General information
Coronaviruses (CoVs) are important pathogens for human and vertebrates. They can infect respiratory, gastrointestinal, hepatic and central nervous system of human, livestock, birds, bat, mouse and many other wild animals. SARS (2002/2003) and MERS (2012) are examples of animal-to-human and human-to-human transmission of newly emerging CoVs.(Chen, Liu, & Guo, 2020)
An outbreak of mystery pneumonia has appeared in Wuhan since December 2019. The causative agent has been identified as a novel coronavirus, temporally named 2019-nCov by the WHO. 2019-nCoV is more similar to two bat-derived coronavirus strains, bat-SL-CoVZC45 and bat-SL-CoVZXC21, than to known human-infecting coronaviruses, including the virus that caused the SARS outbreak of 2003(Lu et al., 2020).
Based on phylogeny, taxonomy and established practice, the CSG (Coronaviridae Study group) recognizes this virus as forming a sister clade to the prototype human and bat severe acute respiratory syndrome coronaviruses (SARS-CoVs) of the species Severe acute respiratory syndrome-related coronavirus, and designates it as SARS-CoV-2(Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020)(Coronaviridae Study Group of the International Committee on Taxonomy of Viruses, 2020).
Coronaviruses belong to the subfamily Coronavirinae in the family of Coronaviridae of the order Nidovirales, and this subfamily includes four genera: Alphacoronavirus, Betacoronavirus, Gammacoronavirus, and Deltacoronavirus. The genome of CoVs is a single-stranded positive-sense RNA (+ssRNA) (~30kb) with 5’-cap structure and 3’-poly-A tail.
Images obtained from: (Chan et al., 2020)
(S.Fung & X. Liu, 2020)
The genomic RNA is used as template to directly translate polyprotein (pp) 1a/1ab, which encodes non-structural proteins (nsps 3,4 and 6) to form the replication-transcription complex (RTC) in a double-membrane vesicles (DMVs). The genome and subgenomes of a typical CoV contain at least 6 open reading frames (ORFs). The first ORFs (ORF1a/b), about two-third of the whole genome length. There is a -1 frameshift between ORF1a (11 proteins) and ORF1b (16 proteins) which allows the use of a ribosomal shifting, leading to production of two polypeptides: pp1a and pp1ab. These polypeptides are processed by virally encoded chymotrypsin-like protease (3CLpro) or main protease (Mpro) and one or two papain-like protease (PLPs). Other ORFs on the one-third of the genome near the 3’-terminus encodes at least four main structural proteins: spike (S), membrane (M), envelope (E), and nucleocapsid (N) proteins.
Besides these four main structural proteins, different CoVs encode special structural and accessory proteins, such as HE protein, 3a/b protein and 4a/b protein. This ORFs are translated in the RTCs in a discontinuous way, generating nested subgenomic RNA-es each of them with 5’leader and 3’ terminator sequences which will translate into the structural and accessory proteins.
Transmembrane structural proteins (S, M, and E) are synthesized, inserted, and folded in the endoplasmic reticulum (ER) and transported to the ER–Golgi intermediate compartment (ERGIC). The N proteins are translated in the cytoplasm and encapsulate the nascent progeny genomic RNA to form the nucleocapsids. Virion assembly occurs in the ERGIC and is likely to be orchestrated by the M protein through protein–protein interactions. The virions budded into the ERGIC are exported through secretory pathway in smooth-wall vesicles, which ultimately fuse with the plasma membrane and release the mature virus particles (Chan et al., 2020; Chen et al., 2020)
The specific tests currently recommended by WHO for the diagnosis and confirmation of SARS-CoV-2 are described on a dedicated WHO webpage. A single positive test should be confirmed by a second RT-PCR assay targeting a different SARS-CoV-2 gene. A single negative SARSCoV-2 test (especially if from an upper respiratory tract specimen) or a positive test result for another respiratory pathogen result does not exclude SARS-CoV-2 infection. A high RT-PCR cycle threshold value (e.g. > 35) obtained as a result in E-gene RT-PCR could be due to E-gene positive control contamination of reagents.
| Country | Institute | Gene targets |
|---|---|---|
| China | China CDC | ORF1ab and N |
| Germany | Charité | RdRP, E, N |
| Hong Kong SAR | HKU | ORF1b-nsp14, N |
| Japan | National Institute of Infectious Diseases, Department of Virology III | Pancorona and multiple targets, Spike protein |
| Thailand | National Institute of Health | N |
| US | US CDC | Three targets in N gene |
| France | Institut Pasteur, Paris | Two targets in RdRP |
ISCIII is using Corman et al RT-PCR protocol, but excluding RdRP polymerase.
| Assay/use | Oligonucleotide | Sequences | notes |
|---|---|---|---|
| RdRP gene | RdRp_SARSr-F | GTGARATGGTCATGTGTGGCGG | |
| RdRp_SARSr-P2 | FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ | Specific for 2019-nCoV, will not detect SARS-CoV. | |
| RdRP_SARSr-P1 | FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ | Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs. | |
| RdRp_SARSr-R | CARATGTTAAASACACTATTAGCATA | ||
| E gene | E_Sarbeco_F | ACAGGTACGTTAATAGTTAATAGCGT | |
| E_Sarbeco_P1 | FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ | ||
| E_Sarbeco_R | ATATTGCAGCAGTACGCACACA | ||
| N gene | N_Sarbeco_F | CACATTGGCACCCGCAATC | |
| N_Sarbeco_P | FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ | ||
| N_Sarbeco_R | GAGGAACGAGAAGAGGCTTG |