implment logic to separate RnaChemistry::Other() and CustomChemistry.

resources/chemistries.json

@@ -60,7 +60,7 @@
     }
   },
   "10xv2": {
-    "geometry": "__builtin",
+    "geometry": "1{b[16]u[10]x:}2{r:}",
     "expected_ori": "fw",
     "plist_name": "dda0309f511ded5d801081a55c66b9a44cab4edbf0e07a9223f539e248d8e090",
     "version": "0.1.0",
@@ -80,7 +80,7 @@
     "remote_url": "https://umd.box.com/shared/static/jbs2wszgbj7k4ic2hass9ts6nhqkwq1p"
   },
   "10xv3": {
-    "geometry": "__builtin",
+    "geometry": "1{b[16]u[12]x:}2{r:}",
     "expected_ori": "fw",
     "plist_name": "2c9dfb98babe5a57ae763778adb9ebb7bfa531e105823bc26163892089333f8c",
     "version": "0.1.0",
@@ -100,7 +100,7 @@
     "remote_url": "https://umd.box.com/shared/static/cbpv1c4zi6ty81nvcgy3pyta2oj7vea1.txt"
   },
   "10xv4-3p": {
-    "geometry": "__builtin",
+    "geometry": "1{b[16]u[12]x:}2{r:}",
     "expected_ori": "fw",
     "plist_name": "0bfa4a0bea1d636e7ec1908aabb94307c53778185c12fc164da32dd085848131",
     "version": "0.1.0",
@@ -138,5 +138,47 @@
     "meta": {
       "cr_filename": "737K-arc-v1.txt"
     }
+  },
+  "dropseq": {
+    "geometry": "1{b[12]u[8]x:}2{r:}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
+  },
+  "indropv2": {
+    "geometry": "1{r:}2{b[8-11]f[GAGTGATTGCTTGTGACGCCTT]b[8]u[6]x:}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
+  },
+  "celseq2": {
+    "geometry": "1{u[6]b[6]x:}2{r:}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
+  },
+  "splitseqv1": {
+    "geometry": "1{r[66]}2{u[10]b[8]f[CACCGGCTACAAAGCGTAGCCGCATGCTGA]b[8]f[TAGGTGCACGAACTCTCCGGTCTCGTAAGC]b[8]}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
+  },
+  "splitseqv2": {
+    "geometry": "1{r[66]}2{u[10]b[8]f[CACCGGCTACAAAGCGTAGCCGCATGCTGA]b[8]f[TAGGTGCACGAACTCTGACACC]b[8]}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
+  },
+  "sciseq3": {
+    "geometry": "1{b[9-10]f[GTCTCG]u[8][10]x:}2{r:}",
+    "expected_ori": "fw",
+    "plist_name": null,
+    "remote_url": null,
+    "version": "0.1.0"
   }
 }

src/simpleaf_commands.rs

@@ -479,7 +479,7 @@ pub struct ChemistryAddOpts {
     /// the geometry to which the chemistry maps, wrapped in quotes.
     #[arg(short, long)]
     pub geometry: String,
-    /// the expected orientation to give to the chemistry
+    /// the expected orientation indicating the direction of biological reads to reference sequences.
     #[arg(short, long, value_parser = clap::builder::PossibleValuesParser::new(["fw", "rc", "both"]))]
     pub expected_ori: String,
     /// the (fully-qualified) path to a local file that will be copied into
@@ -497,7 +497,7 @@ pub struct ChemistryAddOpts {
     /// optionally assign a version number to this chemistry. A chemistry's
     /// entry can be updated in the future by adding it again with a higher
     /// version number.
-    #[arg(long)]
+    #[arg(long, default_value = "0.0.0")]
     pub version: Option<String>,
 }
 

