Refactor of VariantLookup and related code #115
Conversation
![coderabbitai[bot]](https://avatars.githubusercontent.com/in/347564?s=60&v=4){kind=small}
There was a problem hiding this comment.
Actionable comments posted: 11
🔭 Outside diff range comments (1)
prymer/api/coordmath.py (1)
Line range hint
6-25: Add input validation.Length should be non-negative.
def get_closed_end(start: int, length: int) -> int: + if length < 0: + raise ValueError("Length must be non-negative") return start + length - 1
🧹 Nitpick comments (13)
tests/primer3/test_primer3_input_tag.py (1)
4-11: Test looks good but add docstring.Test validates new properties correctly. Add docstring to explain test purpose.
def test_primer3_input_tag() -> None: + """Verify Primer3InputTag properties for sequence and global arguments.""" for tag in Primer3InputTag:prymer/primer3/primer3_input_tag.py (1)
32-33: Make developer note more visible.Important ordering requirement. Move to class docstring.
- # Developer note: sequence-specific tags must be specified prior to global tags + """ + Enumeration of Primer3 input tags. + + Please see the Primer3 manual for additional details: + https://primer3.org/manual.html#commandLineTags + + This class represents two categories of Primer3 input tags: + * `SEQUENCE_` tags are those that control sequence-specific attributes of Primer3 jobs. + These can be modified after each query submitted to Primer3. + Note: These tags must be specified prior to global tags. + * `PRIMER_` tags are those that describe more general parameters of Primer3 jobs. + These attributes persist across queries to Primer3 unless they are explicitly reset. + Errors in these "global" input tags are fatal. + """prymer/thermo.py (1)
51-56: Clarify constant names to distinguish Tm methods and salt correction methods.The constants
TM_METHOD_SANTALUCIAandSALT_CORRECTION_METHOD_SANTALUCIAboth have the value"santalucia". To avoid confusion, consider making the constant names more explicit or namespacing them to clearly differentiate between Tm methods and salt correction methods.prymer/model.py (1)
95-335: Implement rich comparison methods forSpan.Adding
__lt__,__eq__, and other comparison methods to theSpanclass would allow instances to be compared using standard operators, enhancing readability and usability.prymer/__init__.py (1)
1-7: Group related imports.Organize imports by module.
-from prymer.model import MinOptMax -from prymer.model import Oligo -from prymer.model import PrimerPair -from prymer.model import Span -from prymer.model import Strand +from prymer.model import ( + MinOptMax, + Oligo, + PrimerPair, + Span, + Strand, +) from prymer.thermo import Thermo from prymer.variant import VariantLookuptests/conftest.py (1)
31-38: Improve seq_dict fixture.Add docstring and parameterize values.
@pytest.fixture def seq_dict() -> SequenceDictionary: + """Provides a SequenceDictionary with three chromosomes for testing.""" + chr_length = 1_000_000 metadatas: list[SequenceMetadata] = [ - SequenceMetadata(name="chr1", length=1000000, index=0), - SequenceMetadata(name="chr2", length=1000000, index=1), - SequenceMetadata(name="chr3", length=1000000, index=2), + SequenceMetadata(name=f"chr{i}", length=chr_length, index=i) + for i in range(1, 4) ] return SequenceDictionary(metadatas)tests/test_thermo.py (3)
33-36: Parametrize hairpin tests.Add multiple known hairpin structures with their expected Tm ranges.
