Make nextclade tree

CHANGES.md

@@ -1,4 +1,5 @@
 # CHANGELOG
+* 9 May 2024: Create a N450 tree that can be used as part of a Nextclade dataset to assign genotypes to measles samples based on criteria outlined by the WHO [PR #28](https://github.com/nextstrain/measles/pull/28)
 * 25 April 2024: Add specific sequences and metadata to the measles trees, including WHO reference sequences, vaccine strains, and genotypes reported on NCBI [PR #26](https://github.com/nextstrain/measles/pull/26)
 * 10 April 2024: Add a single GH Action workflow to automate the ingest and phylogenetic workflows [PR #22](https://github.com/nextstrain/measles/pull/22)
 * 2 April 2024: Add nextstrain-automation build-configs for deploying the final Auspice dataset of the phylogenetic workflow [PR #21](https://github.com/nextstrain/measles/pull/21)

nextclade/README.md

@@ -0,0 +1,36 @@
+
+# Measles Nextclade Dataset Tree
+
+This workflow creates a phylogenetic tree that can be used as part of a Nextclade dataset to assign genotypes to measles samples based on [criteria outlined by the WHO](https://www.who.int/publications/i/item/WER8709). 
+
+The WHO has defined 24 measles genotypes based on N gene and H gene sequences from 28 reference strains. For new measles samples, genotypes can be assigned based on genetic similarity to the reference strains at the "N450" region (a 450 bp region of the N gene). 
+
+The tree created here includes N450 sequences for the 28 reference strains, along with other representative strains for each genotype. 
+
+The workflow includes the following steps:
+* Build a tree using samples from the `ingest` output, with the following sampling criteria:
+	* Exclude samples for which a genotype is NOT present on NCBI (indicated in the metadata column "genotype_ncbi")
+	* Force-include the following samples:
+		* WHO genotype reference strains
+		* Vaccine strains
+		* All available samples for genotypes that are poorly represented on NCBI (i.e., genotypes that have fewer than 10 samples on NCBI)
+	* Subsampling criteria:
+	  * group_by: "region genotype_ncbi year"
+      * subsample_max_sequences: 500
+	  * min_date: 1950
+      * min_length: 400
+* Assign genotypes to each sample and internal nodes of the tree with `augur clades`, using clade-defining mutations in `defaults/clades.tsv`
+* Provide the following coloring options on the tree:
+	* WHO reference strains ("True" or "False")
+	* Genotype assignment from `augur clades`
+	* Genotype assignment reported on NCBI
+
+## How to create a new tree:
+* Run the workflow: `nextstrain build .`
+* Inspect the output tree by comparing genotype assignments from the following sources:
+	* WHO reference strains
+	* `augur clades` output
+	* NCBI Datasets output
+* If unwanted samples are present in the tree, add them to `defaults/dropped_strains.tsv` and re-run the workflow
+* If any changes are needed to the clade-defining mutations, add changes to `defaults/clades.tsv` and re-run the workflow
+* Repeat as needed

nextclade/Snakefile

@@ -0,0 +1,24 @@
+configfile: "defaults/config.yaml" 
+
+rule all:
+    input:
+        auspice_json = "auspice/measles.json"
+
+include: "rules/prepare_sequences.smk"
+include: "rules/construct_phylogeny.smk"
+include: "rules/annotate_phylogeny.smk"
+include: "rules/export.smk"
+
+# Include custom rules defined in the config.
+if "custom_rules" in config:
+    for rule_file in config["custom_rules"]:
+
+        include: rule_file
+
+rule clean:
+    """Removing directories: {params}"""
+    params:
+        "results ",
+        "auspice"
+    shell:
+        "rm -rfv {params}"

nextclade/defaults/auspice_config.json

@@ -0,0 +1,62 @@
+{
+  "title": "Real-time tracking of measles virus evolution",
+  "maintainers": [
+    {"name": "Kim Andrews", "url": "https://bedford.io/team/kim-andrews/"},
+    {"name": "the Nextstrain team", "url": "https://nextstrain.org/team"}
+  ],
+  "build_url": "https://github.com/nextstrain/measles",
+  "colorings": [
+    {
+      "key": "gt",
+      "title": "Genotype",
+      "type": "categorical"
+    },
+    {
+      "key": "num_date",
+      "title": "Date",
+      "type": "continuous"
+    },
+    {
+      "key": "clade_membership",
+      "title": "MeV Genotype (Nextstrain)",
+      "type": "categorical"
+    },
+    {
+      "key": "region",
+      "title": "Region",
+      "type": "categorical"
+    },
+    {
+      "key": "country",
+      "title": "Country",
+      "type": "categorical"
+    },
+    {
+      "key": "genotype_ncbi",
+      "title": "MeV Genotype (GenBank metadata)",
+      "type": "categorical"
+    },
+    {
+      "key": "is_reference",
+      "title": "WHO Reference",
+      "type": "categorical"
+    }
+  ],
+  "geo_resolutions": [
+    "country",
+    "region"
+  ],
+  "display_defaults": {
+    "map_triplicate": true,
+    "color_by": "clade_membership"
+  },
+  "filters": [
+    "clade_membership",
+    "region",
+    "country",
+    "author"
+  ],
+  "metadata_columns": [
+    "author"
+  ]
+}