src/simpleaf_commands/chemistry.rs

@@ -1,6 +1,6 @@
 use crate::utils::af_utils::*;
 use crate::utils::chem_utils::{
-    custom_chem_hm_to_json, get_custom_chem_hm, get_single_custom_chem_from_file, CustomChemistry,
+    custom_chem_hm_into_json, get_custom_chem_hm, get_single_custom_chem_from_file, CustomChemistry,
 };
 use crate::utils::constants::*;
 use crate::utils::prog_utils::{self, download_to_file_compute_hash};
@@ -56,11 +56,8 @@ pub fn add_chemistry(
     let chem_p = af_home_path.join(CHEMISTRIES_PATH);
 
     if let Some(existing_entry) = get_single_custom_chem_from_file(&chem_p, &name)? {
-        let existing_ver_str = existing_entry
-            .version()
-            .clone()
-            .unwrap_or("0.0.0".to_string());
-        let existing_ver = Version::parse(existing_ver_str.as_ref()).with_context( || format!("could not parse version {} found in existing chemistries.json file. Please correct this entry", existing_ver_str))?;
+        let existing_ver_str = existing_entry.version();
+        let existing_ver = Version::parse(existing_ver_str).with_context( || format!("could not parse version {} found in existing chemistries.json file. Please correct this entry", existing_ver_str))?;
         if add_ver <= existing_ver {
             info!("Attempting to add chemistry with version {:#} which is <= than the existing version ({:#}) for this chemistry. Skipping addition", add_ver, existing_ver);
             return Ok(());
@@ -155,10 +152,10 @@ pub fn add_chemistry(
     let custom_chem = CustomChemistry {
         name,
         geometry,
-        expected_ori: Some(ExpectedOri::from_str(&add_opts.expected_ori)?),
+        expected_ori: ExpectedOri::from_str(&add_opts.expected_ori)?,
         plist_name: local_plist,
         remote_pl_url: add_opts.remote_url,
-        version: Some(version),
+        version,
         meta: None,
     };
 
@@ -180,7 +177,7 @@ pub fn add_chemistry(
     }
 
     // convert the custom chemistry hashmap to json
-    let v = custom_chem_hm_to_json(&chem_hm)?;
+    let v = custom_chem_hm_into_json(chem_hm)?;
 
     // write out the new custom chemistry file
     let mut custom_chem_file = std::fs::File::create(&chem_p)
@@ -385,7 +382,7 @@ pub fn remove_chemistry(
         chem_hm.remove(&name);
 
         // convert the custom chemistry hashmap to json
-        let v = custom_chem_hm_to_json(&chem_hm)?;
+        let v = custom_chem_hm_into_json(chem_hm)?;
 
         // write out the new custom chemistry file
         let mut custom_chem_file = std::fs::File::create(&chem_p)

src/simpleaf_commands/inspect.rs

@@ -2,7 +2,7 @@ use crate::atac::commands::AtacChemistry;
 use crate::utils::constants::CHEMISTRIES_PATH;
 use crate::utils::{
     af_utils::RnaChemistry,
-    chem_utils::{custom_chem_hm_to_json, get_custom_chem_hm},
+    chem_utils::{custom_chem_hm_into_json, get_custom_chem_hm},
     prog_utils::*,
 };
 use anyhow::Result;
@@ -19,7 +19,7 @@ pub fn inspect_simpleaf(version: &str, af_home_path: PathBuf) -> Result<()> {
     let chem_info_value = if custom_chem_p.is_file() {
         // parse the chemistry json file
         let custom_chem_hm = get_custom_chem_hm(&custom_chem_p)?;
-        let v = custom_chem_hm_to_json(&custom_chem_hm)?;
+        let v = custom_chem_hm_into_json(custom_chem_hm)?;
         json!({
             "custom_chem_path" : custom_chem_p.display().to_string(),
             "custom_geometries" : v

src/simpleaf_commands/quant.rs

@@ -1,4 +1,4 @@
-use crate::utils::{af_utils::*, chem_utils::*};
+use crate::utils::af_utils::*;
 
 use crate::utils::prog_utils;
 use crate::utils::prog_utils::{CommandVerbosityLevel, ReqProgs};
@@ -179,12 +179,6 @@ impl CBListInfo {
     }
 }
 