-def test_hairpin_tm() -> None: - thermo = Thermo() - tm = thermo.hairpin_tm("CCCTTTTTAAAGGG") - assert 50 < tm < 70 +@pytest.mark.parametrize("sequence,min_tm,max_tm", [ + ("CCCTTTTTAAAGGG", 50, 70), + ("GCGCTTTTGCGC", 45, 65), + ("ATCGATTTCGAT", 40, 60), +]) +def test_hairpin_tm(sequence: str, min_tm: float, max_tm: float) -> None: + thermo = Thermo() + tm = thermo.hairpin_tm(sequence) + assert min_tm < tm < max_tm
39-45: Add docstring.Document test purpose and expectations.
def test_homodimer_tm() -> None: + """Test homodimer Tm calculation. + + Tests: + 1. Sequence that cannot form homodimer (poly-A) + 2. Sequence that forms perfect homodimer (A10T10) + """ thermo = Thermo()
48-73: Combine heterodimer tests.Merge related heterodimer tests for better organization.
-def test_heterodimer_tm() -> None: - thermo = Thermo() - tm1 = thermo.heterodimer_tm("AAAAAAAAAA", "CCCCCCCCCC") - tm2 = thermo.heterodimer_tm("AAAAAAAAAA", "TTTTTTTTTT") - - assert tm1 == 0 - assert tm2 > 0 - -def test_heterodimer_3p_anchored_tm() -> None: - thermo = Thermo() - tm1 = thermo.heterodimer_3p_anchored_tm("AAAAAAAAAA", "CCCCCCCCCC") - tm2 = thermo.heterodimer_3p_anchored_tm("AAAAAAAAAA", "TTTTTTTTTT") - - assert tm1 == 0 - assert tm2 > 0 +@pytest.mark.parametrize("method,seq1,seq2,expected_tm", [ + ("heterodimer_tm", "AAAAAAAAAA", "CCCCCCCCCC", 0), + ("heterodimer_tm", "AAAAAAAAAA", "TTTTTTTTTT", 1), + ("heterodimer_3p_anchored_tm", "AAAAAAAAAA", "CCCCCCCCCC", 0), + ("heterodimer_3p_anchored_tm", "AAAAAAAAAA", "TTTTTTTTTT", 1), +]) +def test_heterodimer_calculations(method: str, seq1: str, seq2: str, expected_tm: int) -> None: + """Test both regular and 3' anchored heterodimer Tm calculations.""" + thermo = Thermo() + tm = getattr(thermo, method)(seq1, seq2) + if expected_tm == 0: + assert tm == 0 + else: + assert tm > 0tests/model/test_span.py (1)
Line range hint
8-18: Add edge cases for invalid spans.Test missing edge cases:
- Empty string refname
- Negative coordinates
- Maximum coordinate values
[ ("chr1", 0, 10, "+"), # start < 1 ("chr1", 30, 20, "-"), # start > end (" ", 0, 10, "+"), # empty refname + ("", 1, 10, "+"), # empty string refname + ("chr1", -1, 10, "+"), # negative start + ("chr1", 1, -10, "+"), # negative end + ("chr1", 2**31-1, 2**31, "+"), # max int coords ],tests/test_variant.py (1)
156-161: Use constants for test data.Move test sequences to constants for better maintainability.
+ # Constants for test sequences + TEST_SEQUENCE = "ACGCTCGATCACCGGACTGAATGACTGACTAACTGATGCTGCGTGTCTGATGATGCTGCT" + EXPECTED_SOFT_MASKED = "aCGCTCGATCAccgGACTGAatGACTGACTaaCTGATGCTGCGTGTCTGATGATGCTGCT" + EXPECTED_HARD_MASKED = "NCGCTCGATCANNNGACTGANNGACTGACTNNCTGATGCTGCGTGTCTGATGATGCTGCT" - bases_fresh = "ACGCTCGATCACCGGACTGAATGACTGACTAACTGATGCTGCGTGTCTGATGATGCTGCT" - soft_masked = "aCGCTCGATCAccgGACTGAatGACTGACTaaCTGATGCTGCGTGTCTGATGATGCTGCT" - hard_masked = "NCGCTCGATCANNNGACTGANNGACTGACTNNCTGATGCTGCGTGTCTGATGATGCTGCT" + bases_fresh = TEST_SEQUENCE + soft_masked = EXPECTED_SOFT_MASKED + hard_masked = EXPECTED_HARD_MASKEDprymer/api/picking.py (1)
212-214: Consider caching the heterodimer calculation.The heterodimer calculation is potentially expensive and called in a loop.