nextclade/defaults/clades.tsv

@@ -0,0 +1,64 @@
+clade	gene	site	alt
+A	nuc	89	A
+A	nuc	126	A
+A	nuc	422	T
+A	nuc	439	A
+B1	nuc	36	G
+B1	nuc	79	G
+B1	nuc	111	T
+B1	nuc	261	A
+B1	nuc	279	G
+B2	nuc	323	T
+B3	nuc	351	C
+C1	nuc	75	C
+C1	nuc	246	T
+C1	nuc	317	T
+C1	nuc	354	A
+C2	nuc	81	A
+C2	nuc	118	T
+D1	nuc	23	G
+D1	nuc	45	C
+D1	nuc	330	T
+D10	nuc	123	G
+D10	nuc	218	T
+D10	nuc	323	G
+D10	nuc	444	A
+D11	nuc	54	A
+D11	nuc	214	T
+D2	nuc	207	G
+D2	nuc	255	C
+D2	nuc	15	A
+D2	nuc	250	A
+D3	nuc	21	C
+D3	nuc	186	C
+D3	nuc	275	C
+D3	nuc	287	T
+D4	nuc	133	A
+D4	nuc	367	T
+D4	nuc	416	T
+D5	nuc	48	G
+D5	nuc	105	C
+D6	nuc	316	A
+D7	nuc	339	C
+D7	nuc	343	C
+D8	nuc	226	A
+D8	nuc	251	T
+D9	nuc	216	A
+E	nuc	224	T
+E	nuc	329	A
+E	nuc	341	A
+F	nuc	222	A
+F	nuc	297	T
+F	nuc	332	T
+G1	nuc	27	T
+G1	nuc	177	G
+G1	nuc	419	T
+G2	nuc	242	A
+G2	nuc	271	G
+G3	nuc	3	A
+H1	nuc	126	C
+H1	nuc	224	A
+H2	nuc	84	A
+H2	nuc	171	A
+H2	nuc	245	A
+H2	nuc	387	T

nextclade/defaults/colors.tsv

@@ -0,0 +1,59 @@
+# Regions: These fields are identical to those in phylogenetic/defaults/colors.tsv. Any changes to one should also be made to the other.
+region	Asia	#447CCD
+region	Oceania	#5EA9A1
+region	Africa	#8ABB6A
+region	Europe	#BEBB48
+region	South America	#E29E39
+region	North America	#E2562B
+#
+# MeV Genotypes reported in NCBI GenBank metadata: These fields are identical to those in phylogenetic/defaults/colors.tsv. Any changes to one should also be made to the other.
+genotype_ncbi	A	#5E1D9D
+genotype_ncbi	B1	#4B26B1
+genotype_ncbi	B2	#4138C3
+genotype_ncbi	B3	#3F4FCC
+genotype_ncbi	C1	#4065CF
+genotype_ncbi	C2	#447ACD
+genotype_ncbi	D1	#4A8BC3
+genotype_ncbi	D2	#529AB6
+genotype_ncbi	D3	#5BA6A6
+genotype_ncbi	D4	#66AE95
+genotype_ncbi	D5	#73B583
+genotype_ncbi	D6	#81B973
+genotype_ncbi	D7	#91BC64
+genotype_ncbi	D8	#A1BE58
+genotype_ncbi	D9	#B1BD4E
+genotype_ncbi	D10	#C0BA47
+genotype_ncbi	D11	#CEB541
+genotype_ncbi	E	#DAAD3D
+genotype_ncbi	F	#E19F3A
+genotype_ncbi	G1	#E68E36
+genotype_ncbi	G2	#E67832
+genotype_ncbi	G3	#E35F2D
+genotype_ncbi	H1	#DF4328
+genotype_ncbi	H2	#DB2823
+#
+# MeV Genotypes assigned by augur clades
+clade_membership	A	#5E1D9D
+clade_membership	B1	#4B26B1
+clade_membership	B2	#4138C3
+clade_membership	B3	#3F4FCC
+clade_membership	C1	#4065CF
+clade_membership	C2	#447ACD
+clade_membership	D1	#4A8BC3
+clade_membership	D2	#529AB6
+clade_membership	D3	#5BA6A6
+clade_membership	D4	#66AE95
+clade_membership	D5	#73B583
+clade_membership	D6	#81B973
+clade_membership	D7	#91BC64
+clade_membership	D8	#A1BE58
+clade_membership	D9	#B1BD4E
+clade_membership	D10	#C0BA47
+clade_membership	D11	#CEB541
+clade_membership	E	#DAAD3D
+clade_membership	F	#E19F3A
+clade_membership	G1	#E68E36
+clade_membership	G2	#E67832
+clade_membership	G3	#E35F2D
+clade_membership	H1	#DF4328
+clade_membership	H2	#DB2823