-enum IndexType {
-    Salmon(PathBuf),
-    Piscem(PathBuf),
-    NoIndex,
-}
-
 fn push_advanced_piscem_options(
     piscem_quant_cmd: &mut std::process::Command,
     opts: &MapQuantOpts,
@@ -387,79 +381,21 @@ pub fn map_and_quant(af_home_path: &Path, opts: MapQuantOpts) -> anyhow::Result<
     // the chemistries file
     let custom_chem_p = af_home_path.join(CHEMISTRIES_PATH);
 
-    let chem = match opts.chemistry.as_str() {
-        "10xv2" => Chemistry::Rna(RnaChemistry::TenxV2),
-        "10xv2-5p" => Chemistry::Rna(RnaChemistry::TenxV25P),
-        "10xv3" => Chemistry::Rna(RnaChemistry::TenxV3),
-        "10xv3-5p" => Chemistry::Rna(RnaChemistry::TenxV35P),
-        "10xv4-3p" => Chemistry::Rna(RnaChemistry::TenxV43P),
-        s => {
-            // we try to extract the single record for the chemistry and ignore the rest
-            if let Some(chem) =
-                get_single_custom_chem_from_file(&custom_chem_p, opts.chemistry.as_str())?
-            {
-                info!(
-                    "custom chemistry {} maps to geometry {}",
-                    s,
-                    chem.geometry()
-                );
-                Chemistry::Custom(chem)
-            } else {
-                Chemistry::Custom(CustomChemistry::simple_custom(s).with_context(|| {
-                    format!(
-                        "Could not parse the provided chemistry {}. Please ensure it is a valid chemistry string wrapped by quotes or that it is defined in the custom_chemistries.json file.",
-                        s
-                    )
-                })?)
-            }
-        }
-    };
+    let chem = Chemistry::from_str(&index_type, &custom_chem_p, &opts.chemistry)?;
 
     let ori: ExpectedOri;
     // if the user set the orientation, then
     // use that explicitly
-    if let Some(o) = opts.expected_ori.clone() {
-        ori = ExpectedOri::from_str(&o).with_context(|| {
+    if let Some(o) = &opts.expected_ori {
+        ori = ExpectedOri::from_str(o).with_context(|| {
             format!(
                 "Could not parse orientation {}. It must be one of the following: {:?}",
                 o,
                 ExpectedOri::all_to_str().join(", ")
             )
         })?;
     } else {
-        // otherwise, this was not set explicitly. In that case
-        // if we have 10xv2, 10xv3, or 10xv4 (3') chemistry, set ori = "fw"
-        // if we have 10xv2-5p or 10xv3-5p chemistry, set ori = "fw"
-        // otherwise set ori = "both"
-        match &chem {
-            Chemistry::Rna(RnaChemistry::TenxV2)
-            | Chemistry::Rna(RnaChemistry::TenxV3)
-            | Chemistry::Rna(RnaChemistry::TenxV43P) => {
-                ori = ExpectedOri::Forward;
-            }
-            Chemistry::Rna(RnaChemistry::TenxV25P) | Chemistry::Rna(RnaChemistry::TenxV35P) => {
-                // NOTE: This is because we assume the piscem encoding
-                // that is, these are treated as potentially paired-end protocols and
-                // we infer the orientation of the fragment = orientation of read 1.
-                // So, while the direction we want is the same as the 3' protocols
-                // above, we separate out the case statement here for clarity.
-                // Further, we may consider changing this or making it more robust if
-                // and when we propagate more information about paired-end mappings.
-                ori = ExpectedOri::Forward;
-            }
-            Chemistry::Rna(RnaChemistry::Other(_)) => ori = ExpectedOri::default(),
-            Chemistry::Custom(cc) => {
-                // if the custom chemistry has an orientation, use that
-                if let Some(o) = cc.expected_ori() {
-                    ori = o.clone();
-                } else {
-                    ori = ExpectedOri::default();
-                }
-            }
-            _ => {
-                bail!("Encountered non-RNA chemistry in simpleaf quant. This should not happen. Please report this to simpleaf GitHub issues.");
-            }
-        }
+        ori = chem.expected_ori();
     }
 
     let mut filter_meth_opt = None;