trimming beyond adapter?

[RichardCorbett]

Hey There.
I've been using your tool quite a bit lately. It has been the best option for adapter trimming in my hands.

I've just been handed some illumina reads which are much longer than the insert, so I expect to see quite a lot of adapter.

I'm wondering if skewer will work if I can only provide the first 50 bases of the adapter sequence but the read contains more adapter sequence after what I provided. For example. my read is 200 bases, and there is only a 50 base insert which means I'll be getting an extra 150bp off the end of my insert. If I only know the first 50 bases of the adapter/primer sequencer, will the extra 100bp after my provided adapter sequence still be trimmed, or will no trimming occur?

thanks,
Richard

[ATpoint]

After a quick test with a dummy fastq file, with only the sequence:
ACCTTNTCCCAAGCAAATGGCAAACATAATAAAGGGTATAATCCCATAGGAGGAT
and ./skewer -x TGGCAAAC -l 1, I get
ACCTTNTCCCAAGCAAA.
So everything downstream of the adapter seems to be removed.