nextclade/defaults/config.yaml

@@ -0,0 +1,25 @@
+strain_id_field: "accession"
+files:
+    exclude: "defaults/dropped_strains.txt"
+    include: "defaults/include_strains.txt"
+    reference_N450: "defaults/measles_reference_N450.gb"
+    reference_N450_fasta: "defaults/measles_reference_N450.fasta"
+    clades: "defaults/clades.tsv"
+    colors: "defaults/colors.tsv"
+    auspice_config: "defaults/auspice_config.json"
+align_and_extract_N450:
+    min_length: 400
+    min_seed_cover: 0.01
+filter:
+    group_by: "region genotype_ncbi year"
+    subsample_max_sequences: 500
+    min_date: 1950
+    min_length: 400
+refine:
+    coalescent: "opt"
+    date_inference: "marginal"
+    clock_filter_iqd: 4
+ancestral:
+    inference: "joint"
+export:
+    metadata_columns: "strain division location"

nextclade/defaults/dropped_strains.txt

@@ -0,0 +1,31 @@
+HM562901 # temara.MOR/24.03
+HM562900 # Mvs/Toulon.FRA/08.07
+#
+# Incorrect genotypes reported on NCBI:
+KY941950
+KX610825
+KX603680
+KX455930
+KX420624
+KX024471
+KP856709
+KP734120
+KP734117
+KP056769
+KM017095
+KJ556875
+KJ556859
+KC139079
+JX556685
+JX556684
+JN005809
+GU937234
+AF410987
+#
+# Genotype assignment is ambiguous based on tree structure:
+KY678430
+AB453044
+#
+# Clock rate outliers:
+AB573812
+HM562905

nextclade/defaults/include_strains.txt

@@ -0,0 +1,53 @@
+# Vaccine strain information from Parks et al. Comparison of predicted amino acid
+# sequences of measles virus strains in the Edmonston vaccine lineage
+# https://doi.org/10.1128/jvi.75.2.910-920.2001
+AF266288
+AF266287
+AF266290
+AF266289
+AF266291
+AF266286
+#
+# WHO genotype reference strains
+# Information from https://www.who.int/publications/i/item/WER8709
+AF045212
+AF045217
+AF079555
+AF171232
+AF243450
+AF280803
+AF481485
+AJ232203
+AY037020
+AY043459
+AY184217
+AY923185
+D01005
+GU440571
+L46750
+L46753
+L46758
+M89921
+U01974
+U01976
+U01977
+U01987
+U01994
+U01998
+U64582
+X84865
+X84872
+X84879
+#
+# Rare genotypes
+# Including these to boost representation of these genotypes in the nextclade tree
+AF410989  #Rare genotype: E
+MG912591  #Rare genotype: G2
+AY037009  #Rare genotype: G2
+AY037043  #Rare genotype: H2
+AY037026  #Rare genotype: H2
+AY037028  #Rare genotype: D2
+FJ668380  #Rare genotype: D10
+MN017369  #Rare genotype: D11
+KC968467  #Rare genotype: D11
+KC968354  #Rare genotype: D11

nextclade/defaults/measles_reference_N450.fasta

@@ -0,0 +1,8 @@
+>lcl|NC_001498.1_cds_NP_056918.1_1 [gene=N] [locus_tag=MeVgp1] [db_xref=GeneID:1489804] [protein=nucleocapsid protein] [protein_id=NP_056918.1] [location=1233..1682] [gbkey=CDS]
+GTCAGTTCCACATTGGCATCCGAACTCGGTATCACTGCCGAGGATGCAAGGCTTGTTTCAGAGAT
+TGCAATGCATACTACTGAGGACAGGATCAGTAGAGCGGTCGGACCCAGACAAGCCCAAGTGTCATTTCTA
+CACGGTGATCAAAGTGAGAATGAGCTACCAGGATTGGGGGGCAAGGAAGATAGGAGGGTCAAACAGGGTC
+GGGGAGAAGCCAGGGAGAGCTACAGAGAAACCGGGTCCAGCAGAGCAAGTGATGCGAGAGCTGCCCATCC
+TCCAACCAGCATGCCCCTAGACATTGACACTGCATCGGAGTCAGGCCAAGATCCGCAGGACAGTCGAAGG
+TCAGCTGACGCCCTGCTCAGGCTGCAAGCCATGGCAGGAATCTTGGAAGAACAAGGCTCAGACACGGACA
+CCCCTAGGGTATACAATGACAGAGATCTTCTAGAC