+ # Cache heterodimer calculations + if max_heterodimer_tm is not None: + heterodimer_cache = {} + for i, j, penalty, tm in pairings: lp = left_primers[i] rp = right_primers[j] if max_heterodimer_tm is not None: - if thermo.heterodimer_tm(lp.bases, rp.bases) > max_heterodimer_tm: + pair_key = (lp.bases, rp.bases) + if pair_key not in heterodimer_cache: + heterodimer_cache[pair_key] = thermo.heterodimer_tm(lp.bases, rp.bases) + if heterodimer_cache[pair_key] > max_heterodimer_tm: continue.github/workflows/tests.yml (1)
60-63: Track documentation build re-enablement.Temporarily disabled documentation build needs tracking.
Would you like me to create an issue to track re-enabling the documentation build after refactoring?
📜 Review details
Configuration used: CodeRabbit UI
Review profile: CHILL
Plan: Pro
⛔ Files ignored due to path filters (2)
poetry.lockis excluded by!**/*.locktests/primer3/data/miniref.variants.vcf.gzis excluded by!**/*.gz
📒 Files selected for processing (48)
.github/workflows/tests.yml(2 hunks).github/workflows/wheels.yml(1 hunks)prymer/__init__.py(1 hunks)prymer/api/__init__.py(0 hunks)prymer/api/clustering.py(0 hunks)prymer/api/coordmath.py(2 hunks)prymer/api/melting.py(0 hunks)prymer/api/minoptmax.py(0 hunks)prymer/api/oligo.py(0 hunks)prymer/api/oligo_like.py(0 hunks)prymer/api/picking.py(7 hunks)prymer/api/primer.py(0 hunks)prymer/api/primer_pair.py(0 hunks)prymer/api/span.py(0 hunks)prymer/api/variant_lookup.py(0 hunks)prymer/model.py(1 hunks)prymer/ntthal/__init__.py(0 hunks)prymer/offtarget/offtarget_detector.py(2 hunks)prymer/primer3/primer3.py(17 hunks)prymer/primer3/primer3_input.py(3 hunks)prymer/primer3/primer3_input_tag.py(1 hunks)prymer/primer3/primer3_parameters.py(1 hunks)prymer/primer3/primer3_task.py(2 hunks)prymer/primer3/primer3_weights.py(1 hunks)prymer/thermo.py(1 hunks)prymer/variant.py(1 hunks)pyproject.toml(4 hunks)tests/api/conftest.py(0 hunks)tests/api/test_clustering.py(0 hunks)tests/api/test_coordmath.py(1 hunks)tests/api/test_melting.py(0 hunks)tests/api/test_oligo_like.py(0 hunks)tests/api/test_picking.py(4 hunks)tests/api/test_variant_lookup.py(0 hunks)tests/conftest.py(2 hunks)tests/model/test_minoptmax.py(1 hunks)tests/model/test_oligo.py(9 hunks)tests/model/test_primer_pair.py(2 hunks)tests/model/test_span.py(1 hunks)tests/ntthal/test_ntthal.py(0 hunks)tests/offtarget/test_offtarget.py(1 hunks)tests/primer3/test_primer3.py(11 hunks)tests/primer3/test_primer3_input.py(1 hunks)tests/primer3/test_primer3_input_tag.py(1 hunks)tests/primer3/test_primer3_parameters.py(1 hunks)tests/primer3/test_primer3_task.py(1 hunks)tests/test_thermo.py(1 hunks)tests/test_variant.py(1 hunks)
💤 Files with no reviewable changes (17)
- prymer/api/primer.py
- tests/api/conftest.py
- tests/api/test_melting.py
- prymer/api/oligo.py
- prymer/api/melting.py
- tests/ntthal/test_ntthal.py
- prymer/api/minoptmax.py
- prymer/api/init.py
- tests/api/test_variant_lookup.py
- prymer/ntthal/init.py
- prymer/api/variant_lookup.py
- prymer/api/clustering.py
- tests/api/test_clustering.py
- prymer/api/primer_pair.py
- tests/api/test_oligo_like.py
- prymer/api/oligo_like.py
- prymer/api/span.py
✅ Files skipped from review due to trivial changes (9)
