[ADAM-646] Special case reads with '*' quality during BQSR. #647
Conversation
|
This looks good, but should we just set |
|
Are you suggesting to do that check in the SAM/BAM<->ADAM converters? |
|
Test FAILed. Build result: FAILUREGitHub pull request #647 of commit f6ce721 automatically merged.Notifying endpoint 'HTTP:https://webhooks.gitter.im/e/ac8bb6e9f53357bc8aa8'[EnvInject] - Loading node environment variables.Building remotely on amp-jenkins-worker-05 (centos) in workspace /home/jenkins/workspace/ADAM-prb > git rev-parse --is-inside-work-tree # timeout=10Fetching changes from the remote Git repository > git config remote.origin.url https://github.com/bigdatagenomics/adam.git # timeout=10Fetching upstream changes from https://github.com/bigdatagenomics/adam.git > git --version # timeout=10 > git fetch --tags --progress https://github.com/bigdatagenomics/adam.git +refs/pull/:refs/remotes/origin/pr/ > git rev-parse origin/pr/647/merge^{commit} # timeout=10 > git branch -a --contains d7e55c115cfc9f4de7289144d2506ea006bf3237 # timeout=10 > git rev-parse remotes/origin/pr/647/merge^{commit} # timeout=10Checking out Revision d7e55c115cfc9f4de7289144d2506ea006bf3237 (origin/pr/647/merge) > git config core.sparsecheckout # timeout=10 > git checkout -f d7e55c115cfc9f4de7289144d2506ea006bf3237First time build. Skipping changelog.Triggering ADAM-prb ? 2.2.0,centosTriggering ADAM-prb ? 2.3.0,centosTriggering ADAM-prb ? 1.0.4,centosADAM-prb ? 2.2.0,centos completed with result SUCCESSADAM-prb ? 2.3.0,centos completed with result FAILUREADAM-prb ? 1.0.4,centos completed with result SUCCESSNotifying endpoint 'HTTP:https://webhooks.gitter.im/e/ac8bb6e9f53357bc8aa8'Test FAILed. |
|
Yes, when we convert from BAM to ADAM, set simply set the |
|
That's a good idea. Let me refactor that. |
fnothaft
force-pushed
the
allow-asterisk-bqsr
branch
from
f6ce721
to
608d5f7
Compare
|
Updated with the |
|
Test FAILed. Build result: FAILUREGitHub pull request #647 of commit 608d5f7 automatically merged.Notifying endpoint 'HTTP:https://webhooks.gitter.im/e/ac8bb6e9f53357bc8aa8'[EnvInject] - Loading node environment variables.Building remotely on amp-jenkins-worker-05 (centos) in workspace /home/jenkins/workspace/ADAM-prb > git rev-parse --is-inside-work-tree # timeout=10Fetching changes from the remote Git repository > git config remote.origin.url https://github.com/bigdatagenomics/adam.git # timeout=10Fetching upstream changes from https://github.com/bigdatagenomics/adam.git > git --version # timeout=10 > git fetch --tags --progress https://github.com/bigdatagenomics/adam.git +refs/pull/:refs/remotes/origin/pr/ > git rev-parse origin/pr/647/merge^{commit} # timeout=10 > git branch -a --contains 356a6d6711a5a558e7df6c94cd0b427d82a69d58 # timeout=10 > git rev-parse remotes/origin/pr/647/merge^{commit} # timeout=10Checking out Revision 356a6d6711a5a558e7df6c94cd0b427d82a69d58 (origin/pr/647/merge) > git config core.sparsecheckout # timeout=10 > git checkout -f 356a6d6711a5a558e7df6c94cd0b427d82a69d58First time build. Skipping changelog.Triggering ADAM-prb ? 2.2.0,centosTriggering ADAM-prb ? 2.3.0,centosTriggering ADAM-prb ? 1.0.4,centosADAM-prb ? 2.2.0,centos completed with result SUCCESSADAM-prb ? 2.3.0,centos completed with result FAILUREADAM-prb ? 1.0.4,centos completed with result SUCCESSNotifying endpoint 'HTTP:https://webhooks.gitter.im/e/ac8bb6e9f53357bc8aa8'Test FAILed. |
|
Jenkins, retest this please. Looks like some issue with a JAR not being pulled down in the Hadoop 2.2 build. |
| @@ -79,7 +79,7 @@ class AlignmentRecordConverter extends Serializable { | |||
| // set canonically necessary fields | |||
| builder.setReadName(adamRecord.getReadName.toString) | |||
| builder.setReadString(adamRecord.getSequence) | |||
| builder.setBaseQualityString(adamRecord.getQual) | |||
| Option(adamRecord.getQual).fold(builder.setBaseQualityString("*"))(s => builder.setBaseQualityString(s)) | |||
There was a problem hiding this comment.
Simple pattern matching here would prevent double-setting the qualityString (unless I'm misreading this) and prevent allocating objects we won't use.
|
Other than one nit, this looks good to me. |
fnothaft
force-pushed
the
allow-asterisk-bqsr
branch
from
608d5f7
to
4e30187
Compare
|
Test PASSed. |
[ADAM-646] Special case reads with '*' quality during BQSR.
|
Thanks, Frank! |
|
Thanks, Frank! |
|
Great! Glad to hear it @Jaeki! |
|
@fnothaft Could you check the followin case? 15/04/11 12:35:38 INFO DAGScheduler: Job 1 failed: aggregate at BaseQualityRecalibration.scala:84, took 3.648340 s |
|
The exact line of the error is shown in this stack trace. Your sequence is 102 bases long... $ echo "AAATGGAACGAAGTGGAATCGAGTGGAATGGAATCGAATGGAGTGAAATGGAATGGAATGGACGCGAAAGAATGGACTGGAACAAAATGAAATCGAACGGT" | wc -c
102... but the difference between your reference start and end position is The sequence is missing 3 bases. |
|
@massie Thank you for your comment. Do you think the missing 3 bases come from the SNAP tool ? I downloaded the NA12878 reads from web and aligned with SNAP, transformed the sam file to adam and then BQSR with ADAM. That's what I did. |
Resolves #646. Allows the creation of
DecadentReads with*quality scores. These reads are then not observed or corrected during BQSR.