" to start the sequence and no "STOP" to end it, no protein sequence is created at all.
- Protein sequences are written as one-letter codes. The file "peptides.json" contains the relationship between the three- and one-letter codes.
- Example Translation from RNA: ggaugcccaaauaa -> [Met, Pro, Arg] == MPK
Try it out using this online tool and type in the following sequence: ttatttgggcatcc and press the "Translate" button, and look for the protein sequence highlighted in red.