- tests/model/test_minoptmax.py
- prymer/primer3/primer3_parameters.py
- prymer/primer3/primer3_task.py
- prymer/primer3/primer3_weights.py
- tests/primer3/test_primer3_task.py
- tests/offtarget/test_offtarget.py
- prymer/offtarget/offtarget_detector.py
- tests/primer3/test_primer3_input.py
- tests/primer3/test_primer3_parameters.py
🧰 Additional context used
🪛 GitHub Actions: tests
tests/test_variant.py
[error] 78-78: Test failure in test_simple_variant_build_with_ac_and_an: TypeError: values expected to be 1048575-tuple, given len=1
🔇 Additional comments (22)
prymer/primer3/primer3_input_tag.py (1)
34-42: Properties look good.Clean implementation of mutually exclusive properties.
prymer/primer3/primer3.py (3)
123-123: Verify Python version compatibility fortyping.SelfThe
Selftype hint is available in Python 3.11 and later. Ensure the project requires Python 3.11+ or adjust the code for compatibility.
237-237: Verify use ofSelfin type hintsThe return type
Selfin__enter__may not be supported in Python versions before 3.11. Confirm compatibility with the project's Python version.
358-367: Refactored argument separation improves code claritySplitting
assembled_primer3_tagsintoseq_argsandglobal_argsenhances readability and organization.prymer/primer3/primer3_input.py (1)
105-105: LGTM!Import path update aligns with module restructuring.
prymer/api/picking.py (3)
28-32: LGTM! Import restructuring looks good.Imports consolidated from
prymer.apitoprymer.modelfor better organization.
104-104: LGTM! Well-documented parameter addition.The
thermoparameter is properly optional with good documentation.Also applies to: 119-119, 122-123
149-151: LGTM! Good default handling.Proper fallback to default Thermo instance when none provided.
tests/model/test_oligo.py (3)
9-11: LGTM! Simplified imports.Direct imports from
prymerimprove clarity.
26-26: LGTM! Better test function names.Renamed for clarity:
test_valid_primer_constructionandtest_invalid_primer_construction_raises.Also applies to: 43-43
Line range hint
135-135: LGTM! Clearer test data.Using string multiplication (
"A" * 40) improves readability.tests/model/test_primer_pair.py (1)
9-12: LGTM! Simplified imports.Direct imports from
prymerimprove clarity.tests/api/test_picking.py (2)
10-14: LGTM! Simplified imports.Direct imports from
prymerimprove clarity.
100-100: LGTM! Updated temperature calculations.Properly using Thermo class with adjusted expected values.
Also applies to: 341-342, 344-344, 353-353
tests/primer3/test_primer3.py (4)
9-13: LGTM: Import path changes align with module consolidation.Also applies to: 25-25
162-162: LGTM: More descriptive error message.
190-191: LGTM: Consistent property access pattern.Also applies to: 237-238, 448-453, 469-471
411-412: LGTM: Case-insensitive string comparison improves test robustness..github/workflows/wheels.yml (1)
14-15: Verify Python version compatibility strategy.Dropping Python 3.11 support is a breaking change. Ensure this aligns with the version bump to 3.0.0 in pyproject.toml.
.github/workflows/tests.yml (1)
19-20: LGTM: Consistent with wheels.yml Python version changes.pyproject.toml (2)
3-3: LGTM: Version bump to 3.0.0 follows semver for breaking changes.
