Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

Sign up for GitHub

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

bioperl testing #642

Merged
merged 3 commits into from
Jun 18, 2016
Merged

bioperl testing #642

Show file tree
Hide file tree
Changes from all commits
Commits
Show all changes
3 commits
Select commit Hold shift + click to select a range
40a02ce
bioperl testing
bgruening Mar 5, 2016
c3fc744
update test data
bgruening Jun 18, 2016
f48e4ac
Remove duplicated line
bgruening Jun 18, 2016
File filter

Filter by extension

Filter by extension
Conversations
Failed to load comments.
Loading
Jump to
Jump to file
Failed to load files.
Loading
Diff view
Diff view
1 change: 0 additions & 1 deletion .tt_blacklist
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,5 +1,4 @@
tools/art
tools/bioperl
tools/blastxml_to_gapped_gff3
tools/bwtool
tools/deseq2
Expand Down
2 changes: 2 additions & 0 deletions tools/bioperl/macros.xml
View file
Open in desktop
Original file line number Diff line number Diff line change
Expand Up @@ -2,6 +2,8 @@
<xml name="requirements">
<requirements>
<requirement type="package" version="1.6.922">bioperl</requirement>
<!-- conda bioperl dependency -->
<requirement type="package" version="1.6.924">perl-bioperl</requirement>
<yield/>
</requirements>
</xml>
Expand Down
5 changes: 4 additions & 1 deletion tools/bioperl/test-data/seq.gb.0.gff
View file
Open in desktop
Original file line number Diff line number Diff line change
@@ -1,10 +1,12 @@
# Input: /tmp/tmp1YCbBQ/files/000/dataset_1.dat
##gff-version 3
##sequence-region NC_014662 1 165540
# conversion-by bp_genbank2gff3.pl
# organism Enterobacteria phage CC31
# Note Enterobacteria phage CC31, complete genome.
# date 12-NOV-2010
NC_014662 GenBank region 1 165540 . + 1 ID=NC_014662;Dbxref=BioProject:PRJNA60119,taxon:709484;Name=NC_014662;Note=Enterobacteria phage CC31%2C complete genome.,PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;comment1=PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;date=12-NOV-2010;host=Escherichia coli;mol_type=genomic DNA;organism=Enterobacteria phage CC31
# working on contig:NC_014662, Enterobacteria phage CC31, Enterobacteria phage CC31, complete genome., 12-NOV-2010
NC_014662 GenBank contig 1 165540 . + 1 ID=NC_014662;Dbxref=BioProject:PRJNA60119,taxon:709484;Name=NC_014662;Note=Enterobacteria phage CC31%2C complete genome.,PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;comment1=PROVISIONAL REFSEQ: This record has not yet been subject to final NCBI review. The reference sequence is identical to GU323318. COMPLETENESS: full length. ;date=12-NOV-2010;host=Escherichia coli;mol_type=genomic DNA;organism=Enterobacteria phage CC31
NC_014662 GenBank gene 1 2214 . - 1 ID=CC31p001;Dbxref=GeneID:9926434;Name=rIIA;locus_tag=CC31p001
NC_014662 GenBank mRNA 1 2214 . - 1 ID=CC31p001.t01;Parent=CC31p001
NC_014662 GenBank CDS 1 2214 . - 1 ID=CC31p001.p01;Parent=CC31p001.t01;Dbxref=GI:311992993,GeneID:9926434;Name=rIIA;codon_start=1;locus_tag=CC31p001;product=membrane-associated affects host membrane ATPase;protein_id=YP_004009859.1;transl_table=11;translation=length.737
Expand Down Expand Up @@ -1145,6 +1147,7 @@ NC_014662 GenBank gene 164610 165521 . - 1 ID=CC31p279;Dbxref=GeneID:9926433;Nam
NC_014662 GenBank mRNA 164610 165521 . - 1 ID=CC31p279.t01;Parent=CC31p279
NC_014662 GenBank CDS 164610 165521 . - 1 ID=CC31p279.p01;Parent=CC31p279.t01;Dbxref=GI:311993271,GeneID:9926433;Name=rIIB;codon_start=1;locus_tag=CC31p279;product=protector from prophage-induced early lysis;protein_id=YP_004010137.1;transl_table=11;translation=length.303
NC_014662 GenBank exon 164610 165521 . - 1 Parent=CC31p279.t01
# GFF3 saved to stdout2829
##FASTA
>NC_014662
TTACTCATCTTCATCTTTACCTTTTAAGGAAGGAGCGCTTTCCAGCGCTCTCATAATACG
Expand Down
Loading