Why are there more untrimmed reads after decreasing error rate allowed?

[qslin]

Hi,

I run skewer twice with different maximum error ratio. The smaller error ratio leads to more untrimmed reads in output. Could you tell me the reason?

Here are the logs for these two trials:

-------------------------------------trial 1--------------------------------------------------
Parameters used:
-- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r): 0.100
-- maximum indel error ratio allowed (-d): 0.030
-- mean quality threshold (-Q): 20
-- end quality threshold (-q): 15
-- minimum read length allowed after trimming (-l): 18
-- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t): 2
Mon Feb 20 21:41:29 2017 >> started

Mon Feb 20 23:36:10 2017 >> done (6881.277s)
81581041 read pairs processed; of these:
12762 ( 0.02%) read pairs filtered out by quality control
141 ( 0.00%) short read pairs filtered out after trimming by size control
87 ( 0.00%) empty read pairs filtered out after trimming by size control
81568051 (99.98%) read pairs available; of these:
27177957 (33.32%) trimmed read pairs available after processing
54390094 (66.68%) untrimmed read pairs available after processing
------------------------------------trial 2------------------------------------------------

Parameters used:
-- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC
-- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA
-- maximum error ratio allowed (-r): 0.050
-- maximum indel error ratio allowed (-d): 0.010
-- mean quality threshold (-Q): 20
-- end quality threshold (-q): 15
-- minimum read length allowed after trimming (-l): 50
-- file format (-f): Sanger/Illumina 1.8+ FASTQ (auto detected)
-- number of concurrent threads (-t): 8
Mon Mar 6 18:48:16 2017 >> started

Mon Mar 6 20:53:57 2017 >> done (7540.909s)
81581041 read pairs processed; of these:
2225 ( 0.00%) degenerative read pairs filtered out
12762 ( 0.02%) read pairs filtered out by quality control
694 ( 0.00%) short read pairs filtered out after trimming by size control
30 ( 0.00%) empty read pairs filtered out after trimming by size control
81565330 (99.98%) read pairs available; of these:
27171075 (33.31%) trimmed read pairs available after processing
54394255 (66.69%) untrimmed read pairs available after processing