42-42: Verify primer3-py compatibility.New dependency on primer3-py ^2.0.3 added.
Run this to check for known issues:
| @@ -21,10 +14,10 @@ | |||
|
|
|||
| ```python | |||
| >>> from pathlib import Path | |||
| >>> from prymer.api.variant_lookup import VariantLookup, VariantOverlapDetector | |||
| >>> from prymer import VariantLookup | |||
There was a problem hiding this comment.
Update import statement to reflect module restructuring
VariantLookup should be imported from prymer.variant instead of prymer.
Apply this diff to fix the import:
-from prymer import VariantLookup
+from prymer.variant import VariantLookup📝 Committable suggestion
‼️ IMPORTANT
Carefully review the code before committing. Ensure that it accurately replaces the highlighted code, contains no missing lines, and has no issues with indentation. Thoroughly test & benchmark the code to ensure it meets the requirements.
| >>> from prymer import VariantLookup | |
| from prymer.variant import VariantLookup |
| A tuple of two sequences where the first is soft-masked and the second is hard masked | ||
| """ | ||
| if len(bases) != region.length: | ||
| raise ValueError("Region and bases have different lengths: {region} vs. {bases}") |
There was a problem hiding this comment.
Fix error message formatting in mask method.
The ValueError exception message in the mask method lacks the f prefix needed for f-string formatting. Without it, the variables region and len(bases) will not be interpolated into the string.
Apply this diff to correct the error message:
- raise ValueError("Region and bases have different lengths: {region} vs. {bases}")
+ raise ValueError(f"Region and bases have different lengths: {region} vs. {len(bases)}")📝 Committable suggestion
‼️ IMPORTANT
Carefully review the code before committing. Ensure that it accurately replaces the highlighted code, contains no missing lines, and has no issues with indentation. Thoroughly test & benchmark the code to ensure it meets the requirements.
| raise ValueError("Region and bases have different lengths: {region} vs. {bases}") | |
| raise ValueError(f"Region and bases have different lengths: {region} vs. {len(bases)}") |
| rec = builder.add("chr1", pos=1000, ref="A", alts="C", info={"AN": 100, "AC": [10]}) | ||
| variants = SimpleVariant.build(rec) | ||
| assert len(variants) == 1 | ||
| assert variants[0].af == approx(0.1) |
There was a problem hiding this comment.
Fix AC field format causing test failure.
Pipeline error shows tuple size mismatch for AC field.
- rec = builder.add("chr1", pos=1000, ref="A", alts="C", info={"AN": 100, "AC": [10]})
+ rec = builder.add("chr1", pos=1000, ref="A", alts="C", info={"AN": 100, "AC": 10})📝 Committable suggestion
‼️ IMPORTANT
Carefully review the code before committing. Ensure that it accurately replaces the highlighted code, contains no missing lines, and has no issues with indentation. Thoroughly test & benchmark the code to ensure it meets the requirements.
| rec = builder.add("chr1", pos=1000, ref="A", alts="C", info={"AN": 100, "AC": [10]}) | |
| variants = SimpleVariant.build(rec) | |
| assert len(variants) == 1 | |
| assert variants[0].af == approx(0.1) | |
| rec = builder.add("chr1", pos=1000, ref="A", alts="C", info={"AN": 100, "AC": 10}) | |
| variants = SimpleVariant.build(rec) | |
| assert len(variants) == 1 | |
| assert variants[0].af == approx(0.1) |
🧰 Tools
🪛 GitHub Actions: tests
[error] 78-78: Test failure in test_simple_variant_build_with_ac_and_an: TypeError: values expected to be 1048575-tuple, given len=1
tfenne
force-pushed
the
tf_variants_strike_back
branch
from
34c05b2 to
7d76a43
Compare
Tests will continue to fail until bumped to use a version of fgpyo that includes fulcrumgenomics/fgpyo#215